The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013688	Streptococcus gallolyticus strain ICDDRB-NRC-S1, complete genome	2052496	54529	166558	2052496	tRNA,bacteriocin,transposase,protease	Streptococcus_phage(30.77%)	105	NA	NA
WP_039671289.1|54529_55672_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.4	4.5e-87
WP_014295417.1|55809_56118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014295416.1|56121_56652_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_014295415.1|56711_57488_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_014295414.1|57487_57994_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_014295413.1|58196_58385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058621333.1|58432_59782_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_082306710.1|59933_60428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058621334.1|60828_61197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058621335.1|61228_62182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058622004.1|62463_63162_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_039671283.1|63416_64547_+	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_014295405.1|64830_65358_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_014295404.1|65354_66026_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_058621336.1|66071_66986_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.7	1.3e-76
WP_058621337.1|67045_68062_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_014295401.1|68258_69026_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_014295400.1|70300_70747_+	dUTP diphosphatase	NA	Q332E8	Clostridium_botulinum_C_phage	49.3	3.3e-30
WP_039671282.1|71327_72689_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_014295398.1|72814_73309_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_014295395.1|74105_75056_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_058621338.1|76768_78226_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L0I5	Tupanvirus	24.8	1.1e-10
WP_058621339.1|78401_79568_+	MFS transporter	NA	NA	NA	NA	NA
WP_044563147.1|79791_80982_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_014295390.1|81435_82830_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_014295389.1|82958_83318_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_058621340.1|83301_84117_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_058621341.1|84129_85128_+	protein jag	NA	NA	NA	NA	NA
WP_058621342.1|86638_87049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039671256.1|87253_87388_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_014295342.1|89104_90499_+	V-type ATP synthase subunit B	NA	NA	NA	NA	NA
WP_058621343.1|90532_91156_+	V-type ATP synthase subunit D	NA	NA	NA	NA	NA
WP_014295340.1|91273_91483_+	CsbD family protein	NA	J7KJ36	Streptococcus_phage	61.5	2.3e-13
WP_039671255.1|91553_91805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082306712.1|92056_92179_+	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_058621344.1|92193_93732_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	27.9	5.2e-38
WP_058621345.1|93728_94991_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	NA	NA	NA	NA
WP_058621346.1|95021_95261_+	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_058621347.1|95253_96528_+	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_058621348.1|96644_96827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058621349.1|96908_97790_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014295332.1|97946_99569_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_014295331.1|99590_100862_+	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_082306713.1|101619_101994_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012962535.1|102527_102785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014295327.1|102771_103365_+	signal peptidase I	NA	NA	NA	NA	NA
WP_058621350.1|103405_108424_+	cell wall ribonuclease G/E	NA	NA	NA	NA	NA
WP_014295325.1|108514_109951_+	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_058621351.1|110094_111033_+	class C sortase	NA	NA	NA	NA	NA
WP_058621352.1|111650_113447_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	32.5	4.3e-76
WP_058621353.1|114743_115514_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_081498591.1|115485_116076_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_058621354.1|116072_116597_+	DUF1697 domain-containing protein	NA	NA	NA	NA	NA
