The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010995	Campylobacter iguaniorum strain 2463D, complete genome	1809624	45966	53688	1809624		uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_058893728.1|45966_46740_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	34.9	1.2e-06
WP_058892762.1|46730_47582_+	FkbM family methyltransferase	NA	A0A1B1IVQ8	uncultured_Mediterranean_phage	37.0	1.3e-35
WP_082663198.1|48201_49377_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	34.0	1.7e-28
WP_069435763.1|49495_50056_+	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	37.8	4.5e-16
WP_058892764.1|50170_51148_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_058892765.1|51149_51569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058892767.1|51884_52811_+	phosphoglycerate dehydrogenase	NA	A7ITA6	Paramecium_bursaria_Chlorella_virus	31.9	1.0e-28
WP_058892768.1|52800_53688_+	NAD(P)-dependent oxidoreductase	NA	A0A2H4UUK0	Bodo_saltans_virus	31.8	1.1e-21
>prophage 2
NZ_CP010995	Campylobacter iguaniorum strain 2463D, complete genome	1809624	58726	67900	1809624		Klosneuvirus(33.33%)	10	NA	NA
WP_058892774.1|58726_59665_+	NAD(P)-dependent oxidoreductase	NA	I7HTA3	Enterobacteria_phage	28.7	2.8e-18
WP_058892775.1|59665_60571_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	37.3	8.9e-14
WP_058892776.1|60572_61397_+	SDR family oxidoreductase	NA	A0A1V0SKV4	Klosneuvirus	31.4	3.2e-10
WP_058892777.1|61396_62488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058892778.1|62487_64116_+	asparagine synthase (glutamine-hydrolyzing)	NA	M1PN68	Moumouvirus	26.9	3.7e-26
WP_156412497.1|64142_64334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082663199.1|64348_65488_+	N-acetyl sugar amidotransferase	NA	NA	NA	NA	NA
WP_058892780.1|65484_66096_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_058892781.1|66096_66870_+	imidazole glycerol phosphate synthase cyclase subunit	NA	A0A1V0SIZ6	Klosneuvirus	26.4	2.0e-06
WP_058892782.1|66856_67900_+	acyltransferase	NA	Q716G0	Shigella_phage	25.5	2.1e-06
>prophage 3
NZ_CP010995	Campylobacter iguaniorum strain 2463D, complete genome	1809624	918276	996584	1809624	terminase,capsid,integrase,portal,plate,tRNA,tail	Campylobacter_phage(23.08%)	97	961154:961173	996871:996890
WP_058893200.1|918276_919380_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A0U4J6Z1	Vibrio_phage	30.8	1.0e-24
WP_038454230.1|919339_919678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038454232.1|919674_919920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038454234.1|919916_920987_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_038454237.1|921000_921477_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_058893201.1|921573_922173_-	LysE family translocator	NA	NA	NA	NA	NA
WP_058893202.1|922172_922778_-	LysE family translocator	NA	NA	NA	NA	NA
WP_058893203.1|922894_923371_+	DUF4405 domain-containing protein	NA	NA	NA	NA	NA
WP_058893204.1|923402_924446_-	type II asparaginase	NA	NA	NA	NA	NA
WP_058893205.1|924578_925859_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_038454249.1|925975_926896_+	AEC family transporter	NA	NA	NA	NA	NA
WP_038454252.1|926926_927136_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_038454254.1|927254_928136_+	DMT family transporter	NA	NA	NA	NA	NA
WP_038454256.1|928174_929812_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	61.2	6.2e-167
WP_038454258.1|929822_930086_-	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	40.2	3.2e-09
WP_058893206.1|930304_932851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038454262.1|932847_933435_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_038454264.1|933419_934778_-	magnesium transporter	NA	NA	NA	NA	NA
WP_058893207.1|934786_935953_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2P1JY73	Gordonia_phage	43.1	5.3e-19
WP_058893208.1|936063_936723_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_038454270.1|937047_937227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038454272.1|937249_937717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038454274.1|938175_938898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058893209.1|938897_940277_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_038455593.1|940297_941089_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_038454278.1|941148_942603_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	56.6	9.5e-143
WP_058893210.1|942611_943667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038454282.1|943682_944603_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_058893211.1|944599_945016_-	FxsA family protein	NA	NA	NA	NA	NA
WP_058893212.1|945012_946716_-|tRNA	proline--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	24.5	9.8e-06
WP_038454287.1|946715_947981_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_058893213.1|947980_948865_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_038454291.1|948851_949289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038454293.1|949281_949545_-	DUF2018 family protein	NA	NA	NA	NA	NA
WP_058893759.1|949614_951687_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	48.8	7.1e-83
WP_058893214.1|951849_954270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893215.1|954371_955913_-	inorganic phosphate transporter	NA	M4QMY4	Ostreococcus_lucimarinus_virus	26.0	1.7e-36
WP_038454300.1|955969_956902_-	4-hydroxythreonine-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_058893216.1|956898_957672_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_058893217.1|957719_958544_-	adenylosuccinate lyase	NA	NA	NA	NA	NA
