The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013666	Xanthomonas oryzae pv. oryzae strain AXO1947 chromosome, complete genome	4674975	7549	59743	4674975	protease,transposase	Acidithiobacillus_phage(16.67%)	37	NA	NA
WP_024744592.1|7549_8386_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_024744593.1|8570_9377_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_024744594.1|9653_10847_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_053513954.1|11000_11669_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_014501265.1|11753_12515_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12561_12984_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_024743315.1|12987_13401_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_024743314.1|13696_14464_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_024743313.1|14474_14744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743312.1|14818_16279_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_082324079.1|17424_18801_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	1.9e-76
WP_082324080.1|19029_19908_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	1.5e-87
WP_107490060.1|19931_21033_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	1.1e-42
WP_024744007.1|21293_22421_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_024744008.1|23491_24832_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_010364746.1|25049_25742_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_008572943.1|25858_26179_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_024744009.1|27476_29000_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.0e-25
WP_033003570.1|29104_30340_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_024744011.1|30500_31157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053512972.1|31319_33131_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_024744014.1|33278_33629_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_024744015.1|33935_35066_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_053512973.1|35848_36901_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_033003579.1|37601_38675_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_024744018.1|38983_40042_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.9e-77
WP_131091728.1|42307_42652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744291.1|43011_44493_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024744290.1|44687_49160_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_024744289.1|49361_49742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324081.1|49888_51076_+	DNA topoisomerase IB	NA	A0A0U2TSJ7	Niemeyer_virus	35.3	1.3e-41
WP_024744287.1|51278_51584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744285.1|52719_53910_+	saccharopine dehydrogenase	NA	NA	NA	NA	NA
WP_024744284.1|54223_55009_-	DUF1868 domain-containing protein	NA	NA	NA	NA	NA
WP_033003662.1|55019_57608_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024744282.1|57780_58938_+	ROK family protein	NA	NA	NA	NA	NA
WP_101807022.1|58980_59743_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP013666	Xanthomonas oryzae pv. oryzae strain AXO1947 chromosome, complete genome	4674975	177859	273056	4674975	transposase,tRNA	Leptospira_phage(14.29%)	60	NA	NA
WP_158500219.1|177859_178681_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_082324386.1|180978_181194_-	putative modified peptide	NA	NA	NA	NA	NA
WP_033003412.1|181387_182572_+	putative peptide maturation dehydrogenase	NA	NA	NA	NA	NA
WP_024743700.1|182802_184887_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_024743701.1|184986_187014_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_024743703.1|187256_188867_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
WP_024743704.1|188877_190041_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_024743705.1|190169_190790_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743706.1|190841_191030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082325760.1|191351_192368_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_024743707.1|192762_193407_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_024711569.1|193685_194204_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_024743708.1|194475_196194_+	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_014505295.1|196284_196671_-	MerC family mercury resistance protein	NA	NA	NA	NA	NA
WP_053513753.1|196732_198058_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_053513755.1|198172_199486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743711.1|199584_200460_-	membrane protein	NA	NA	NA	NA	NA
WP_033003416.1|200526_201189_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024743713.1|201267_202362_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_024743714.1|202774_203233_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743715.1|203334_203763_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_024743716.1|204009_204876_-	DUF2884 family protein	NA	NA	NA	NA	NA
WP_014505303.1|205037_205454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419033.1|206193_209583_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_107490081.1|209639_210002_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_024745607.1|213562_213865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033004270.1|214021_214786_-	2,5-didehydrogluconate reductase DkgB	NA	A0A2H4PQR8	Staphylococcus_phage	33.9	4.2e-33
WP_107490052.1|214835_215867_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	8.7e-74
WP_053513535.1|215861_217382_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	31.4	3.3e-45
WP_082324093.1|217590_220305_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_053513537.1|220307_222008_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_053513533.1|222007_223267_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	25.8	1.7e-39
WP_024744969.1|223278_225243_-	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_024744968.1|225239_227435_-	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_024744967.1|227610_228678_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_107490044.1|228836_229868_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_053513079.1|229992_231330_-	xylose isomerase	NA	NA	NA	NA	NA
WP_024745612.1|231963_232881_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_024745613.1|232944_233850_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	33.2	1.4e-43
WP_024745614.1|234465_235251_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745615.1|235521_235980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745616.1|236060_236912_-	alpha/beta hydrolase	NA	R4JP33	Mycobacterium_phage	31.3	1.3e-06
WP_024745617.1|236914_237880_-	ferrochelatase	NA	NA	NA	NA	NA
WP_024745618.1|238033_238939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003484969.1|239011_239239_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_024745619.1|239254_239827_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_024745620.1|239823_240579_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_024745621.1|240731_241631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409712.1|241690_242443_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_082324099.1|243623_245000_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_154582574.1|245070_253374_+	hypothetical protein	NA	A0A1S5SDF1	Streptococcus_phage	32.0	1.3e-10
WP_024743461.1|253767_255582_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_024743462.1|255671_256580_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_024743463.1|256737_258996_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_024743464.1|258995_260585_+	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_033003342.1|260837_263597_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.8	9.3e-147
WP_024743466.1|263771_265553_+	outer membrane protein assembly factor	NA	NA	NA	NA	NA
WP_053513161.1|265549_269407_+	translocation/assembly module TamB	NA	NA	NA	NA	NA
WP_058419036.1|269670_270639_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_082324388.1|272069_273056_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.0e-99
>prophage 3
NZ_CP013666	Xanthomonas oryzae pv. oryzae strain AXO1947 chromosome, complete genome	4674975	772300	810356	4674975	transposase,tRNA	Staphylococcus_phage(21.43%)	32	NA	NA
WP_058419055.1|772300_773677_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_019303336.1|774655_775969_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	2.9e-13
WP_024743264.1|775958_776777_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024743263.1|777002_777944_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_024743262.1|777943_778690_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011407612.1|779070_780126_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011407613.1|780181_781069_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_024743261.1|781065_781623_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.1	1.7e-44
WP_024743260.1|781619_782528_+	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	33.8	5.4e-27
WP_024743259.1|782644_784048_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.8	1.6e-41
WP_011407616.1|784093_785440_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_024743258.1|785573_786305_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_024743257.1|786304_786943_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_024743256.1|786966_789702_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_053513020.1|789811_791461_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_024743254.1|791577_792186_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	34.6	1.8e-23
WP_107490068.1|792644_793442_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024743661.1|793585_794230_-	ABC transporter	NA	NA	NA	NA	NA
WP_024743660.1|794226_795153_-	MCE family protein	NA	NA	NA	NA	NA
WP_024743659.1|795155_795998_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.5	2.4e-13
WP_014504620.1|796083_797196_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024743658.1|797365_798625_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_024743657.1|798702_799164_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_024743656.1|799306_801001_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_024743655.1|801112_801517_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_024743654.1|801648_802422_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_024743653.1|802432_802900_+	alanine acetyltransferase	NA	NA	NA	NA	NA
WP_024743652.1|802896_803379_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_107490067.1|803937_805039_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.5e-42
WP_082324130.1|805239_806256_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_082324130.1|807609_808626_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_058419055.1|808979_810356_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
>prophage 4
NZ_CP013666	Xanthomonas oryzae pv. oryzae strain AXO1947 chromosome, complete genome	4674975	866419	994049	4674975	transposase,protease	Ralstonia_phage(25.0%)	93	NA	NA
WP_107490066.1|866419_867224_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.1	9.1e-10
WP_024744618.1|867676_869329_-|protease	serine protease	protease	NA	NA	NA	NA
WP_024744619.1|869321_869711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744620.1|870306_870729_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.2	1.0e-41
WP_058419057.1|870930_871899_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_024743105.1|872211_872727_+	peptide deformylase	NA	NA	NA	NA	NA
WP_024745622.1|875525_876272_+	cellulase	NA	NA	NA	NA	NA
WP_053513521.1|876887_878489_-	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_053513523.1|878849_879176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513519.1|879479_880760_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_024745631.1|884091_885018_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_053513517.1|885078_885855_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_024745633.1|886157_886829_-	methyltransferase	NA	NA	NA	NA	NA
WP_024745634.1|887150_887801_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_053513515.1|887800_889072_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_024745636.1|889225_890317_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_024745637.1|890316_891579_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_024745638.1|891731_892412_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_024745639.1|892578_894495_-	amylosucrase	NA	NA	NA	NA	NA
WP_024745640.1|894529_896974_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024745641.1|897241_898573_+	MFS transporter	NA	NA	NA	NA	NA
WP_058419058.1|898811_900188_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
WP_024745642.1|900319_901351_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_024745644.1|901610_902351_-	acetoacetyl-CoA reductase	NA	NA	NA	NA	NA
WP_024745645.1|902465_903794_-	CitMHS family transporter	NA	NA	NA	NA	NA
WP_024745646.1|904020_905214_-	porin	NA	NA	NA	NA	NA