WP_058621355.1|116666_117539_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_082306715.1|121495_121717_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_058621356.1|121768_121996_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_018364971.1|122017_122401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082306751.1|122397_122619_+|bacteriocin	garvicin Q family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_018364976.1|122618_122927_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_058621357.1|123728_123950_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_058621358.1|123949_124246_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_058621359.1|124414_124648_+|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_058621360.1|124837_125080_+|bacteriocin	garvicin Q family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_018364976.1|125094_125403_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_058621361.1|126053_126254_+|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_006531883.1|126279_126462_+|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_058621362.1|127080_127311_+|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_058621363.1|127400_127712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058621364.1|127879_128518_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_082306717.1|128676_128976_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_006531876.1|128995_129184_+|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_058621365.1|129932_130151_+|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003066579.1|130150_130447_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_099412448.1|131475_133045_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	50.9	2.6e-53
WP_058621369.1|133641_133842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158526987.1|133924_135495_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	50.9	2.6e-53
WP_058621371.1|135729_136056_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058621372.1|136072_136804_+	response regulator transcription factor	NA	A0A1V0E029	Clostridioides_phage	25.0	5.7e-19
WP_058621373.1|136808_138119_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_058621374.1|138577_138877_+	DUF3884 family protein	NA	NA	NA	NA	NA
WP_039671232.1|138886_139036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039671231.1|139047_139359_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_058621376.1|139932_140247_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_014295297.1|140376_140634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014295296.1|141075_141948_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_058621377.1|141954_142614_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_058621378.1|142610_143240_+	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_014295293.1|143241_144516_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_014295292.1|144505_145444_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_058621379.1|145599_146412_+	pur operon repressor	NA	A0A1X9I6E2	Streptococcus_phage	29.6	1.1e-07
WP_003066537.1|146698_147112_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_014295290.1|147132_147603_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_014295289.1|147802_149881_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	29.1	6.7e-65
WP_014295288.1|150086_151100_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_058621380.1|151287_152484_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_014295286.1|152713_153250_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_009854980.1|153338_153710_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014295285.1|153759_155106_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_014295284.1|155283_159801_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_014295283.1|159802_161242_+	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_058621381.1|162325_164008_-	ribonuclease J	NA	NA	NA	NA	NA
WP_058621382.1|164009_164240_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_014295280.1|164424_165114_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_014295279.1|165097_165538_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_014295278.1|165547_166558_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.4	1.8e-60
>prophage 2
NZ_CP013688	Streptococcus gallolyticus strain ICDDRB-NRC-S1, complete genome	2052496	367711	383275	2052496		Streptococcus_phage(84.62%)	18	NA	NA
WP_058621452.1|367711_368476_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	3.3e-17
WP_014295091.1|368475_369186_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.6e-13
WP_039671140.1|369356_370016_+	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	64.2	1.6e-73
WP_014295089.1|370202_370838_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	65.7	1.0e-69
WP_014295088.1|370848_371724_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	50.7	1.9e-74
WP_014295087.1|371720_372521_+	signal peptidase II	NA	NA	NA	NA	NA
WP_014295086.1|372513_372834_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	60.4	5.9e-29
WP_014295085.1|372840_373707_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	70.8	2.5e-114
WP_014295084.1|374104_375340_+	ammonium transporter	NA	NA	NA	NA	NA
