The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013653	Paenibacillus sp. 32O-W chromosome, complete genome	5375858	20573	78431	5375858	coat,holin,tail,plate,integrase	Clostridium_phage(31.25%)	55	77469:77492	78665:78688
WP_062489163.1|20573_20936_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_062489165.1|21044_23279_-	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_062489167.1|23374_23950_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082654979.1|24255_25092_-	hypothetical protein	NA	Q0H257	Geobacillus_phage	48.9	6.9e-37
WP_062489169.1|25088_25538_-|holin	phage holin family protein	holin	D9ZNF2	Clostridium_phage	43.7	7.0e-20
WP_082654980.1|25643_25796_-	XkdX family protein	NA	NA	NA	NA	NA
WP_062489171.1|26266_27556_-	hypothetical protein	NA	S6B1J7	Thermus_phage	29.3	6.1e-24
WP_062489173.1|27559_27841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062489175.1|27837_28431_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_062489177.1|28423_29500_-|plate	baseplate J/gp47 family protein	plate	A0A0K2CP27	Brevibacillus_phage	47.7	9.7e-92
WP_062489179.1|29492_29897_-	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	42.1	2.7e-23
WP_062489180.1|29893_30187_-	DUF2577 domain-containing protein	NA	A0A0A7RTJ2	Clostridium_phage	41.7	3.5e-12
WP_062489182.1|30189_31158_-	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	51.9	1.2e-101
WP_062489184.1|31150_31822_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2CNM3	Brevibacillus_phage	49.8	1.5e-55
WP_145977116.1|31818_33723_-	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	30.0	2.4e-53
WP_062489188.1|34084_34495_-	XkdN-like protein	NA	A0A0A7RTY8	Clostridium_phage	31.2	1.4e-06
WP_062489190.1|34514_34979_-|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	58.1	1.5e-41
WP_062489192.1|34992_36309_-|tail	phage tail sheath protein	tail	S5MUG6	Brevibacillus_phage	50.8	2.1e-120
WP_160327742.1|36310_36475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062489194.1|36471_36900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062496333.1|37197_37809_-	RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
WP_062489196.1|38035_38449_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J245	uncultured_Caudovirales_phage	70.3	1.3e-17
WP_062489198.1|38461_38872_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	42.2	6.6e-17
WP_062489200.1|38935_39625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062489202.1|39621_40110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062489204.1|40330_40600_+	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	39.7	2.0e-06
WP_062489206.1|40606_41221_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_062489208.1|41309_43010_-	ABC-ATPase domain-containing protein	NA	NA	NA	NA	NA
WP_062489210.1|43142_43994_-	EamA family transporter	NA	NA	NA	NA	NA
WP_062496335.1|44198_45203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062489212.1|45229_46168_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_062489215.1|46178_47255_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.8	1.2e-33
WP_062489218.1|47264_48050_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_062489219.1|48053_48875_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_062489221.1|48899_49994_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_062496337.1|50020_50728_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062489223.1|50931_51699_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_062489224.1|51887_52868_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_062489226.1|52945_53881_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145977302.1|53970_55278_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_062489228.1|55554_56535_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_062489230.1|56539_57412_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_062489232.1|57408_59868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062489233.1|59877_60492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062489235.1|60488_61967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082655476.1|61980_62799_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_082654981.1|62850_63807_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_062489238.1|63813_66792_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_082654982.1|66888_68283_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_062489241.1|68793_69660_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_062489242.1|69991_71029_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_082655477.1|71093_71861_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_062489246.1|74814_76827_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_062489248.1|76839_77265_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
77469:77492	attL	TCGCACAACTGAACTTGTGCGACA	NA	NA	NA	NA
WP_062489250.1|77507_78431_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_062489250.1|77507_78431_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
78665:78688	attR	TGTCGCACAAGTTCAGTTGTGCGA	NA	NA	NA	NA
>prophage 2
NZ_CP013653	Paenibacillus sp. 32O-W chromosome, complete genome	5375858	498567	504918	5375858		Bacillus_phage(50.0%)	6	NA	NA
WP_062489959.1|498567_499251_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.1	8.2e-20
WP_062489962.1|499460_500984_-	HAMP domain-containing histidine kinase	NA	A0A1B0VMK3	Pseudomonas_phage	27.6	2.3e-14