WP_024745647.1|905469_906171_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024745648.1|906163_907549_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	23.7	2.4e-10
WP_024745649.1|908637_909276_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024745650.1|910347_910953_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_012445886.1|911263_912166_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513346.1|912157_912937_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024745652.1|912933_914283_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.3	1.3e-61
WP_024745653.1|914598_917244_-	response regulator	NA	B5LWN0	Feldmannia_species_virus	27.7	5.8e-13
WP_024745654.1|917565_918738_-	porin	NA	NA	NA	NA	NA
WP_024745655.1|919033_920407_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011257960.1|920604_922914_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_024745657.1|923089_923254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058419059.1|924604_925573_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_082324422.1|926303_926666_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058419060.1|927848_929225_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_053513990.1|929772_931038_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_158500220.1|931461_931608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158500221.1|931643_931808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324141.1|931872_932292_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_082324142.1|932292_932439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107490031.1|932473_933505_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_053513039.1|933501_933840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324143.1|933755_934772_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	3.3e-49
WP_058419061.1|934953_935922_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
WP_024744251.1|936452_936650_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_053513052.1|936660_937773_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_053513051.1|937753_939088_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_053513050.1|939320_940241_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	NA	NA	NA	NA
WP_024744247.1|940317_941634_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_053513049.1|941908_943288_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_024744245.1|943308_943965_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_024744244.1|944094_944748_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513047.1|946536_947421_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513046.1|947541_948990_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_024744240.1|949057_949705_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_024744239.1|949701_950487_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024744238.1|950523_951597_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_024744237.1|951920_953483_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
WP_033003654.1|953479_954604_-	threonine dehydratase	NA	NA	NA	NA	NA
WP_024744235.1|954679_954937_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_024744234.1|954920_956642_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	8.0e-64
WP_011257812.1|956685_957687_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_024744233.1|958968_960846_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_053513045.1|961270_963622_+	biopolymer transporter Tol	NA	NA	NA	NA	NA
WP_024744231.1|963732_964626_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024744230.1|964674_967641_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.6	1.6e-40
WP_024744229.1|968254_969403_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_024744228.1|969516_970053_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	6.1e-47
WP_024744227.1|970249_970732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744226.1|971024_973052_-	sodium-translocating pyrophosphatase	NA	NA	NA	NA	NA
WP_033003651.1|973333_973825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419062.1|974093_975056_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_058419063.1|975177_976146_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
WP_024743786.1|976445_977702_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_019303282.1|977861_978425_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	2.1e-13
WP_033003466.1|978789_980148_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_024743788.1|980147_980744_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_024743789.1|980890_981775_+	membrane protein	NA	NA	NA	NA	NA
WP_024743790.1|982497_984585_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_024743791.1|984736_985396_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_101807229.1|985442_986241_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024744371.1|986296_986476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744370.1|986494_986899_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_033003697.1|986932_987250_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_053513858.1|988410_989637_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	24.2	9.9e-16
WP_024744368.1|989882_990500_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_101807228.1|993081_994049_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	2.5e-99
>prophage 5
NZ_CP013666	Xanthomonas oryzae pv. oryzae strain AXO1947 chromosome, complete genome	4674975	1118842	1136894	4674975	transposase,tRNA	Leptospira_phage(40.0%)	14	NA	NA
WP_107490946.1|1118842_1119868_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	3.3e-73
WP_024744436.1|1119902_1120334_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_024744435.1|1120394_1121108_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_101807223.1|1121728_1122526_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014504356.1|1122700_1122976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744856.1|1123234_1123576_+	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_053513666.1|1123633_1125496_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_053513667.1|1125571_1126330_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_024744855.1|1126631_1127426_-	thiazole synthase	NA	NA	NA	NA	NA
WP_024744854.1|1127788_1127989_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101807338.1|1131073_1132075_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	4.2e-97
WP_082324428.1|1132936_1134040_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.5	2.9e-43
WP_082324099.1|1134304_1135681_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_058419068.1|1135925_1136894_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
>prophage 6
NZ_CP013666	Xanthomonas oryzae pv. oryzae strain AXO1947 chromosome, complete genome	4674975	1433898	1521558	4674975	transposase,protease	Acidithiobacillus_phage(25.0%)	54	NA	NA
WP_058419078.1|1433898_1434867_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	4.3e-99
WP_158500224.1|1434979_1435297_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082324173.1|1435412_1436789_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_082324099.1|1437288_1438665_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_024743841.1|1439095_1439923_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_024743842.1|1439926_1442041_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	1.4e-33
WP_053513110.1|1442185_1444855_-	glycoside hydrolase family 3	NA	NA	NA	NA	NA
WP_024743843.1|1445063_1447745_-	glycoside hydrolase family 2 protein	NA	NA	NA	NA	NA
WP_053513111.1|1447766_1450217_-	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_024743845.1|1450614_1451682_-	glycosyl hydrolase	NA	A0A2P1CFB9	Microbacterium_phage	24.3	3.0e-08
WP_024743846.1|1451685_1453371_-	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_024743847.1|1453579_1456288_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_033003498.1|1456988_1458005_+	ROK family protein	NA	NA	NA	NA	NA
WP_053503746.1|1458306_1459041_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_053513112.1|1459031_1460450_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	NA	NA	NA	NA
WP_053513114.1|1460491_1461040_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_024743852.1|1461036_1461837_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_053513116.1|1462081_1463101_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_053513118.1|1463097_1463433_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	56.4	9.2e-25
WP_024743855.1|1463730_1464696_+	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	33.5	1.5e-22
WP_053513120.1|1464699_1465134_+	NfeD family protein	NA	NA	NA	NA	NA
WP_024743857.1|1465306_1466416_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_024743858.1|1466552_1466948_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_082324175.1|1467963_1468407_+	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
WP_033003500.1|1469093_1470473_-	serine hydrolase	NA	NA	NA	NA	NA
WP_024743861.1|1472452_1472806_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_024743862.1|1473200_1475675_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_024743863.1|1475671_1476595_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024743864.1|1476731_1477340_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743865.1|1477448_1480358_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.4	6.6e-26
WP_024743866.1|1480753_1481590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743867.1|1481743_1482634_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_024743868.1|1482708_1483446_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_024743869.1|1483448_1484495_+	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	42.6	1.3e-72
WP_024743870.1|1484454_1484883_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_082324178.1|1485310_1486687_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	2.0e-78
WP_024745718.1|1488291_1488936_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_024745717.1|1489011_1490616_-	peptide chain release factor 3	NA	NA	NA	NA	NA
WP_033004316.1|1490748_1491636_-	M23 family metallopeptidase	NA	S5M424	Bacillus_phage	30.6	3.0e-06
WP_053513864.1|1491966_1492998_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_024745714.1|1492994_1494212_+	O-succinylhomoserine (thiol)-lyase	NA	NA	NA	NA	NA
WP_024745713.1|1495979_1497362_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_024745712.1|1497449_1497683_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_033004309.1|1497768_1498158_-	excalibur calcium-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024745711.1|1498475_1499045_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_024745710.1|1499054_1499618_-	cytochrome b	NA	NA	NA	NA	NA
WP_024745709.1|1499614_1500277_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_024745708.1|1500373_1503949_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	4.6e-37
WP_024745707.1|1504248_1507806_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	30.7	8.3e-39
WP_082324180.1|1507871_1511438_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	33.3	7.7e-45
WP_101807335.1|1511931_1515480_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	33.3	2.6e-45
WP_024743889.1|1516815_1518747_+	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_053503777.1|1518913_1519267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419082.1|1520181_1521558_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	1.2e-62
>prophage 7
NZ_CP013666	Xanthomonas oryzae pv. oryzae strain AXO1947 chromosome, complete genome	4674975	1638285	1755972	4674975	coat,protease,transposase,tRNA	Ralstonia_phage(14.29%)	86	NA	NA
WP_024744130.1|1638285_1639632_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_024744131.1|1639658_1640849_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_024744132.1|1640851_1641679_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_024744133.1|1641675_1642437_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	1.4e-15
WP_011258697.1|1642454_1643012_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_011258698.1|1643193_1643916_-	UMP kinase	NA	NA	NA	NA	NA
WP_024744137.1|1645822_1646701_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_011258701.1|1646870_1647674_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_024744138.1|1648049_1648775_-	molecular chaperone	NA	NA	NA	NA	NA
WP_024744139.1|1648777_1649110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513289.1|1649156_1650191_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_024744141.1|1650187_1652539_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_024744142.1|1652555_1653326_-	molecular chaperone	NA	NA	NA	NA	NA
WP_033003618.1|1653334_1653859_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_024744144.1|1654177_1654954_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_053513287.1|1654950_1657560_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_024744146.1|1657576_1658773_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_024744147.1|1658769_1659240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744148.1|1659236_1659593_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_024744149.1|1659589_1660105_+	GNAT family N-acetyltransferase	NA	A0A1X9I687	Streptococcus_phage	36.9	1.6e-20