WP_014295083.1|375396_375738_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_014295082.1|375868_376507_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_014295081.1|376642_377734_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	81.5	3.9e-173
WP_014295080.1|377804_378353_+	hypothetical protein	NA	M1PSC3	Streptococcus_phage	56.7	2.2e-55
WP_014295079.1|378398_379577_+	3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	81.1	3.9e-179
WP_014295078.1|379675_379903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014295077.1|379961_380447_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	51.6	4.6e-41
WP_014295076.1|380459_380816_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	58.3	4.0e-34
WP_058621453.1|382444_383275_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	78.5	1.6e-123
>prophage 3
NZ_CP013688	Streptococcus gallolyticus strain ICDDRB-NRC-S1, complete genome	2052496	430874	488461	2052496	tRNA,transposase	Streptococcus_phage(36.84%)	51	NA	NA
WP_014295023.1|430874_432821_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	38.6	3.9e-123
WP_014295020.1|435130_436009_+	DUF3114 domain-containing protein	NA	NA	NA	NA	NA
WP_014295019.1|436114_436807_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.6e-31
WP_058621467.1|436751_438284_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.6	2.2e-17
WP_014295016.1|438525_438828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014295015.1|439075_439684_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	33.2	7.8e-22
WP_099412448.1|439790_441361_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	50.9	2.6e-53
WP_014295014.1|441462_442110_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_039671116.1|442121_442826_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_058621468.1|442842_443655_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014295011.1|443665_444430_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	9.7e-38
WP_014295010.1|444734_445445_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.1	4.1e-38
WP_014295009.1|445437_446790_+	cell wall metabolism sensor histidine kinase VicK	NA	W8CYF6	Bacillus_phage	33.9	1.9e-36
WP_014295008.1|446790_447600_+	MBL fold metallo-hydrolase	NA	A0A2H4J3R0	uncultured_Caudovirales_phage	39.1	1.5e-36
WP_014295006.1|448100_448787_+	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	34.7	6.5e-25
WP_058621469.1|448916_452456_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_058621470.1|452472_452883_+	NUDIX hydrolase	NA	A0A0A0YVI0	Citrobacter_phage	35.4	9.9e-05
WP_031365517.1|452935_454192_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	73.9	1.3e-172
WP_058621471.1|455757_456111_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_158527004.1|456110_457316_+	chloride transporter	NA	NA	NA	NA	NA
WP_058621473.1|457302_458049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058621474.1|458066_459017_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_058621475.1|459091_460348_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	73.9	1.3e-172
WP_058621476.1|461493_462291_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_058621477.1|462290_463109_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_058621478.1|463157_464570_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_081831482.1|464576_464744_+	cytochrome O ubiquinol oxidase	NA	NA	NA	NA	NA
WP_014294998.1|465995_466808_-	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_014294997.1|466807_467710_-	permease	NA	NA	NA	NA	NA
WP_003065749.1|467715_467850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058621479.1|468066_470199_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_058621480.1|470185_470629_+	SprT family protein	NA	NA	NA	NA	NA
WP_058621481.1|470734_471013_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_058621482.1|471348_472290_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_058621483.1|472289_473072_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_058621484.1|473095_473515_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_014294990.1|473511_473985_+	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_058621485.1|474154_474439_-	DUF3270 domain-containing protein	NA	NA	NA	NA	NA
WP_014294988.1|474707_475634_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_058621486.1|475765_477055_+	U32 family peptidase	NA	Q6DW11	Phage_TP	30.5	5.1e-39
WP_039671102.1|477110_477434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003065722.1|478726_478939_+	hypothetical protein	NA	A0A223LEC3	Bacillus_phage	51.6	6.6e-13
WP_058621487.1|478984_479524_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_058621488.1|479916_480672_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_006738512.1|481951_482149_-	helix-turn-helix domain-containing protein	NA	A0A1S5SF07	Streptococcus_phage	43.1	3.9e-07
WP_093529001.1|482513_483193_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	82.3	7.2e-109
