The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013737	Herbaspirillum rubrisubalbicans M1, complete genome	5611261	1591356	1676517	5611261	transposase,plate,portal,integrase,head,capsid,tRNA,tail,terminase	Burkholderia_phage(28.21%)	80	1641297:1641356	1680042:1680119
WP_058894789.1|1591356_1592130_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_008327243.1|1592274_1592658_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017454124.1|1592762_1593434_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_058894790.1|1593613_1594573_+	CobD/CbiB family protein	NA	NA	NA	NA	NA
WP_058894791.1|1594921_1595272_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_058894792.1|1595514_1596903_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_058894793.1|1597222_1597549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058894794.1|1597619_1598183_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_058894795.1|1598442_1599471_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_058894796.1|1599568_1600948_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_058894797.1|1600944_1601691_-	response regulator	NA	NA	NA	NA	NA
WP_058894798.1|1601919_1602441_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_058894799.1|1602747_1604289_+	MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_058894800.1|1604313_1607421_+	MdtB/MuxB family multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_058894801.1|1607433_1610670_+	MMPL family transporter	NA	S5VTK5	Leptospira_phage	22.1	4.8e-62
WP_058894802.1|1610692_1612222_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_058894803.1|1612228_1614070_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	34.7	4.0e-45
WP_058894804.1|1614243_1615647_+	MFS transporter	NA	NA	NA	NA	NA
WP_058894805.1|1615669_1616578_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017454378.1|1616604_1617591_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_058894806.1|1617938_1620056_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_058894807.1|1620063_1621650_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_058894808.1|1621640_1622615_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_058894809.1|1622611_1623442_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_058894810.1|1623438_1624890_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	33.1	2.7e-12
WP_058894811.1|1624917_1625262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058894812.1|1625265_1626825_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	5.6e-16
WP_058894813.1|1627021_1631044_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_058894814.1|1631098_1632874_-	outer membrane protein assembly factor	NA	NA	NA	NA	NA
WP_082685998.1|1633206_1634016_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_017454389.1|1634374_1635040_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_058894815.1|1635507_1636401_-	glutamate racemase	NA	NA	NA	NA	NA
WP_058894816.1|1636444_1637986_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_017454392.1|1638018_1638639_-	YqhA family protein	NA	K4K6D8	Caulobacter_phage	31.5	2.0e-17
WP_058894817.1|1639065_1641048_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.7	7.2e-85
1641297:1641356	attL	TTCGAATCCCCCCCTCTCCGCCAGAACAGAACGCCTAACCTATTGATTTTCAATGGTTAG	NA	NA	NA	NA
WP_058894818.1|1641485_1642640_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	57.4	5.3e-120
WP_058894819.1|1642862_1643228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058894820.1|1643367_1645419_-	replication endonuclease	NA	A4JWW0	Burkholderia_virus	41.5	8.2e-108
WP_058894821.1|1645408_1645762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058894822.1|1645850_1646057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082685999.1|1646136_1646397_-	ogr/Delta-like zinc finger family protein	NA	E5E3T8	Burkholderia_phage	50.0	8.2e-13
WP_058894823.1|1646387_1646585_-	hypothetical protein	NA	A4PE59	Ralstonia_virus	47.2	1.1e-06
WP_058894824.1|1646622_1646820_-	hypothetical protein	NA	E5E3U0	Burkholderia_phage	54.7	3.4e-11
WP_156425813.1|1646838_1647039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058894826.1|1647122_1647548_+	helix-turn-helix transcriptional regulator	NA	K4NXA8	Burkholderia_phage	53.5	2.7e-21
WP_156425814.1|1647662_1648328_+	DUF1496 domain-containing protein	NA	A4PE55	Ralstonia_virus	27.3	2.2e-14
WP_082686000.1|1648386_1650330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058894829.1|1650337_1651567_-	late control protein	NA	K4PAY4	Burkholderia_phage	49.4	1.7e-84
WP_058894830.1|1651563_1652211_-|tail	phage tail protein	tail	A0A2H4JG54	uncultured_Caudovirales_phage	59.1	2.2e-38
WP_058894831.1|1652222_1654847_-	hypothetical protein	NA	A4PE52	Ralstonia_virus	54.4	2.4e-221
WP_006464173.1|1654847_1654961_-|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	67.6	5.4e-06
WP_058894832.1|1654969_1655287_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	52.7	3.5e-18
WP_058894833.1|1655346_1655856_-|tail	phage major tail tube protein	tail	R4JEU1	Burkholderia_phage	54.4	4.2e-45
WP_058894834.1|1655913_1657092_-|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	67.3	1.8e-147
WP_082686143.1|1657116_1657299_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_058897507.1|1657403_1658003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058894836.1|1658608_1659208_-|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	58.4	4.3e-57
WP_058894837.1|1659221_1660145_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	51.2	3.3e-72
WP_034309811.1|1660141_1660486_-	oxidoreductase	NA	E5FFH4	Burkholderia_phage	47.9	7.0e-20
WP_058894838.1|1660482_1661127_-|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	40.0	1.3e-30
WP_058894839.1|1661225_1661762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058894840.1|1661852_1662323_-	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	54.6	1.5e-36
WP_058894841.1|1662319_1662805_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	51.0	6.0e-33
WP_058894842.1|1662758_1663328_-	lysozyme	NA	NA	NA	NA	NA
WP_058894843.1|1663324_1663855_-	glycoside hydrolase family 104 protein	NA	Q9MC90	Pseudomonas_phage	62.3	1.3e-41