WP_024744150.1|1660109_1661240_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_024744151.1|1661534_1663229_+	asparagine synthase B	NA	A0A0P0C1V4	Ostreococcus_lucimarinus_virus	38.8	1.3e-87
WP_024744152.1|1663297_1664350_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_024744153.1|1664851_1666978_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_024744154.1|1667560_1669978_-	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_011408338.1|1670124_1670610_+	bacterioferritin	NA	NA	NA	NA	NA
WP_024744156.1|1671055_1673299_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.6	7.2e-81
WP_024744157.1|1673359_1674211_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024744158.1|1674333_1674774_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033003622.1|1674770_1676276_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_024744159.1|1676298_1677492_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_024744160.1|1677498_1679079_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_024744161.1|1679330_1679576_+	serine hydrolase	NA	NA	NA	NA	NA
WP_133260285.1|1679576_1680713_+	serine hydrolase	NA	NA	NA	NA	NA
WP_107490939.1|1680944_1681743_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_053513877.1|1682188_1684378_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_024745379.1|1684506_1686324_-	M14 family metallopeptidase	NA	NA	NA	NA	NA
WP_014503886.1|1687520_1688129_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_024745377.1|1688542_1688731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050588027.1|1688950_1689229_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_024745375.1|1689279_1690125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745374.1|1690191_1690692_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024745373.1|1690783_1691362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745372.1|1691523_1692030_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_024745371.1|1693543_1694257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324449.1|1694506_1694746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259009.1|1697203_1697689_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
WP_024745370.1|1697770_1698550_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_024745369.1|1698738_1700619_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.9	5.2e-24
WP_053513872.1|1700953_1702471_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_033004173.1|1702606_1703242_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_058419088.1|1704332_1705301_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.5e-99
WP_101836935.1|1705473_1706547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419089.1|1706868_1707837_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	5.6e-99
WP_058419090.1|1708955_1710332_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_024744839.1|1710475_1712707_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	59.7	1.5e-09
WP_024743055.1|1715325_1715811_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|1716038_1716254_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_024743056.1|1716504_1716984_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_024743057.1|1717115_1717544_-	cytochrome c	NA	NA	NA	NA	NA
WP_024743058.1|1717616_1718447_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_024743059.1|1718537_1719305_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_024743060.1|1719304_1719520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444392.1|1719665_1720457_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_024743061.1|1724523_1725162_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_024743062.1|1725337_1727278_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.8	2.6e-26
WP_024743063.1|1727494_1728049_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	34.1	1.2e-18
WP_024743064.1|1728270_1729701_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.6	3.8e-120
WP_024743065.1|1729803_1731222_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.5	3.3e-47
WP_101807075.1|1731229_1732028_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024743393.1|1732490_1733216_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.8e-09
WP_024743394.1|1735078_1736053_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.0	2.6e-19
WP_082324198.1|1739013_1740390_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	1.9e-76
WP_082324199.1|1740938_1742291_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_082324200.1|1742356_1743292_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_024743458.1|1743358_1743958_-	LysE family translocator	NA	NA	NA	NA	NA
WP_082324452.1|1743993_1744854_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_024743457.1|1744871_1745912_-	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_024743456.1|1745938_1747261_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_082324201.1|1747260_1748415_-	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_033003338.1|1748691_1748940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807049.1|1749918_1751021_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_130625332.1|1751399_1751825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033003395.1|1751943_1752636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324203.1|1753404_1754781_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_058419096.1|1755003_1755972_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
>prophage 8
NZ_CP013666	Xanthomonas oryzae pv. oryzae strain AXO1947 chromosome, complete genome	4674975	1938936	1992821	4674975	transposase,tRNA	uncultured_Mediterranean_phage(41.67%)	29	NA	NA
WP_058419098.1|1938936_1939887_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_107490971.1|1940039_1941059_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	8.8e-95
WP_058419036.1|1941222_1942191_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_053513388.1|1946287_1946584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745870.1|1946791_1948363_-	S8/S53 family peptidase	NA	A0A1V0SLL0	Klosneuvirus	37.6	4.7e-71
WP_053513389.1|1948826_1951184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513391.1|1951683_1954500_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	25.7	1.3e-47
WP_053513394.1|1954738_1959097_+	carbohydrate-binding protein	NA	NA	NA	NA	NA
WP_053513395.1|1959093_1960680_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_033004375.1|1961002_1963348_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_058419099.1|1965771_1967148_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	5.1e-61
WP_024743919.1|1967760_1969665_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.7	3.0e-112
WP_033003529.1|1969904_1970525_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_024743917.1|1970521_1971028_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.8	2.1e-25
WP_024743916.1|1971074_1971572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743914.1|1971803_1972088_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_024743913.1|1972084_1973878_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_024743912.1|1974231_1974864_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_024744453.1|1978646_1979768_+	phytase	NA	NA	NA	NA	NA
WP_053513215.1|1980635_1981343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513213.1|1981691_1983188_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_024744449.1|1983310_1983742_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_024744448.1|1983907_1984978_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_024744447.1|1985047_1986193_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_024744446.1|1986324_1986678_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_053513211.1|1986868_1988713_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_024744444.1|1988826_1989795_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	29.9	6.8e-28
WP_101838548.1|1990002_1991105_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	2.2e-43
WP_058419216.1|1991444_1992821_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	9.2e-63
>prophage 9
NZ_CP013666	Xanthomonas oryzae pv. oryzae strain AXO1947 chromosome, complete genome	4674975	2022681	2088558	4674975	transposase,tRNA,protease	Ralstonia_phage(23.08%)	44	NA	NA
WP_107490936.1|2022681_2023784_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	2.2e-43
WP_058419036.1|2024081_2025050_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_082324466.1|2025767_2027135_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	3.1e-79
WP_053512975.1|2027145_2027403_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_158500225.1|2027794_2027941_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_058419068.1|2031635_2032604_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_053513703.1|2032788_2033775_-	response regulator	NA	W8CYM9	Bacillus_phage	26.8	4.8e-05
WP_053513705.1|2033808_2037903_-	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	5.0e-56
WP_024743139.1|2038044_2039349_-	DUF445 family protein	NA	NA	NA	NA	NA
WP_024743140.1|2039519_2040374_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	38.7	3.2e-13
WP_053513707.1|2040538_2043670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513709.1|2043730_2045083_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_024743143.1|2045611_2047291_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_024743144.1|2047297_2048143_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_024743145.1|2048139_2050488_+	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_024743146.1|2050477_2050756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743147.1|2051057_2052338_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_053513711.1|2052643_2053948_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.9	5.0e-18
WP_033003186.1|2054030_2055347_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_024743150.1|2055346_2056726_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_024743152.1|2057372_2058758_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_058419102.1|2061377_2062346_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	3.6e-98
WP_024744783.1|2063194_2064397_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_024744782.1|2064393_2065980_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_024744781.1|2065984_2067478_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_024744780.1|2067623_2068757_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	7.4e-26
WP_024744779.1|2068885_2069797_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_024744778.1|2069793_2070642_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_033003835.1|2071116_2072481_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_024744776.1|2072632_2073634_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_024744775.1|2073649_2074930_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_024744774.1|2074926_2075805_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_024744773.1|2075899_2076418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744772.1|2076417_2076903_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_033003832.1|2076957_2077602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744771.1|2078032_2079019_-	PhoH family protein	NA	A0A1B2ICF6	Erwinia_phage	47.7	4.8e-45
WP_024744770.1|2079442_2080897_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_053513011.1|2081192_2081486_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_024744767.1|2082838_2083825_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_024744766.1|2084352_2084997_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_024744765.1|2084996_2086256_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_024744764.1|2086248_2087007_+	cytochrome c1	NA	NA	NA	NA	NA
WP_024744763.1|2087403_2088039_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_014503014.1|2088117_2088558_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.0	7.1e-25
>prophage 10
NZ_CP013666	Xanthomonas oryzae pv. oryzae strain AXO1947 chromosome, complete genome	4674975	2280251	2346284	4674975	plate,transposase	Planktothrix_phage(28.57%)	54	NA	NA
WP_024745094.1|2280251_2281172_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_024745095.1|2281796_2282456_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_024745096.1|2282508_2284425_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_024745097.1|2284527_2285247_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_024745098.1|2285243_2286251_-	glucokinase	NA	NA	NA	NA	NA
WP_024745099.1|2286247_2287678_-	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	1.7e-67
WP_024745100.1|2288100_2289198_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	5.7e-23