WP_003134158.1|483253_483634_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_058621489.1|483686_484466_-	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_058621490.1|484556_486461_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.5	2.5e-90
WP_058621491.1|486461_486899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058621492.1|487780_488461_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	94.2	1.6e-121
>prophage 4
NZ_CP013688	Streptococcus gallolyticus strain ICDDRB-NRC-S1, complete genome	2052496	730575	743132	2052496	tRNA	Bacillus_phage(33.33%)	12	NA	NA
WP_039670892.1|730575_731781_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	48.0	2.1e-42
WP_014294729.1|731777_733649_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.1	4.6e-65
WP_014294728.1|733726_735466_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	5.1e-42
WP_014294727.1|735468_737235_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.3	1.9e-60
WP_058621576.1|737479_738139_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	53.8	3.5e-60
WP_014294725.1|738131_738578_+	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	57.7	3.4e-43
WP_099390341.1|738567_739284_+	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	47.9	6.3e-63
WP_014294723.1|739296_739788_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	61.6	2.8e-46
WP_014294722.1|739843_740341_-	membrane protein	NA	NA	NA	NA	NA
WP_058621577.1|740586_741939_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_058621578.1|742215_742725_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014294719.1|742721_743132_+	peptide deformylase	NA	A0A2I7QLT9	Vibrio_phage	39.0	9.9e-13
>prophage 5
NZ_CP013688	Streptococcus gallolyticus strain ICDDRB-NRC-S1, complete genome	2052496	752740	762804	2052496		Bacillus_phage(33.33%)	7	NA	NA
WP_058621584.1|752740_753421_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.3	2.2e-17
WP_058621585.1|753429_754659_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.3	5.2e-09
WP_082306730.1|755312_755912_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_058622014.1|755916_758991_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	21.1	1.1e-12
WP_058621587.1|758994_759858_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	56.8	2.5e-82
WP_058621588.1|759850_761053_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	24.9	3.5e-18
WP_058621589.1|761148_762804_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	49.2	9.6e-123
>prophage 6
NZ_CP013688	Streptococcus gallolyticus strain ICDDRB-NRC-S1, complete genome	2052496	783430	816564	2052496	protease,integrase,transposase	Bacillus_virus(10.0%)	26	793700:793717	814905:814922
WP_012962047.1|783430_784660_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.7	3.9e-137
WP_058621607.1|784670_785264_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_058621608.1|785562_786939_+	amino acid permease	NA	NA	NA	NA	NA
WP_014294682.1|786951_787899_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_058621609.1|789472_791581_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	39.2	1.2e-122
WP_014294677.1|792765_793269_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_014294676.1|793348_793714_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
793700:793717	attL	GTTACTCTTAAATAATAG	NA	NA	NA	NA
WP_058621611.1|793954_797563_+	N-6 DNA methylase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	23.8	5.0e-07
WP_014294673.1|798059_798320_+	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_058621612.1|798309_799491_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	29.3	1.2e-26
WP_099412448.1|799715_801286_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	50.9	2.6e-53
WP_014294671.1|801504_801678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014294668.1|803033_803795_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.2	4.8e-21
WP_014294667.1|803975_804926_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_014294666.1|805161_805587_+	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
WP_014294665.1|805620_806136_+	galactose-6-phosphate isomerase subunit LacB	NA	NA	NA	NA	NA
WP_014294664.1|806147_807080_+	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
WP_007209213.1|807082_808063_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_058621613.1|808090_808408_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_058621614.1|808407_810114_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_039670868.1|810276_811683_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.8	4.7e-46
WP_014294660.1|811770_812667_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_014294659.1|812914_813139_+	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	39.3	2.6e-07
WP_000860228.1|813408_813657_+	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_014294658.1|813659_814865_+|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	31.1	4.5e-29