WP_062496425.1|500990_501698_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.6	4.6e-26
WP_062489965.1|501874_502549_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.2	9.5e-29
WP_062496427.1|502578_503943_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.8	6.0e-14
WP_062489970.1|504003_504918_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.9	2.2e-44
>prophage 3
NZ_CP013653	Paenibacillus sp. 32O-W chromosome, complete genome	5375858	1739340	1789149	5375858	protease,transposase,tRNA	Moraxella_phage(20.0%)	39	NA	NA
WP_062491863.1|1739340_1740585_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	46.5	7.0e-86
WP_062491865.1|1740899_1741370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062491868.1|1741944_1742811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062491871.1|1742903_1744205_+	trigger factor	NA	NA	NA	NA	NA
WP_062491874.1|1744504_1745098_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	2.8e-56
WP_062491875.1|1745123_1746380_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.9	1.4e-150
WP_062491877.1|1746479_1747586_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_062491879.1|1747737_1749441_+|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	25.3	3.5e-19
WP_062491881.1|1749475_1751854_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	42.9	1.4e-178
WP_062491883.1|1751850_1752447_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_062491885.1|1752655_1753246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062491887.1|1753562_1753961_+	adenosylmethionine decarboxylase	NA	A0A222YVV4	Synechococcus_phage	37.7	5.3e-19
WP_082655131.1|1754197_1755583_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_082655132.1|1755902_1757621_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_062491889.1|1757613_1759191_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_062491891.1|1759187_1760201_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_062491893.1|1760357_1761662_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	26.9	3.9e-10
WP_082655133.1|1761677_1762631_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_062491895.1|1763309_1765070_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_062491897.1|1766930_1769588_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	42.0	1.5e-165
WP_062491899.1|1769616_1770990_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_082655134.1|1770996_1772397_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_062491900.1|1772553_1774107_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_062491902.1|1774164_1774407_+	DUF4321 domain-containing protein	NA	NA	NA	NA	NA
WP_062496631.1|1774430_1775081_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_062496635.1|1775161_1775851_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_062491904.1|1775893_1776928_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_062491906.1|1776961_1777846_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_062491908.1|1777842_1778367_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_062491911.1|1778430_1779090_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_062491913.1|1779093_1779885_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_062491915.1|1779892_1781041_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_062491917.1|1781133_1782090_+	D-2-hydroxyacid dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	35.9	9.3e-30
WP_062491918.1|1782252_1783221_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_062491920.1|1783213_1784110_+|protease	Zn-dependent protease	protease	NA	NA	NA	NA
WP_082655554.1|1784470_1785322_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_062491924.1|1785673_1786924_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_082655135.1|1787242_1788277_+|protease	FtsH protease activity modulator HflK	protease	M1PGF9	Moumouvirus	19.6	2.7e-06
WP_062491926.1|1788273_1789149_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 4
NZ_CP013653	Paenibacillus sp. 32O-W chromosome, complete genome	5375858	1972006	2006800	5375858	capsid,holin,plate,integrase,terminase,portal	Aeribacillus_phage(21.21%)	50	1973044:1973059	2006548:2006563
WP_062492214.1|1972006_1973989_+	AAA family ATPase	NA	A0A1L2K2K3	Aeribacillus_phage	44.1	1.0e-134
1973044:1973059	attL	CGAGGTCGACGGCCGT	NA	NA	NA	NA
WP_082655151.1|1973992_1974910_+	recombinase	NA	A0A1L2JY28	Aeribacillus_phage	62.8	9.7e-101
WP_062492217.1|1974909_1975617_+	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	64.2	6.4e-84
WP_062492218.1|1975622_1975874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160327785.1|1975876_1976026_+	hypothetical protein	NA	A0A2H4J977	uncultured_Caudovirales_phage	50.0	1.1e-06
WP_062492220.1|1976050_1976899_+	DnaD domain protein	NA	A0A0K2CY85	Paenibacillus_phage	49.5	3.2e-58
WP_160327786.1|1976885_1977233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062496654.1|1977240_1978620_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.5	3.3e-100
WP_145977175.1|1978616_1978916_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	42.4	4.4e-10
WP_082655564.1|1978824_1979202_+	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	55.0	1.0e-24
WP_062492227.1|1979198_1979972_+	MmcB family DNA repair protein	NA	A0A2P1JTY9	Anoxybacillus_phage	45.6	9.8e-62
WP_062492231.1|1980219_1981026_+	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	45.6	3.3e-60
WP_062492233.1|1981019_1981271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062492241.1|1981914_1982394_+	hypothetical protein	NA	A0A076G7T6	Mycobacterium_phage	59.9	5.1e-45