WP_024745101.1|2289326_2290199_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_082324477.1|2290142_2290409_+	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_024745102.1|2290468_2290864_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_024745103.1|2290860_2291247_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_014503502.1|2291280_2293071_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_082324243.1|2293074_2293284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745105.1|2293300_2294083_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011408531.1|2294193_2294442_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_033004030.1|2294392_2294845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010378794.1|2294868_2296110_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_024745107.1|2296102_2296837_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	2.9e-31
WP_024745108.1|2296861_2297059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745109.1|2297048_2298113_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_024745110.1|2298422_2300831_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_024745111.1|2300859_2301522_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_024745112.1|2301525_2301990_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_024745113.1|2301986_2303756_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	4.2e-52
WP_024745114.1|2303752_2304793_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_053513591.1|2305083_2305863_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_024745116.1|2305859_2306324_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_024745117.1|2306347_2307766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745118.1|2307762_2309619_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_014503486.1|2309618_2310251_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_033003585.1|2311213_2311984_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_024744020.1|2312353_2313646_+	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_024744021.1|2313629_2314892_-	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_024744022.1|2314903_2315335_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_024744023.1|2315393_2315759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513589.1|2315858_2316620_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_003489223.1|2316841_2317489_+	response regulator	NA	NA	NA	NA	NA
WP_024744025.1|2318083_2321782_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_024744026.1|2322192_2323179_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_053513611.1|2323211_2325005_-	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_012445383.1|2325890_2326313_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_019301510.1|2326309_2326666_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_024744029.1|2326754_2327354_+	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_024744030.1|2327367_2329194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419105.1|2329427_2330396_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.1e-98
WP_101807075.1|2334095_2334894_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024743901.1|2335238_2335745_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_024743900.1|2335737_2337252_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_024743899.1|2337351_2337855_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_024743898.1|2337890_2338724_+	ImpE protein	NA	NA	NA	NA	NA
WP_024743897.1|2338711_2339215_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_024743896.1|2339218_2341096_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_024743894.1|2342102_2344874_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	1.2e-77
WP_058419107.1|2345315_2346284_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	5.6e-99
>prophage 12
NZ_CP013666	Xanthomonas oryzae pv. oryzae strain AXO1947 chromosome, complete genome	4674975	2644573	2675961	4674975	transposase	Acidithiobacillus_phage(18.18%)	28	NA	NA
WP_058419058.1|2644573_2645950_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
WP_058419060.1|2646406_2647783_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_082324259.1|2647888_2648485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745515.1|2648498_2648840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745516.1|2648820_2649330_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	36.0	1.3e-09
WP_082324260.1|2649326_2649728_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_101807133.1|2649823_2651046_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	67.7	2.1e-103
WP_024744204.1|2652440_2652875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419068.1|2653358_2654327_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_082324483.1|2654482_2654761_+	hypothetical protein	NA	A0A0P0ZG22	Escherichia_phage	70.3	9.0e-34
WP_053513018.1|2655005_2658107_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743073.1|2658938_2659391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513014.1|2659645_2661865_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	28.6	3.7e-05
WP_130625354.1|2661866_2662802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133264024.1|2662386_2663379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033003138.1|2663381_2664089_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	1.4e-51
WP_130625355.1|2665049_2666000_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_082324262.1|2666000_2666729_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_014503259.1|2666817_2667558_+	flagellar motor protein	NA	NA	NA	NA	NA
WP_024743069.1|2667564_2668539_+	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_024743068.1|2668540_2669323_+	ParA family protein	NA	Q8JL10	Natrialba_phage	35.7	1.7e-13
WP_024743067.1|2669319_2670342_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_010375641.1|2670442_2670751_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_002806565.1|2670747_2671113_+	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_024743066.1|2671146_2673156_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_107490044.1|2673459_2674491_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_154221295.1|2674557_2674722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107490051.1|2675175_2675961_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP013666	Xanthomonas oryzae pv. oryzae strain AXO1947 chromosome, complete genome	4674975	2860058	2869946	4674975	tRNA	Escherichia_phage(16.67%)	7	NA	NA
WP_053513913.1|2860058_2860550_-	glycoside hydrolase family 104 protein	NA	D5LH07	Escherichia_phage	67.1	1.7e-56
WP_003481884.1|2862440_2862653_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_024745486.1|2862792_2865441_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.8	2.4e-83
WP_024745487.1|2865542_2866031_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_019300309.1|2866332_2867367_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.0	1.6e-112
WP_011408885.1|2867539_2868181_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_053513920.1|2868269_2869946_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.3	2.1e-37
>prophage 14
NZ_CP013666	Xanthomonas oryzae pv. oryzae strain AXO1947 chromosome, complete genome	4674975	2901121	2962692	4674975	transposase,tRNA,integrase	Leptospira_phage(25.0%)	51	2901943:2901963	2961885:2961905
WP_101807075.1|2901121_2901920_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
2901943:2901963	attL	AGAAGATCGTGAACAGGTTCT	NA	NA	NA	NA
WP_053513338.1|2902354_2903770_+	MFS transporter	NA	NA	NA	NA	NA
WP_024745160.1|2904078_2905800_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	34.6	1.8e-10
WP_053513339.1|2905893_2906952_-	serine kinase	NA	NA	NA	NA	NA
WP_024745158.1|2907084_2908605_+	radical SAM protein	NA	NA	NA	NA	NA
WP_053513340.1|2908694_2909909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745156.1|2910012_2911125_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_024745155.1|2911121_2912252_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_024745154.1|2912373_2913072_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024745153.1|2913068_2914304_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_024745152.1|2914316_2915159_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024745151.1|2915439_2916291_-	chain-length determining protein	NA	NA	NA	NA	NA
WP_024745150.1|2916336_2917470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513341.1|2917466_2918417_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_024745148.1|2918413_2919667_-	O-antigen translocase	NA	NA	NA	NA	NA
WP_033004058.1|2919663_2920776_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	28.1	1.9e-29
WP_024745146.1|2920775_2921708_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024745145.1|2921694_2922648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745144.1|2922651_2923323_-	acetyltransferase	NA	NA	NA	NA	NA
WP_024745143.1|2923319_2923751_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_024745142.1|2924145_2924676_+	cytochrome-c oxidase	NA	NA	NA	NA	NA
WP_024745141.1|2924759_2926100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745140.1|2926124_2926517_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_033004056.1|2926960_2927749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503710.1|2927812_2928394_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_024745138.1|2928390_2929047_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_053513343.1|2929043_2930369_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	36.7	4.0e-23
WP_024743095.1|2930379_2931138_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_024743094.1|2931134_2931341_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_024743093.1|2931337_2931808_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_024743092.1|2931871_2933860_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_024743091.1|2933856_2934399_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_024743090.1|2934398_2934896_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_033003148.1|2934895_2935597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743088.1|2935741_2937814_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_024743087.1|2937800_2939318_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_024743086.1|2939620_2939965_+	response regulator	NA	NA	NA	NA	NA
WP_024743886.1|2942357_2944469_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.2	1.3e-15
WP_058419126.1|2945843_2949437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107490965.1|2949493_2950595_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	7.2e-42
WP_082324282.1|2951147_2951489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017154976.1|2951482_2951725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033003336.1|2951820_2953311_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_024743446.1|2953862_2954879_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743447.1|2954978_2955563_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_024743448.1|2956023_2957415_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.6	1.0e-93
WP_024743449.1|2957526_2958189_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_058419031.1|2958310_2959279_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_024744617.1|2959709_2960177_+	TonB family protein	NA	NA	NA	NA	NA
WP_107490964.1|2960596_2961699_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_101807110.1|2961893_2962692_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
2961885:2961905	attR	AGAACCTGTTCACGATCTTCT	NA	NA	NA	NA
>prophage 15
NZ_CP013666	Xanthomonas oryzae pv. oryzae strain AXO1947 chromosome, complete genome	4674975	3010791	3141422	4674975	transposase,tRNA,protease	Ralstonia_phage(22.73%)	109	NA	NA
WP_024743628.1|3010791_3011718_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_011259735.1|3011797_3012190_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_024743629.1|3012333_3015048_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	21.6	2.9e-20
WP_024743630.1|3015143_3016655_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_019300413.1|3016659_3017250_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_053513478.1|3017724_3019185_-	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_024743632.1|3019221_3020724_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_053513480.1|3020744_3022904_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_005914274.1|3022911_3023217_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_033003391.1|3023213_3023873_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_003485557.1|3023880_3024369_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_024743635.1|3024372_3025464_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_024743636.1|3025460_3027695_-	NADH-quinone oxidoreductase subunit NuoG	NA	NA	NA	NA	NA
WP_053513482.1|3027691_3029026_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_024743637.1|3029029_3029557_-	NADH-quinone oxidoreductase subunit NuoE	NA	NA	NA	NA	NA
WP_024743638.1|3029553_3030861_-	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_053513484.1|3030857_3031610_-	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_010371165.1|3031646_3032201_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_014503798.1|3032191_3032548_-	NADH-quinone oxidoreductase subunit A	NA	NA	NA	NA	NA