WP_058894844.1|1663851_1664226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017452849.1|1664266_1664476_-|tail	tail protein X	tail	E5FFI3	Burkholderia_phage	47.8	7.8e-06
WP_058894845.1|1664475_1664967_-|head	head completion/stabilization protein	head	A4JWU5	Burkholderia_virus	53.5	4.3e-31
WP_058894846.1|1665055_1665775_-|integrase	integrase	integrase	A0A2H4J948	uncultured_Caudovirales_phage	45.1	1.1e-43
WP_017452846.1|1665774_1666818_-|capsid	phage major capsid protein, P2 family	capsid	A4PE30	Ralstonia_virus	63.4	2.5e-113
WP_058894847.1|1666869_1667712_-|capsid	GPO family capsid scaffolding protein	capsid	E5FFI7	Burkholderia_phage	48.6	1.0e-56
WP_044527945.1|1667855_1669637_+|terminase	terminase ATPase subunit family protein	terminase	A4JWQ1	Burkholderia_virus	65.8	1.6e-229
WP_058894848.1|1669636_1670689_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	61.6	1.5e-121
WP_058894849.1|1670918_1671644_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	45.9	4.0e-41
WP_058894850.1|1671640_1672243_-	hypothetical protein	NA	A4PE25	Ralstonia_virus	46.2	3.8e-37
WP_058894851.1|1672242_1672590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058894852.1|1672573_1673083_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	56.7	1.2e-44
WP_058894853.1|1673079_1673496_-	PAAR domain-containing protein	NA	A4PE23	Ralstonia_virus	44.7	6.9e-22
WP_082686002.1|1674106_1675267_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_123020395.1|1675286_1676517_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	79.1	7.3e-128
1680042:1680119	attR	TTCGAATCCCCCCCTCTCCGCCAGAACAGAACGCCTAACCTATTGATTTTCAATGGTTAGGCGTTTTTTTATGTCTCA	NA	NA	NA	NA
>prophage 2
NZ_CP013737	Herbaspirillum rubrisubalbicans M1, complete genome	5611261	2662814	2703383	5611261	plate,protease,transposase	Burkholderia_virus(40.0%)	42	NA	NA
WP_156425905.1|2662814_2663024_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_123020395.1|2663059_2664290_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	79.1	7.3e-128
WP_156425828.1|2664642_2665431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123020447.1|2665606_2666044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156425829.1|2666538_2666691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156425830.1|2666796_2666946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082686038.1|2666942_2667344_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_058895475.1|2667893_2668226_+	thioredoxin	NA	A0A1V0SD63	Indivirus	50.0	1.8e-09
WP_058895476.1|2668229_2669129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082686039.1|2669170_2670646_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_082686040.1|2670819_2671767_-	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_082686149.1|2671770_2672292_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_058895478.1|2672803_2673268_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_058897558.1|2673730_2676064_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_058897559.1|2676593_2676860_+	TonB family protein	NA	NA	NA	NA	NA
WP_058895479.1|2676914_2677646_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_082686151.1|2677662_2678076_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_058895481.1|2678072_2679857_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_082686042.1|2679853_2681227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058897560.1|2681322_2682765_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_156425831.1|2683567_2684293_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_082686044.1|2684253_2684835_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_058895484.1|2684917_2685460_-	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	43.6	4.8e-31
WP_058895485.1|2685657_2686059_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_058895486.1|2686120_2686432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058895487.1|2686483_2686759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058895488.1|2686774_2687284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044530237.1|2688029_2688374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058895489.1|2688404_2688668_+	DUF1640 domain-containing protein	NA	Q2A091	Sodalis_phage	34.4	3.7e-05
WP_058895490.1|2688881_2689358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156425832.1|2689354_2689657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123020395.1|2689826_2691058_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	79.1	7.3e-128
WP_058895492.1|2691415_2692315_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058895493.1|2692476_2693280_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_058895494.1|2693297_2694119_-	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_058895495.1|2694234_2694600_+	RidA family protein	NA	NA	NA	NA	NA
WP_058895496.1|2694596_2695802_+	MFS transporter	NA	NA	NA	NA	NA
WP_123020500.1|2697869_2699366_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_058895498.1|2699434_2700007_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_058895499.1|2700059_2700443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058895500.1|2700507_2702334_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_058895501.1|2702297_2703383_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 3
NZ_CP013737	Herbaspirillum rubrisubalbicans M1, complete genome	5611261	3465172	3476905	5611261		Bacillus_phage(25.0%)	9	NA	NA
WP_058896032.1|3465172_3465598_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.4	3.5e-21
WP_058896033.1|3465867_3466557_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	36.8	4.8e-28
WP_058896035.1|3468225_3469587_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.3	2.6e-25
WP_058896036.1|3469728_3470742_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	33.9	4.6e-35
WP_058896037.1|3470745_3471711_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1P8CWQ1	Bacillus_phage	42.4	4.1e-09
WP_058896038.1|3471952_3472918_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	48.4	3.7e-34
WP_058896039.1|3472914_3473652_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	56.2	1.1e-73
WP_058896040.1|3473724_3474672_-	flagellar brake protein	NA	NA	NA	NA	NA
WP_058896041.1|3474673_3476905_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.8	3.1e-84