WP_038454306.1|958588_959314_-	arginyltransferase	NA	NA	NA	NA	NA
WP_058893218.1|959306_959537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038454310.1|959540_960986_-	acetyl-CoA carboxylase subunit A	NA	NA	NA	NA	NA
961154:961173	attL	TGGTGCGCCCTAGAGAATTC	NA	NA	NA	NA
WP_058893219.1|961371_962286_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_058893220.1|962276_962480_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_058893221.1|962476_962956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893222.1|962952_963339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893223.1|963342_965643_-|tail	phage tail tape measure protein	tail	A7YG97	Campylobacter_phage	27.1	1.8e-42
WP_058893224.1|965685_965883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058893225.1|966005_966263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893226.1|966274_966505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082663247.1|966518_967007_-|tail	phage tail protein	tail	A7YGZ4	Campylobacter_phage	26.1	1.9e-10
WP_058893228.1|967115_968225_-|tail	phage tail sheath family protein	tail	A7YGH4	Campylobacter_phage	27.2	4.9e-30
WP_058893229.1|968214_968670_-	glycoside hydrolase family protein	NA	A0A1L2CUV5	Pectobacterium_phage	34.2	1.8e-15
WP_058893230.1|968666_968993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893231.1|969124_969502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893232.1|969562_969811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893233.1|969807_970236_-	hypothetical protein	NA	A0A0F6R5Y6	Sinorhizobium_phage	43.3	3.6e-05
WP_058893234.1|970248_971784_-	hypothetical protein	NA	A0A2K9VI36	Pseudomonas_phage	27.9	1.6e-31
WP_058893235.1|971796_972906_-|tail	phage tail protein	tail	A0A1V0DZY8	Clostridioides_phage	42.8	2.7e-28
WP_058893236.1|972943_973552_-	hypothetical protein	NA	F1BUP2	Erwinia_phage	29.1	1.2e-06
WP_058893237.1|973544_974582_-|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_058893238.1|974585_974873_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_058893239.1|974955_975573_-|plate	phage baseplate assembly protein V	plate	A0A0E3Y4V1	Fusobacterium_phage	31.5	3.0e-05
WP_058893240.1|975676_976060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893241.1|976049_976334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893242.1|976305_976521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893243.1|976653_978369_-|capsid	phage major capsid protein	capsid	A0A0K1Y730	Rhodobacter_phage	21.9	1.2e-19
WP_058893244.1|978365_979754_-|portal	phage portal protein	portal	A0A1W6JT60	Escherichia_phage	26.9	1.5e-28
WP_058893245.1|979762_979981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893142.1|980311_980668_+	HicB family protein	NA	NA	NA	NA	NA
WP_058893246.1|980647_981142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893247.1|981143_981404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893248.1|981400_983113_-|terminase	terminase	terminase	A0A0C5ABH4	Bacteriophage	35.1	1.4e-84
WP_058893249.1|983801_984479_+	sce7726 family protein	NA	NA	NA	NA	NA
WP_058893250.1|984442_985522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893251.1|985526_985934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893252.1|985948_986140_-	excalibur calcium-binding domain-containing protein	NA	Q19UP2	Mannheimia_phage	42.9	3.8e-07
WP_058893760.1|986150_986852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893253.1|986847_987396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082663224.1|987435_988251_-	LexA family transcriptional regulator	NA	Q76TK4	Streptococcus_pyogenes_phage	38.5	2.4e-10
WP_141070371.1|988345_988654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156412508.1|988943_989084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058893256.1|989059_989296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058893257.1|989282_989504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058893258.1|989507_989963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156412509.1|989959_990127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058893259.1|990135_991044_+	hypothetical protein	NA	X2KQ81	Campylobacter_phage	34.4	5.4e-27
WP_082663225.1|991055_991802_+	site-specific DNA-methyltransferase	NA	X2KR14	Campylobacter_phage	78.5	2.6e-112
WP_082663226.1|991814_992141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058893260.1|992142_992592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058893261.1|992641_992833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058893262.1|992845_993058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058893263.1|993177_994026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058893264.1|994123_994363_+	helix-turn-helix transcriptional regulator	NA	M5A9C2	Nitratiruptor_phage	40.8	1.1e-08
WP_058893265.1|994854_995322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058893266.1|995360_996584_-|integrase	tyrosine-type recombinase/integrase	integrase	X2KXI6	Campylobacter_phage	28.0	8.0e-26
996871:996890	attR	TGGTGCGCCCTAGAGAATTC	NA	NA	NA	NA
>prophage 4
NZ_CP010995	Campylobacter iguaniorum strain 2463D, complete genome	1809624	1367368	1453135	1809624	terminase,capsid,integrase,portal,plate,tRNA,tail	Campylobacter_phage(17.24%)	100	1441719:1441734	1452091:1452106
WP_058893478.1|1367368_1369705_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_058893479.1|1369701_1370694_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.3	1.7e-34