WP_053513485.1|3032784_3033258_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_024743641.1|3033291_3034047_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_024743642.1|3034159_3034960_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024744613.1|3037241_3037670_-	group 1 truncated hemoglobin	NA	NA	NA	NA	NA
WP_024744612.1|3037669_3038542_-	DUF3034 family protein	NA	NA	NA	NA	NA
WP_024744611.1|3038538_3040905_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_024744610.1|3040901_3041585_-	methylamine utilization protein	NA	NA	NA	NA	NA
WP_024744609.1|3041794_3042733_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_024744608.1|3042855_3044205_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011259760.1|3044201_3045089_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_024744607.1|3045413_3046220_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_024744606.1|3046666_3047884_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_053513073.1|3047989_3048916_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	3.0e-09
WP_024744604.1|3049298_3049967_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_024744603.1|3049963_3050737_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_024744602.1|3050909_3051317_-	VOC family protein	NA	NA	NA	NA	NA
WP_162492476.1|3051313_3053266_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259769.1|3053840_3054866_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_024744600.1|3054949_3056023_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	24.1	1.2e-14
WP_024744599.1|3056015_3057119_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.7	1.4e-74
WP_024744598.1|3057129_3058056_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_019302734.1|3058136_3058787_+	SCO family protein	NA	NA	NA	NA	NA
WP_024744597.1|3058783_3059632_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_024744596.1|3060181_3061765_-	transglycosylase SLT domain-containing protein	NA	I1VXB7	Halocynthia_phage	30.6	4.7e-10
WP_024744595.1|3062059_3063565_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.4	5.5e-85
WP_082324290.1|3063584_3064163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324130.1|3064239_3065256_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_107490047.1|3065478_3066579_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.2	2.3e-40
WP_024744616.1|3066738_3067251_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_058419131.1|3067898_3068867_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	3.3e-99
WP_024745382.1|3068929_3070294_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_024745381.1|3070474_3071137_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_024711439.1|3071133_3071568_+	HIT family protein	NA	NA	NA	NA	NA
WP_058419036.1|3071922_3072891_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_024744529.1|3073461_3073647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744530.1|3073681_3074251_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	74.9	4.5e-72
WP_024744531.1|3074346_3075198_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_154221280.1|3075563_3076133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058419036.1|3076216_3077185_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_082324099.1|3077482_3078859_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_082324143.1|3079101_3080118_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	3.3e-49
WP_024743076.1|3080787_3082803_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_058419132.1|3083658_3084081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324291.1|3085198_3086224_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.5e-49
WP_058419134.1|3086807_3087776_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_024744749.1|3088026_3088725_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_024744748.1|3088765_3089062_-	cysteine methyltransferase	NA	NA	NA	NA	NA
WP_053514015.1|3090619_3091990_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.8	2.4e-34
WP_024745359.1|3091986_3093237_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024745358.1|3093244_3094489_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_024745357.1|3094717_3095197_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_024745356.1|3095307_3095844_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_024745355.1|3095953_3096703_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_024745354.1|3096910_3097402_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_024745353.1|3097648_3098485_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_024745352.1|3098494_3099835_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_024745351.1|3099977_3101684_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_024745350.1|3101717_3103022_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_024745349.1|3103053_3103314_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_024745348.1|3103315_3104191_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_101807075.1|3104302_3105101_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024744629.1|3105507_3106605_+|protease	protease	protease	NA	NA	NA	NA
WP_024744630.1|3106674_3107136_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_082324502.1|3107187_3107592_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_024744631.1|3107666_3109034_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_024744632.1|3109179_3109761_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_024744633.1|3110017_3111463_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_024744634.1|3111561_3112314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744635.1|3112319_3116240_-	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_024744636.1|3116380_3117880_-	ribonuclease G	NA	NA	NA	NA	NA
WP_024744637.1|3117879_3118452_-	Maf-like protein	NA	NA	NA	NA	NA
WP_024744638.1|3118590_3119325_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_024744639.1|3119791_3122902_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_033003769.1|3123212_3123887_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_024744641.1|3124324_3124795_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_053513280.1|3125884_3127000_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_011259822.1|3127011_3127428_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_024744645.1|3127484_3128384_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259823.1|3128380_3129409_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_024744646.1|3129431_3130067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744647.1|3130580_3133223_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	40.0	4.7e-172
WP_024744648.1|3133334_3133946_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_053513279.1|3134150_3135008_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.0e-11
WP_024744650.1|3135273_3135723_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_024744651.1|3136615_3136909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513278.1|3137382_3137616_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_053513276.1|3137666_3138653_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_082324504.1|3139344_3139758_+	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_024744656.1|3139836_3140130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419068.1|3140453_3141422_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
>prophage 16
NZ_CP013666	Xanthomonas oryzae pv. oryzae strain AXO1947 chromosome, complete genome	4674975	3174582	3232598	4674975	transposase,tRNA,protease	Acidithiobacillus_phage(25.0%)	38	NA	NA
WP_058419089.1|3174582_3175551_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	5.6e-99
WP_058419136.1|3177133_3178579_+	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	6.4e-14
WP_024744687.1|3178651_3179692_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_014502644.1|3179824_3180007_-	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_024744688.1|3180306_3180717_-	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_107490044.1|3185307_3186339_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_024743817.1|3190349_3190946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033004102.1|3191632_3192523_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_058419137.1|3192550_3193927_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	8.9e-74
WP_082324507.1|3194212_3195229_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
WP_101807094.1|3195337_3196482_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.9	1.2e-84
WP_024743593.1|3196645_3196849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743594.1|3197626_3198085_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_019302800.1|3198487_3198994_-	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743595.1|3199007_3200411_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_024743596.1|3200479_3201571_-	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
WP_053513785.1|3201592_3202477_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_024743598.1|3202595_3203207_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_024743600.1|3204152_3204965_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_162492468.1|3205096_3205405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033003388.1|3206495_3207404_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_014502625.1|3207828_3208371_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_024743602.1|3208766_3212231_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_131091743.1|3212462_3212690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258268.1|3212720_3213050_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_024743603.1|3213068_3215072_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_024743604.1|3215140_3217297_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.5	1.4e-09
WP_024743605.1|3217307_3217823_+	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_024743606.1|3217849_3219133_+	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_024743607.1|3219137_3219944_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_014502616.1|3219940_3221080_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_024742991.1|3222521_3223271_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_024742990.1|3223374_3224088_+	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_130625317.1|3224355_3225012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712501.1|3226327_3226789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053512931.1|3227743_3229975_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_024743650.1|3229974_3230571_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082324203.1|3231221_3232598_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
>prophage 17
NZ_CP013666	Xanthomonas oryzae pv. oryzae strain AXO1947 chromosome, complete genome	4674975	3314223	3367651	4674975	transposase	Ralstonia_phage(27.27%)	40	NA	NA
WP_058419145.1|3314223_3315192_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_003487850.1|3315585_3315978_+	PTS fructose IIA component family protein	NA	NA	NA	NA	NA
WP_005913389.1|3315970_3316240_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_024744437.1|3316298_3318029_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.1	1.0e-10
WP_024744438.1|3318316_3319678_+	magnesium transporter	NA	NA	NA	NA	NA
WP_024744439.1|3319834_3320632_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_024744440.1|3320692_3321709_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_058419147.1|3322829_3323798_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
WP_050588037.1|3324030_3325272_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	34.7	3.2e-54
WP_033004264.1|3325271_3326174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807086.1|3326130_3327585_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	41.0	9.0e-93
WP_053513783.1|3329534_3330923_-	amino acid permease	NA	NA	NA	NA	NA
WP_024745601.1|3331678_3332620_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_024745602.1|3332933_3333698_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024745603.1|3333890_3335273_+	APC family permease	NA	NA	NA	NA	NA
WP_024745604.1|3335714_3337112_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_082324518.1|3337701_3339078_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.3	1.1e-60
WP_024743419.1|3339209_3339608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743420.1|3339752_3340757_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_024743421.1|3340794_3342312_-	tryptophan 7-halogenase	NA	A0A1D7SF58	Cyanophage	31.8	5.8e-50
WP_053512962.1|3342352_3343399_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_024743423.1|3343409_3344162_-	SapC family protein	NA	NA	NA	NA	NA
WP_024743424.1|3344493_3347652_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743426.1|3348689_3350696_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_050587989.1|3352493_3352955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743427.1|3353317_3354484_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	41.6	6.4e-73