WP_058621615.1|815388_816564_+|transposase	IS256 family transposase	transposase	A0A0N9S006	Staphylococcus_phage	28.2	3.4e-05
814905:814922	attR	GTTACTCTTAAATAATAG	NA	NA	NA	NA
>prophage 7
NZ_CP013688	Streptococcus gallolyticus strain ICDDRB-NRC-S1, complete genome	2052496	953166	1020152	2052496	integrase,transposase	Streptococcus_phage(14.29%)	53	952600:952623	958246:958269
952600:952623	attL	TTGGGAACAGCGTAAGTTGGGAGA	NA	NA	NA	NA
WP_014294525.1|953166_954102_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	49.2	6.4e-84
WP_058621654.1|954146_957092_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	22.7	3.0e-18
WP_082306734.1|957098_958316_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	23.7	4.5e-13
958246:958269	attR	TCTCCCAACTTACGCTGTTCCCAA	NA	NA	NA	NA
WP_058621655.1|958317_959913_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	47.5	8.6e-113
WP_058621656.1|960445_961771_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_058621657.1|963821_965111_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	53.6	8.2e-122
WP_058621659.1|965616_967179_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.3	7.1e-19
WP_158526997.1|967582_969153_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	50.9	2.0e-53
WP_058622019.1|969233_969842_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.6	3.6e-35
WP_058621661.1|970654_972109_+	alpha-amylase	NA	NA	NA	NA	NA
WP_058621662.1|972247_973984_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.6	1.6e-56
WP_014294503.1|973985_975710_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.6	2.4e-44
WP_058621663.1|975749_976352_-	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	44.5	2.6e-22
WP_058621664.1|976351_977329_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_039670775.1|977373_978624_-	serine hydroxymethyltransferase	NA	A0A219YB23	Aeromonas_phage	53.2	8.6e-100
WP_039670774.1|978727_979327_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	31.1	1.8e-18
WP_039670773.1|979319_980150_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_014294497.1|980149_981229_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_058622020.1|981267_981849_-	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	53.2	1.2e-48
WP_039670772.1|982316_982526_+	hypothetical protein	NA	Q7Y4M2	Streptococcus_phage	75.4	4.1e-23
WP_002885057.1|982630_982816_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_058621665.1|982963_983902_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_039670824.1|983950_985231_-	purine permease	NA	Q9KX94	Enterobacteria_phage	28.4	3.0e-31
WP_058621666.1|985232_985814_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_058621667.1|986761_987745_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	74.6	2.5e-139
WP_058621668.1|990397_991816_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.7	1.5e-39
WP_048816338.1|991938_992355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142348653.1|992385_992571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099412448.1|992691_994262_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	50.9	2.6e-53
WP_058621669.1|994336_994765_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082306736.1|995902_996301_+	sodium transporter	NA	NA	NA	NA	NA
WP_058621670.1|996331_997087_-	SDR family oxidoreductase	NA	F2NZ12	Diadromus_pulchellus_ascovirus	28.6	3.8e-10
WP_058621671.1|997154_998153_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_058621672.1|998169_999060_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_014294483.1|999056_999893_-	NAD kinase	NA	NA	NA	NA	NA
WP_058621673.1|999867_1000533_-	GTP pyrophosphokinase family protein	NA	F8K9M7	Nitrososphaera_phage	32.6	2.6e-10
WP_014294481.1|1000665_1001235_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_058621674.1|1001320_1002292_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	36.0	1.2e-40
WP_058621675.1|1002299_1003427_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	29.2	7.9e-36
WP_014294478.1|1003416_1003764_+	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_014294477.1|1003909_1004557_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_014294476.1|1004693_1005374_-	JAB domain-containing protein	NA	A0A1B2LRS6	Wolbachia_phage	34.9	6.2e-12
WP_058621676.1|1005420_1006260_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_058621677.1|1006266_1007385_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_058621678.1|1008071_1008695_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.9	6.1e-30
WP_039670763.1|1011294_1012623_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_058621679.1|1012812_1013766_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.6	2.2e-39
WP_014294467.1|1013881_1015099_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_014294466.1|1015168_1016011_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014294465.1|1016034_1016664_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	8.3e-27