WP_062492243.1|1982390_1982600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062492245.1|1982596_1983046_+	ASCH domain-containing protein	NA	A0A068CCC0	Rhizobium_phage	30.2	1.0e-10
WP_062492247.1|1983042_1983333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062492249.1|1983429_1983882_+	hypothetical protein	NA	A0A0C5AJ96	Bacteriophage	33.8	2.9e-13
WP_062492250.1|1984547_1984886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062492251.1|1984917_1985139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145977176.1|1985288_1985558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062492252.1|1985619_1986228_+|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	48.2	1.3e-40
WP_145977337.1|1986495_1987245_+	hypothetical protein	NA	D0R7J0	Paenibacillus_phage	48.0	1.2e-27
WP_062492254.1|1987216_1988506_+|terminase	PBSX family phage terminase large subunit	terminase	E5DV50	Deep-sea_thermophilic_phage	74.0	7.3e-187
WP_145977177.1|1988579_1989881_+|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	41.8	1.1e-84
WP_062492255.1|1989877_1991137_+	hypothetical protein	NA	E5DV54	Deep-sea_thermophilic_phage	40.0	2.7e-53
WP_160327787.1|1991438_1992110_+	DUF4355 domain-containing protein	NA	A0A0A7AQU8	Bacillus_phage	25.6	7.8e-07
WP_062492257.1|1992132_1993122_+|capsid	phage major capsid protein	capsid	A0A2K9V3F8	Faecalibacterium_phage	50.5	2.7e-80
WP_062492258.1|1993194_1993497_+	SAP domain-containing protein	NA	NA	NA	NA	NA
WP_062492259.1|1993493_1993919_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_062492260.1|1993893_1994394_+	hypothetical protein	NA	E5DV55	Deep-sea_thermophilic_phage	50.3	7.5e-39
WP_062492261.1|1994395_1994743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062492262.1|1994735_1995239_+	hypothetical protein	NA	A8ATH1	Listeria_phage	40.1	9.9e-15
WP_062492263.1|1995243_1996254_+	DUF3383 family protein	NA	A0A1L2JZ70	Aeribacillus_phage	47.5	7.7e-83
WP_062496659.1|1996275_1996671_+	DUF3277 family protein	NA	A0A1L2K2P1	Aeribacillus_phage	60.0	1.5e-34
WP_062492264.1|1996744_1997017_+	hypothetical protein	NA	D6PSY5	Lactobacillus_phage	43.7	3.4e-09
WP_062492265.1|1997172_1999164_+	hypothetical protein	NA	A0A0A7S0K9	Clostridium_phage	29.9	4.5e-26
WP_062492266.1|1999166_1999751_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4JD33	uncultured_Caudovirales_phage	32.1	1.4e-15
WP_062492267.1|1999752_2000055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062492268.1|2000051_2000852_+	hypothetical protein	NA	E5DV61	Deep-sea_thermophilic_phage	46.3	1.4e-66
WP_062492269.1|2000838_2001228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062492270.1|2001224_2001572_+	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_062492271.1|2001564_2002740_+|plate	baseplate J/gp47 family protein	plate	A0A1L2JY69	Aeribacillus_phage	53.9	7.0e-112
WP_062492272.1|2002736_2003375_+	hypothetical protein	NA	E5DV65	Deep-sea_thermophilic_phage	57.4	9.9e-60
WP_062492273.1|2003387_2004677_+	hypothetical protein	NA	A0A1L2K2Q1	Aeribacillus_phage	49.4	1.5e-11
WP_062492274.1|2004687_2005137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145977179.1|2005105_2005330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082655155.1|2005329_2005470_+	XkdX family protein	NA	NA	NA	NA	NA
WP_062492276.1|2005521_2005974_+|holin	phage holin family protein	holin	A0A0A7S099	Clostridium_phage	38.6	7.8e-19
WP_082655156.1|2005966_2006800_+	hypothetical protein	NA	Q0H257	Geobacillus_phage	47.2	1.2e-36
2006548:2006563	attR	CGAGGTCGACGGCCGT	NA	NA	NA	NA
>prophage 5
NZ_CP013653	Paenibacillus sp. 32O-W chromosome, complete genome	5375858	2560547	2566655	5375858		Staphylococcus_phage(57.14%)	7	NA	NA
WP_062492707.1|2560547_2560979_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	45.0	1.0e-20
WP_062492708.1|2561659_2562799_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.5	1.7e-54
WP_062492709.1|2562783_2563458_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.8	4.1e-32
WP_062492710.1|2563518_2564769_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	55.3	1.4e-121
WP_062492711.1|2564777_2565248_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.2	1.2e-43
WP_062492712.1|2565271_2566051_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	8.2e-08
WP_062492713.1|2566019_2566655_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	29.9	2.8e-14
>prophage 6
NZ_CP013653	Paenibacillus sp. 32O-W chromosome, complete genome	5375858	5126853	5137142	5375858		Prochlorococcus_phage(25.0%)	9	NA	NA
WP_062495974.1|5126853_5128401_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.6	4.5e-74
WP_062495976.1|5128451_5129063_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.9	2.7e-30
WP_062495978.1|5129062_5130106_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	45.6	2.7e-70
WP_062495979.1|5130182_5131664_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.6	2.5e-53
WP_062495981.1|5131648_5133892_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.8	1.4e-164
WP_062495983.1|5133869_5134565_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_062495985.1|5134568_5134811_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	33.8	5.3e-06
WP_062495986.1|5134931_5135825_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	34.6	2.4e-40
WP_062495989.1|5135840_5137142_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	26.2	1.3e-21