WP_024743428.1|3354485_3355058_-	DUF1190 domain-containing protein	NA	A0A191ZBZ0	Erwinia_phage	28.1	6.4e-10
WP_024743429.1|3355070_3355475_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_024743430.1|3355512_3356190_-	YjfK family protein	NA	NA	NA	NA	NA
WP_024743431.1|3356186_3357269_-	potassium channel protein	NA	NA	NA	NA	NA
WP_024743432.1|3357294_3358068_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_012445807.1|3358080_3358497_-	YjfI family protein	NA	NA	NA	NA	NA
WP_024743433.1|3358677_3359277_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_024743434.1|3359443_3359986_+	shikimate kinase	NA	NA	NA	NA	NA
WP_024743435.1|3359982_3361095_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_024743436.1|3361394_3361646_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_024743437.1|3361660_3362725_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_133264031.1|3363037_3363967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324099.1|3364085_3365462_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_107490046.1|3366549_3367651_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
>prophage 18
NZ_CP013666	Xanthomonas oryzae pv. oryzae strain AXO1947 chromosome, complete genome	4674975	3376562	3422594	4674975	plate,transposase	Leptospira_phage(30.77%)	35	NA	NA
WP_024743025.1|3376562_3377654_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_024743026.1|3377617_3379453_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011409203.1|3379455_3379944_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003467612.1|3380091_3380589_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011409204.1|3380730_3382227_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003467601.1|3382230_3382731_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_033003111.1|3382777_3383266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743027.1|3383651_3384260_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011259947.1|3384411_3385746_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_033003115.1|3385745_3386534_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_024744031.1|3389083_3389596_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_107490044.1|3389635_3390667_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_131091742.1|3390691_3391612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419090.1|3391945_3393322_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_133264997.1|3394387_3394864_+	hypothetical protein	NA	K4I3P0	Salmonella_phage	36.4	2.6e-12
WP_107490031.1|3394903_3395935_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_107490895.1|3395950_3396154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324099.1|3396374_3397751_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_133264026.1|3397778_3398264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419151.1|3398430_3399489_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	2.4e-74
WP_058419050.1|3399644_3400613_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_058419152.1|3401277_3402654_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	5.1e-61
WP_058419153.1|3402797_3404174_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	3.0e-77
WP_082324308.1|3405281_3406298_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	5.6e-49
WP_058419157.1|3406803_3409623_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.4	1.0e-52
WP_107490044.1|3409694_3410726_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_024745820.1|3411656_3412727_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_053513252.1|3412779_3413574_-	OmpA family protein	NA	NA	NA	NA	NA
WP_053513250.1|3413570_3414554_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_024745817.1|3414550_3418288_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_024745816.1|3418303_3419785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745815.1|3419844_3420105_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_024745814.1|3420212_3421091_-	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	34.5	3.9e-06
WP_024745813.1|3421290_3422022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807079.1|3422177_3422594_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP013666	Xanthomonas oryzae pv. oryzae strain AXO1947 chromosome, complete genome	4674975	3536609	3595770	4674975	transposase,protease	Acidithiobacillus_phage(11.76%)	52	NA	NA
WP_058419060.1|3536609_3537986_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024743505.1|3538573_3538927_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_024743506.1|3538923_3539883_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_024743507.1|3539879_3540953_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_024743508.1|3541013_3542369_-	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_024743509.1|3542539_3543775_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_010368407.1|3543916_3544156_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
WP_024743510.1|3544360_3545104_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.5	5.2e-12
WP_024743511.1|3545165_3546110_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_024743512.1|3546387_3546828_-	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_024743513.1|3547059_3548037_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_024743514.1|3548126_3548321_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_024743515.1|3548418_3548928_-	characterized ACR protein	NA	NA	NA	NA	NA
WP_024743516.1|3549040_3549616_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_053513146.1|3549720_3551514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743518.1|3551664_3553533_-	membrane protein	NA	NA	NA	NA	NA
WP_024743519.1|3553570_3554524_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_024743520.1|3554529_3555486_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_053513144.1|3555478_3557428_+	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_024743522.1|3557427_3557961_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_024743523.1|3558080_3558431_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011257913.1|3558532_3559126_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_005913896.1|3559223_3559544_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_053513142.1|3559550_3561647_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	3.1e-46
WP_053513140.1|3562017_3562509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807313.1|3562505_3563598_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	9.3e-42
WP_107490962.1|3563536_3564647_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	57.3	2.4e-85
WP_024743546.1|3565093_3565543_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_024743545.1|3565539_3565785_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_033003368.1|3565793_3566279_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_033003366.1|3566304_3566685_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_024743543.1|3566681_3567713_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_024743542.1|3567712_3568462_-	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	4.2e-09
WP_024743541.1|3568461_3569211_-	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_024743540.1|3569231_3570281_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011257902.1|3570491_3570896_-	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
WP_024745518.1|3572718_3573096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019302615.1|3573841_3574546_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_058419116.1|3574830_3576207_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
WP_024745454.1|3576500_3577235_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.6	1.1e-35
WP_011257888.1|3577243_3577696_-	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_024745453.1|3577723_3578380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745452.1|3578392_3579160_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_024745451.1|3579156_3580335_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_024745450.1|3581033_3583001_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_002806049.1|3583615_3583888_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_053513454.1|3584101_3586573_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	9.9e-225
WP_011257881.1|3586716_3588003_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_002806026.1|3588127_3588754_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_024745448.1|3588846_3590139_-	trigger factor	NA	NA	NA	NA	NA
WP_058419103.1|3592426_3593395_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_058419165.1|3594711_3595770_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.6e-73
>prophage 21
NZ_CP013666	Xanthomonas oryzae pv. oryzae strain AXO1947 chromosome, complete genome	4674975	3888235	3958720	4674975	transposase	Staphylococcus_phage(18.75%)	56	NA	NA
WP_101807055.1|3888235_3889034_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024743403.1|3889121_3890096_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_024743404.1|3890316_3890787_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_024743405.1|3890783_3891248_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	40.3	2.2e-24
WP_053513552.1|3891561_3892701_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	34.0	6.1e-52
WP_024743407.1|3892697_3893300_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	36.0	3.9e-26
WP_024743408.1|3893860_3894484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743409.1|3894539_3895649_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	2.4e-45
WP_024743410.1|3895645_3896131_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024743411.1|3896127_3896652_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_024743412.1|3896651_3897167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712241.1|3897180_3898434_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	1.6e-101
WP_024743413.1|3898619_3900950_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_154221260.1|3901158_3901440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743415.1|3901620_3902118_-	RcnB family protein	NA	NA	NA	NA	NA
WP_024743416.1|3902343_3904005_+	energy-dependent translational throttle protein EttA	NA	A0A1B0RXA0	Streptococcus_phage	28.6	1.3e-39
WP_024743417.1|3904186_3904525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324327.1|3904521_3904998_-	DUF4386 domain-containing protein	NA	NA	NA	NA	NA
WP_058419036.1|3905171_3906140_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_024744872.1|3906191_3906401_-	DUF4386 family protein	NA	NA	NA	NA	NA
WP_024744871.1|3906530_3907361_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_024744870.1|3907420_3907996_-	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
WP_024744869.1|3908064_3909174_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.4	3.8e-35
WP_024744868.1|3909238_3909514_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_024744866.1|3910649_3911750_-	glycosyltransferase	NA	A0A142BZU7	Faustovirus	28.5	9.8e-15
WP_024744865.1|3911828_3912608_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_053513043.1|3912604_3914104_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.1	3.6e-12
WP_053513042.1|3914136_3915057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712624.1|3915999_3916485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744863.1|3918907_3920272_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_024744862.1|3920487_3921183_+	VIT family protein	NA	NA	NA	NA	NA
WP_024744861.1|3921276_3921900_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_024744860.1|3922044_3922842_+	cytochrome c4	NA	NA	NA	NA	NA
WP_024744859.1|3922935_3923586_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_053513041.1|3923677_3924493_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_024744857.1|3924542_3925286_+	endonuclease	NA	NA	NA	NA	NA
WP_107490044.1|3925280_3926312_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_162492470.1|3926506_3926845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162492471.1|3926923_3928201_+	hypothetical protein	NA	A0A2I7QNT1	Vibrio_phage	25.8	3.4e-11
WP_058419068.1|3931733_3932702_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_024743539.1|3932922_3934155_+	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.5	2.3e-73
WP_024743537.1|3935368_3937411_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_024743536.1|3937412_3939311_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_024743535.1|3939312_3940566_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_024743534.1|3940562_3941168_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_024743533.1|3941672_3942827_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_024743532.1|3942829_3943858_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_024743531.1|3943864_3944932_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743530.1|3944972_3946250_-	sugar MFS transporter	NA	NA	NA	NA	NA