WP_009854101.1|1016675_1017317_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014294464.1|1017502_1017832_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_014294462.1|1018895_1020152_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	73.4	2.7e-170
>prophage 8
NZ_CP013688	Streptococcus gallolyticus strain ICDDRB-NRC-S1, complete genome	2052496	1259378	1354274	2052496	tail,terminase,holin,head,capsid,protease,tRNA,portal,transposase	Streptococcus_phage(78.57%)	85	NA	NA
WP_099412448.1|1259378_1260948_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	50.9	2.6e-53
WP_058621768.1|1261065_1261446_-	RidA family protein	NA	NA	NA	NA	NA
WP_014294239.1|1261517_1262312_-	YdcF family protein	NA	NA	NA	NA	NA
WP_058621769.1|1262350_1263274_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	47.6	1.8e-06
WP_014294237.1|1264373_1265177_-	putative ABC transporter permease	NA	NA	NA	NA	NA
WP_014294236.1|1265262_1266438_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_014294235.1|1266466_1267585_-	citrate synthase	NA	NA	NA	NA	NA
WP_058621770.1|1267588_1270252_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_014294233.1|1270539_1270767_+	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	42.9	3.5e-12
WP_014294232.1|1270844_1273004_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	61.8	1.7e-260
WP_014294231.1|1273582_1274545_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	69.8	1.8e-126
WP_014294230.1|1274813_1275380_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_058621771.1|1275409_1275976_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_039670602.1|1276131_1276689_-	NAD(P)H dehydrogenase	NA	NA	NA	NA	NA
WP_014294227.1|1276787_1277918_-	acetylornithine transaminase	NA	B5LJF5	Mycobacterium_phage	28.9	3.8e-14
WP_014294226.1|1277943_1278678_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_014294225.1|1278691_1279885_-	bifunctional ornithine acetyltransferase/N-acetylglutamate synthase	NA	NA	NA	NA	NA
WP_058621772.1|1279956_1280979_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_058621773.1|1281091_1282270_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_058621774.1|1282281_1283064_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_009853783.1|1284651_1284840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014294220.1|1284885_1287504_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.8	6.0e-63
WP_039670593.1|1287872_1288895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014294218.1|1288964_1289666_-	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.3	5.1e-09
WP_014294217.1|1289719_1290331_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_058621775.1|1290944_1292747_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_014294215.1|1292736_1293708_-	competence protein CoiA	NA	NA	NA	NA	NA
WP_039670589.1|1293760_1294477_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_014294213.1|1294552_1295257_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_058621776.1|1296059_1297088_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_058621777.1|1297119_1297845_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014294210.1|1297995_1298604_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	57.4	3.4e-62
WP_014294209.1|1298692_1299754_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_158526998.1|1300473_1301028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058621779.1|1301031_1301370_-	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_058621780.1|1301387_1302242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058621781.1|1302319_1302547_-	hypothetical protein	NA	Q6DMS5	Streptococcus_phage	33.8	5.5e-05
WP_058621782.1|1302728_1304291_-	recombinase family protein	NA	Q6DMS5	Streptococcus_phage	73.2	1.4e-219
WP_082306742.1|1304290_1305526_-	recombinase family protein	NA	M1NSJ1	Streptococcus_phage	96.6	3.2e-232
WP_058621784.1|1305851_1307321_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1B0RXL4	Streptococcus_phage	92.6	3.0e-261
WP_058621785.1|1307322_1307727_-|holin	phage holin family protein	holin	D0R0E9	Streptococcus_phage	74.8	1.5e-45
WP_058621786.1|1307744_1309601_-	hypothetical protein	NA	Q6DMS9	Streptococcus_phage	73.1	2.1e-256
WP_058621787.1|1309613_1312529_-	carbamoylsarcosine amidase	NA	Q6DMT0	Streptococcus_phage	64.6	0.0e+00
WP_058621788.1|1312528_1313254_-	hypothetical protein	NA	Q6DMT1	Streptococcus_phage	57.5	2.7e-82
WP_058621789.1|1313250_1316109_-	hypothetical protein	NA	A0A1B0RXL6	Streptococcus_phage	94.5	1.3e-215
WP_003054982.1|1316291_1316711_-	hypothetical protein	NA	D0R0E2	Streptococcus_phage	100.0	2.1e-71
WP_003054960.1|1316722_1317292_-	hypothetical protein	NA	E4ZFM9	Streptococcus_phage	98.9	2.2e-103
WP_003054958.1|1317293_1317620_-	hypothetical protein	NA	E4ZFM8	Streptococcus_phage	99.1	3.4e-56
WP_003054952.1|1317626_1317995_-	hypothetical protein	NA	A0A1X9I688	Streptococcus_phage	91.0	2.2e-48