WP_050587991.1|3946294_3947062_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513078.1|3947276_3948443_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_053513077.1|3948576_3950973_-	alpha-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_053513076.1|3950969_3953864_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	2.0e-22
WP_053513075.1|3954014_3956723_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_107490082.1|3957601_3957700_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_058419161.1|3957751_3958720_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.3e-100
>prophage 22
NZ_CP013666	Xanthomonas oryzae pv. oryzae strain AXO1947 chromosome, complete genome	4674975	3991576	4060349	4674975	transposase,protease	Leptospira_phage(16.67%)	47	NA	NA
WP_053513544.1|3991576_3992608_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	7.9e-75
WP_024745755.1|3993085_3994204_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_053513805.1|3994200_3996261_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_024745753.1|3996264_3996750_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_053513808.1|3996746_3998081_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003482734.1|3998253_3999300_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.2	2.7e-06
WP_024745751.1|3999575_4000508_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_024745750.1|4000619_4001243_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_024745749.1|4001542_4002262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745748.1|4002434_4004447_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745747.1|4004568_4005459_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_024745746.1|4005631_4006393_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_024745745.1|4006479_4008129_+	MFS transporter	NA	NA	NA	NA	NA
WP_024745744.1|4009289_4009790_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024745743.1|4009786_4010242_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_024745742.1|4010444_4011812_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.5	4.7e-43
WP_024745741.1|4011916_4012468_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_024745740.1|4012983_4013901_-	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	28.1	1.7e-12
WP_024745739.1|4014094_4014766_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_024745738.1|4014762_4015617_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_024745737.1|4015606_4015849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745736.1|4015906_4016305_-	YbaN family protein	NA	NA	NA	NA	NA
WP_024745735.1|4016648_4018784_-	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	1.8e-28
WP_053513809.1|4018893_4020078_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_024745733.1|4020672_4022766_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_024745732.1|4022833_4023145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745731.1|4023529_4024099_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_024745730.1|4024207_4025173_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_024745729.1|4025734_4026535_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_024745728.1|4027097_4028012_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_024745727.1|4028042_4028780_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024745726.1|4028810_4029863_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.4e-18
WP_024745725.1|4029867_4030536_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_033004321.1|4030687_4032625_-	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_024745723.1|4033616_4035266_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_024745722.1|4035434_4036415_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.0	1.8e-15
WP_024745721.1|4036667_4038155_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.1	2.4e-125
WP_053513811.1|4038362_4039805_+	cellulase family glycosylhydrolase	NA	H2DE45	Erwinia_phage	32.6	5.2e-48
WP_107490888.1|4042408_4043206_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024743078.1|4043784_4046367_-	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	29.2	3.2e-08
WP_024743079.1|4046619_4049508_+	insulinase family protein	NA	NA	NA	NA	NA
WP_024743080.1|4050043_4050973_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_024743081.1|4051011_4052016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743082.1|4053259_4054045_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_024743083.1|4054297_4055989_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_058419058.1|4057161_4058538_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
WP_101807049.1|4059246_4060349_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
>prophage 23
NZ_CP013666	Xanthomonas oryzae pv. oryzae strain AXO1947 chromosome, complete genome	4674975	4090118	4160908	4674975	transposase,tRNA	Acidithiobacillus_phage(18.75%)	42	NA	NA
WP_053513416.1|4090118_4091081_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_053513414.1|4091213_4092788_-	DUF2875 family protein	NA	NA	NA	NA	NA
WP_082324336.1|4092801_4094679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324544.1|4094725_4095901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513412.1|4095969_4098699_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.7	3.8e-68
WP_058419175.1|4099009_4100386_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
WP_130625305.1|4100704_4101265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324545.1|4102614_4104027_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.3e-63
WP_024745366.1|4104037_4104775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745365.1|4104861_4107549_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_024745122.1|4109864_4110608_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_024745121.1|4110818_4111409_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_053513672.1|4111545_4112493_+	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
WP_053513670.1|4113393_4113894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807046.1|4116399_4117002_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082324546.1|4116899_4118276_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.3e-61
WP_053513979.1|4119549_4120110_+	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	30.2	1.4e-12
WP_053513977.1|4120205_4123031_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_024745528.1|4123192_4123711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513975.1|4123710_4124631_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_053513973.1|4124894_4127312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513971.1|4127405_4129583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745526.1|4130099_4131173_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	47.9	4.3e-84
WP_058419036.1|4132104_4133073_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_058419179.1|4135446_4136415_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_053513452.1|4137522_4139799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260602.1|4140099_4141740_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	63.5	5.1e-177
WP_003483210.1|4141883_4142171_-	co-chaperone GroES	NA	A0A221S331	uncultured_virus	40.0	5.1e-16
WP_053513449.1|4144461_4145754_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_053513448.1|4145806_4146421_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_024743224.1|4146499_4147375_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.5	3.6e-44
WP_053513446.1|4147591_4148317_-	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	44.3	4.7e-50
WP_024743226.1|4148313_4149156_-	response regulator	NA	NA	NA	NA	NA
WP_024743227.1|4149164_4150115_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024743228.1|4150111_4150798_-	cell division ATP-binding protein FtsE	NA	NA	NA	NA	NA
WP_053513444.1|4150873_4152598_-	ATP-dependent RNA helicase RhlB	NA	A0A1V0SBR7	Catovirus	29.4	1.1e-47
WP_011260615.1|4152796_4153138_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	44.4	2.3e-15
WP_024743230.1|4153354_4155244_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_082324338.1|4157120_4157354_+	hypothetical protein	NA	V9IQN0	Stenotrophomonas_phage	53.1	4.1e-16
WP_024745952.1|4157971_4158292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014504870.1|4158484_4160359_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_024745951.1|4160467_4160908_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
>prophage 24
NZ_CP013666	Xanthomonas oryzae pv. oryzae strain AXO1947 chromosome, complete genome	4674975	4280547	4343861	4674975	transposase	Ralstonia_phage(33.33%)	50	NA	NA
WP_058419181.1|4280547_4281528_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	56.7	1.4e-89
WP_053513134.1|4282149_4283439_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	6.0e-40
WP_053513136.1|4283878_4284073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058419055.1|4284109_4285486_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_058419058.1|4285678_4287055_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
WP_024743400.1|4287525_4287957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743401.1|4288305_4289715_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024743402.1|4290092_4290848_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_058419182.1|4290929_4292306_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	2.0e-78
WP_024742984.1|4292671_4293304_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_024742983.1|4293320_4295483_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011407199.1|4295596_4295782_-	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_024742982.1|4295804_4298408_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_082324554.1|4298404_4300294_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_024742980.1|4300350_4302108_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_024742979.1|4302110_4304342_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_050587979.1|4304338_4305868_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_024742977.1|4306405_4308034_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_024742976.1|4309586_4310528_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_033003076.1|4310768_4312493_+	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	3.0e-34
WP_058419179.1|4312618_4313587_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_053513749.1|4313666_4313927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513751.1|4313945_4316504_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_024744362.1|4316688_4317030_+	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_024744361.1|4318296_4319850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513747.1|4320313_4320877_-	lytic transglycosylase domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	39.4	5.2e-12
WP_053513745.1|4321280_4321712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513743.1|4322451_4324275_-	type III secretion system outer membrane ring subunit SctC	NA	NA	NA	NA	NA
WP_024744356.1|4324357_4325188_-	type III secretion system export apparatus protein SctT	NA	NA	NA	NA	NA
WP_053513741.1|4325184_4325694_-	type III secretion protein HrpB7	NA	NA	NA	NA	NA
WP_024744354.1|4325686_4327015_-	type III secretion system ATPase SctN	NA	NA	NA	NA	NA
WP_024744353.1|4327004_4327706_-	type III secretion system stator protein SctL	NA	NA	NA	NA	NA
WP_024744352.1|4327690_4328320_-	type III secretion protein HrpB4	NA	NA	NA	NA	NA
WP_024744351.1|4328327_4329092_-	type III secretion inner membrane ring lipoprotein SctJ	NA	NA	NA	NA	NA
WP_011407211.1|4329093_4329486_-	type III secretion protein HrpB2	NA	NA	NA	NA	NA
WP_011257083.1|4329519_4329975_-	HrpB1 family type III secretion system apparatus protein	NA	NA	NA	NA	NA
WP_024744349.1|4330190_4331264_+	type III secretion system export apparatus subunit SctU	NA	NA	NA	NA	NA
WP_053513739.1|4331272_4333195_+	hypersensitivity response secretion protein hrcV	NA	NA	NA	NA	NA
WP_053513737.1|4333194_4333836_+	type III secretion system protein SctP	NA	NA	NA	NA	NA
WP_024744346.1|4333928_4334882_+	type III secretion system cytoplasmic ring protein SctQ	NA	NA	NA	NA	NA
WP_024744345.1|4334868_4335513_+	type III secretion system export apparatus protein SctR	NA	NA	NA	NA	NA
WP_024744344.1|4335517_4335778_+	type III secretion system export apparatus subunit SctS	NA	NA	NA	NA	NA
WP_024744343.1|4335774_4336602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744342.1|4336598_4337537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744341.1|4337546_4337789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130625300.1|4337869_4338151_+	serine kinase	NA	NA	NA	NA	NA
WP_024744340.1|4338205_4338676_+	4-hydroxyphenylacetate 3-monooxygenase	NA	NA	NA	NA	NA
WP_053513734.1|4339449_4341450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324345.1|4341446_4341893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107490032.1|4342759_4343861_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	3.8e-43
>prophage 25
NZ_CP013666	Xanthomonas oryzae pv. oryzae strain AXO1947 chromosome, complete genome	4674975	4397943	4546558	4674975	transposase,integrase	Acidithiobacillus_phage(20.0%)	105	4399323:4399342	4456858:4456877