WP_058621790.1|1317987_1318326_-|head,tail	head-tail adaptor protein	head,tail	A0A1X9I694	Streptococcus_phage	98.2	4.9e-58
WP_003054946.1|1318325_1318583_-|head,tail	phage gp6-like head-tail connector protein	head,tail	D0R0D7	Streptococcus_phage	97.6	8.6e-39
WP_058621791.1|1318585_1319791_-|capsid	phage major capsid protein	capsid	A0A1X9I692	Streptococcus_phage	98.0	1.3e-225
WP_015057820.1|1319809_1320505_-|protease	Clp protease ClpP	protease	A0A1B0RXJ9	Streptococcus_phage	90.9	6.2e-116
WP_058621792.1|1320497_1321781_-|portal	phage portal protein	portal	A0A1B0RXD8	Streptococcus_phage	88.3	1.4e-222
WP_058621793.1|1321861_1322488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058621794.1|1322525_1324118_-|terminase	terminase large subunit	terminase	A0A1B0RXJ8	Streptococcus_phage	90.0	1.0e-291
WP_058622028.1|1324114_1324588_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B0RXG3	Streptococcus_phage	94.3	2.3e-82
WP_058621795.1|1324650_1324860_-	DUF4314 domain-containing protein	NA	A0A1B0RXD4	Streptococcus_phage	63.8	1.3e-16
WP_058621796.1|1324863_1325118_-	hypothetical protein	NA	M1PG57	Streptococcus_phage	58.2	1.7e-18
WP_058621797.1|1325189_1326446_-	DNA (cytosine-5-)-methyltransferase	NA	M1NSK8	Streptococcus_phage	88.8	2.3e-222
WP_058621798.1|1326442_1327699_-	DNA modification methylase	NA	A0A1B0RXE5	Streptococcus_phage	86.6	6.4e-212
WP_058621800.1|1328414_1328780_-	HNH endonuclease	NA	A0A1B0RXJ3	Streptococcus_phage	86.8	6.0e-62
WP_058621801.1|1329341_1330379_-	methionine adenosyltransferase	NA	Q6DMV3	Streptococcus_phage	91.3	7.7e-179
WP_024409997.1|1330425_1330608_-	hypothetical protein	NA	A0A1B0RXC3	Streptococcus_phage	96.7	6.5e-25
WP_024409998.1|1330786_1331296_-	hypothetical protein	NA	Q6DMV6	Streptococcus_phage	52.7	4.6e-44
WP_058621802.1|1331288_1332665_-	DEAD/DEAH box helicase	NA	A0A1B0RXH8	Streptococcus_phage	97.6	1.3e-258
WP_058621803.1|1332645_1332927_-	VRR-NUC domain-containing protein	NA	A0A1B0RXC4	Streptococcus_phage	98.9	4.6e-46
WP_058621804.1|1333211_1335497_-	DNA primase	NA	A0A1B0RXC5	Streptococcus_phage	95.4	0.0e+00
WP_058621805.1|1335880_1336204_+	hypothetical protein	NA	D0R0B4	Streptococcus_phage	91.5	9.1e-46
WP_058621806.1|1336196_1337318_+	DUF2800 domain-containing protein	NA	Q6DMW2	Streptococcus_phage	94.6	2.5e-207
WP_032462758.1|1337322_1337871_+	DUF2815 family protein	NA	E4ZFK3	Streptococcus_phage	100.0	7.1e-99
WP_058621807.1|1338105_1340061_+	DNA polymerase	NA	Q6DMW5	Streptococcus_phage	97.5	0.0e+00
WP_058621808.1|1340099_1340669_-	hypothetical protein	NA	Q6DMW6	Streptococcus_phage	92.6	9.6e-99
WP_058621809.1|1341002_1342826_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1B0RXB2	Streptococcus_phage	96.7	0.0e+00
WP_058621810.1|1342943_1344083_-	DNA cytosine methyltransferase	NA	R4TMW4	Halovirus	31.3	7.2e-29
WP_082306743.1|1344172_1345225_+	HindVP family restriction endonuclease	NA	NA	NA	NA	NA
WP_058621811.1|1345316_1346006_+	helix-turn-helix transcriptional regulator	NA	A0A1B0RXB1	Streptococcus_phage	94.8	1.5e-122
WP_058621812.1|1346008_1346236_+	hypothetical protein	NA	D0R0A4	Streptococcus_phage	95.9	1.1e-34
WP_058621813.1|1347770_1348139_+	hypothetical protein	NA	A0A1B0RXA8	Streptococcus_phage	94.3	2.6e-57
WP_058621814.1|1348125_1348425_+	hypothetical protein	NA	Q6DMX6	Streptococcus_phage	98.0	3.7e-49
WP_058621815.1|1348616_1350080_-	Msr family ABC-F type ribosomal protection protein	NA	A0A2I4R674	Erysipelothrix_phage	96.9	4.5e-249
WP_058621816.1|1350200_1351418_-	macrolide efflux MFS transporter Mef(A)	NA	A0A2K5B2B5	Erysipelothrix_phage	99.0	3.5e-215
WP_015057859.1|1351966_1352383_-	hypothetical protein	NA	A0A1B0RXA3	Streptococcus_phage	100.0	1.3e-73
WP_015057860.1|1352397_1353510_-	recombinase family protein	NA	Q6DMY0	Streptococcus_phage	99.2	5.0e-208
WP_058621817.1|1353638_1354274_-	hypothetical protein	NA	Q6DMY1	Streptococcus_phage	93.4	1.2e-110
>prophage 9
NZ_CP013688	Streptococcus gallolyticus strain ICDDRB-NRC-S1, complete genome	2052496	1992215	2000358	2052496		Streptococcus_phage(16.67%)	9	NA	NA
WP_014295497.1|1992215_1993460_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	42.2	6.1e-90
WP_014295496.1|1993460_1994750_+	insulinase family protein	NA	A0A2K9LA15	Tupanvirus	25.9	6.1e-16
WP_014295495.1|1994813_1995758_+	membrane protein	NA	NA	NA	NA	NA
WP_058621992.1|1995767_1996322_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_014295493.1|1996318_1997161_+	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	30.0	2.2e-19
WP_014295492.1|1997136_1997979_+	energy-coupling factor transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.4	1.0e-16
WP_014295491.1|1997971_1998769_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_058621993.1|1998901_1999495_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A288TY55	Enterococcus_phage	78.5	2.2e-21
WP_014295489.1|1999701_2000358_+	transglycosylase SLT domain-containing protein	NA	Q4Z8Z7	Staphylococcus_phage	70.9	9.9e-23