WP_058419065.1|4397943_4399320_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
4399323:4399342	attL	GGGGTTTTTCAGGGGCGACT	NA	NA	NA	NA
WP_033003694.1|4399519_4400488_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	44.0	5.9e-56
WP_101807308.1|4400993_4401356_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_058419186.1|4401412_4404700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419030.1|4406054_4407023_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_154221272.1|4407274_4407685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744036.1|4407845_4408118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807307.1|4409655_4409883_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_033003188.1|4410100_4410532_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024743155.1|4410668_4411547_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_024743156.1|4413975_4414932_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_012443837.1|4415139_4416168_-	methionine synthase	NA	NA	NA	NA	NA
WP_053513586.1|4416195_4417179_-	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_024743158.1|4417321_4417915_-	FMN reductase	NA	NA	NA	NA	NA
WP_024743159.1|4418105_4419020_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260641.1|4419019_4419685_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_101807306.1|4419954_4420839_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_053513587.1|4421537_4422215_+	response regulator	NA	NA	NA	NA	NA
WP_033003192.1|4422298_4423150_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_024743165.1|4423368_4423761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743166.1|4424103_4424982_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024743167.1|4425019_4426138_-	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_024743168.1|4426196_4427078_-	NAD-dependent protein deacetylase	NA	A0A068EPD4	Bacillus_phage	23.3	6.6e-14
WP_024743170.1|4427517_4428798_-	MFS transporter	NA	NA	NA	NA	NA
WP_024743171.1|4428894_4429782_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743173.1|4430651_4431464_-	preprotein translocase subunit TatD	NA	NA	NA	NA	NA
WP_024743176.1|4432545_4432977_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_024743178.1|4434028_4434214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058419188.1|4435106_4436075_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
WP_024742958.1|4437208_4437667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024742959.1|4437844_4440352_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_024742960.1|4440463_4440856_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_053513548.1|4441592_4442006_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_024742963.1|4441995_4443252_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_024742964.1|4444139_4444553_+	DUF3225 domain-containing protein	NA	NA	NA	NA	NA
WP_130625298.1|4445018_4445807_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_011260806.1|4445992_4446466_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	48.7	2.1e-35
WP_024742966.1|4447058_4447697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513546.1|4447850_4450352_+	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	25.7	4.6e-20
WP_024745542.1|4451004_4451445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745544.1|4451767_4452340_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_024745545.1|4452432_4453287_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024745546.1|4453519_4454491_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_024745547.1|4454629_4455658_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_107490052.1|4455760_4456792_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	8.7e-74
WP_082324355.1|4456974_4458351_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
4456858:4456877	attR	AGTCGCCCCTGAAAAACCCC	NA	NA	NA	NA
WP_033003464.1|4458527_4459631_+	restriction endonuclease or methylase	NA	A0A1S5SAB0	Streptococcus_phage	40.4	9.4e-58
WP_024743784.1|4459722_4460097_-	VOC family protein	NA	NA	NA	NA	NA
WP_082324356.1|4460797_4461814_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
WP_024743734.1|4462436_4463492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743735.1|4463718_4465137_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_024743736.1|4465177_4466155_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_024743738.1|4467559_4468861_-	MFS transporter	NA	NA	NA	NA	NA
WP_024743739.1|4469322_4472256_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743740.1|4472354_4473842_+	MFS transporter	NA	NA	NA	NA	NA
WP_024743741.1|4473873_4474908_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_024743742.1|4475249_4475783_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_058419192.1|4476064_4477033_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_154221296.1|4477084_4477423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807286.1|4477499_4478305_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.0	7.7e-09
WP_024743989.1|4478506_4479079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008573820.1|4479232_4479436_+	YdcH family protein	NA	NA	NA	NA	NA
WP_024743991.1|4480072_4481053_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_024743992.1|4481248_4483912_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_024743993.1|4483911_4484886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324359.1|4484884_4485130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419193.1|4485298_4486351_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513382.1|4486515_4489554_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_053513380.1|4489855_4492888_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743574.1|4492997_4494527_+	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.5	3.9e-46
WP_024743573.1|4494833_4495613_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_024743572.1|4495609_4496620_-	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_024743571.1|4496899_4497565_+	YceH family protein	NA	NA	NA	NA	NA
WP_024743568.1|4498951_4500928_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.0	3.1e-112
WP_024743567.1|4501134_4501764_+	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	1.1e-52
WP_024743566.1|4502222_4503461_+	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_024743565.1|4503603_4505202_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_082324360.1|4505270_4506362_-	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_033003378.1|4506594_4507410_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.0	1.1e-18
WP_058419055.1|4507698_4509075_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_024744511.1|4515553_4517458_-	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.0e-19
WP_024744510.1|4517454_4518057_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_024744509.1|4518157_4519417_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_024744508.1|4519707_4521870_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_024744507.1|4522022_4522229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324361.1|4522436_4522826_-	YchJ family protein	NA	NA	NA	NA	NA
WP_053513283.1|4522925_4523705_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_058419194.1|4523829_4525206_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	6.6e-61
WP_053513660.1|4525337_4526519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513661.1|4526616_4530048_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_024745665.1|4530195_4530894_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_024745666.1|4530877_4532350_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_024745667.1|4532346_4532934_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_024745668.1|4532933_4534130_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_024745669.1|4534203_4534806_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	49.5	6.9e-47
WP_050588040.1|4534926_4535424_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513662.1|4536837_4537362_+	FUSC family protein	NA	NA	NA	NA	NA
WP_082324308.1|4537333_4538350_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	5.6e-49
WP_024744628.1|4538756_4540118_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.1	5.8e-33
WP_058419195.1|4540329_4541706_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_082324568.1|4542394_4543108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745343.1|4543138_4543645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745344.1|4543918_4544125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745345.1|4544111_4545224_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_107490090.1|4545456_4546558_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	3.2e-42
>prophage 26
NZ_CP013666	Xanthomonas oryzae pv. oryzae strain AXO1947 chromosome, complete genome	4674975	4560566	4632947	4674975	transposase	Ralstonia_phage(25.0%)	49	NA	NA
WP_082324366.1|4560566_4560923_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_053513986.1|4560965_4563746_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743548.1|4564032_4565055_+	sugar kinase	NA	NA	NA	NA	NA
WP_154221263.1|4565511_4565652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743549.1|4565675_4566884_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_024743552.1|4568855_4570022_+	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_058419197.1|4571974_4573351_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.0e-77
WP_024743644.1|4573765_4575904_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.6	2.4e-65
WP_024712580.1|4576059_4577262_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_024743645.1|4577532_4578543_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	7.3e-49
WP_024743646.1|4578817_4579285_+	DUF4410 domain-containing protein	NA	NA	NA	NA	NA
WP_082324173.1|4580661_4582038_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_158500224.1|4582153_4582471_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_058419078.1|4582583_4583552_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	4.3e-99
WP_130625425.1|4583976_4584207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130625426.1|4584370_4587016_+	protein kinase/lanthionine synthetase C family protein	NA	NA	NA	NA	NA
WP_131085815.1|4587056_4587803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324171.1|4587824_4589120_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_107490031.1|4589421_4590453_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_082324369.1|4590459_4592355_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.3	7.0e-29
WP_101807298.1|4592611_4593859_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	2.1e-61
WP_024743495.1|4595151_4595550_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_033003354.1|4595821_4596277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743497.1|4596500_4597388_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_033003355.1|4597721_4599299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743499.1|4599793_4600621_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_058419165.1|4601347_4602406_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.6e-73
WP_058419103.1|4603722_4604691_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_107490044.1|4604931_4605963_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_058419078.1|4606409_4607378_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	4.3e-99
WP_101807300.1|4607376_4607937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107490959.1|4608209_4609311_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	3.8e-43
WP_058419050.1|4609605_4610574_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_130625431.1|4610668_4610971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745548.1|4611042_4611780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513643.1|4611797_4612580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743553.1|4612588_4612921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743554.1|4612913_4613390_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_024743555.1|4613392_4613827_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_024743556.1|4613942_4614188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003482333.1|4614524_4614857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743557.1|4615306_4616701_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_024745520.1|4617856_4618135_-	plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	37.0	2.9e-08
WP_024745521.1|4618232_4620494_-	exodeoxyribonuclease V subunit alpha	NA	A0A0N9S864	Staphylococcus_phage	44.9	1.5e-09
WP_053513647.1|4620681_4624743_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	22.5	3.2e-10
WP_053513649.1|4624739_4628153_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_024745524.1|4628478_4629186_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	3.5e-05
WP_082324099.1|4629775_4631152_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_058419202.1|4631978_4632947_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	5.6e-99