WP_038454745.1|1370809_1371169_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_038454747.1|1371197_1372049_-	universal stress protein	NA	NA	NA	NA	NA
WP_038454749.1|1372059_1374246_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_038454751.1|1374255_1374936_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_038454753.1|1374932_1377122_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_058893480.1|1377111_1377567_-	RDD family protein	NA	NA	NA	NA	NA
WP_038454757.1|1377563_1378811_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_058893481.1|1379065_1379698_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_038454761.1|1379694_1380168_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_038454763.1|1380167_1381700_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.5	4.2e-16
WP_058893482.1|1381873_1382326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058893483.1|1382315_1384127_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_058893484.1|1384172_1384925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058893485.1|1384921_1387993_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.0	2.2e-40
WP_038454772.1|1387989_1388370_+	response regulator	NA	NA	NA	NA	NA
WP_038454774.1|1388358_1388763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081867167.1|1388860_1389376_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_058893486.1|1389445_1390141_+	dUTPase	NA	NA	NA	NA	NA
WP_058893487.1|1390137_1390872_+	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_058893488.1|1390874_1392641_+	sodium:phosphate symporter	NA	NA	NA	NA	NA
WP_038454784.1|1392701_1392893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058893489.1|1393130_1393463_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_038454790.1|1395104_1395515_-	acyl-CoA thioesterase	NA	A0A292GK23	Xanthomonas_phage	36.1	8.1e-07
WP_058893490.1|1395591_1396602_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_058893491.1|1396717_1398538_+	invasion protein CiaB	NA	NA	NA	NA	NA
WP_002850080.1|1398645_1398948_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_058893492.1|1399253_1399490_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_058893493.1|1399499_1400456_-	permease	NA	NA	NA	NA	NA
WP_058893494.1|1400583_1400898_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038454800.1|1400916_1401207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893495.1|1401261_1402518_-	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	47.7	2.4e-102
WP_038455674.1|1402600_1403482_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_038454804.1|1403574_1404723_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_058893496.1|1404947_1406324_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_058893497.1|1406345_1408169_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_144242191.1|1408311_1409886_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.6	4.2e-152
WP_058893498.1|1409981_1411373_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_038454813.1|1411360_1411630_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_038454815.1|1411700_1412612_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_038454817.1|1412693_1412924_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_038454819.1|1412920_1415032_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_058893499.1|1415283_1415718_-	lysozyme	NA	A0A1L2CUV5	Pectobacterium_phage	36.4	1.4e-12
WP_058893500.1|1415714_1416041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893501.1|1416187_1416553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893502.1|1416549_1416798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893503.1|1416807_1417749_-	hypothetical protein	NA	A0A088FRU7	Escherichia_phage	27.2	1.4e-17
WP_082663250.1|1417742_1417940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893505.1|1417929_1418301_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_058893506.1|1418311_1418959_-|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	32.4	8.0e-09
WP_058893507.1|1419136_1419565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893508.1|1419568_1419886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893509.1|1419878_1420151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893510.1|1420147_1421890_-|capsid	phage major capsid protein	capsid	A0A193GYA3	Enterobacter_phage	36.1	5.7e-94
WP_058893511.1|1421879_1423322_-|portal	phage portal protein	portal	Q6R4V2	Vibrio_virus	39.2	8.1e-94
WP_058893512.1|1423321_1423552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893513.1|1423629_1425372_-|tail	phage tail tape measure protein	tail	A0A2K9VGW0	Faecalibacterium_phage	40.0	6.4e-77
WP_058893514.1|1425403_1425616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058893515.1|1425700_1425904_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_058893516.1|1425908_1426403_-	hypothetical protein	NA	K4I1G5	Acidithiobacillus_phage	25.6	1.2e-07
WP_058893517.1|1426402_1427530_-|tail	phage tail protein	tail	A7YGJ8	Campylobacter_phage	32.8	6.0e-52
WP_058893518.1|1427626_1428661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893519.1|1428745_1429330_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_058893520.1|1429436_1429883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156412523.1|1429905_1430334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893522.1|1430330_1431209_-|tail	phage tail protein	tail	A0A0A7RTP0	Clostridium_phage	34.4	9.5e-21
WP_058893523.1|1431218_1431866_-|tail	phage tail protein I	tail	Q19UQ4	Mannheimia_phage	36.6	1.2e-17
WP_058893524.1|1431834_1432929_-	hypothetical protein	NA	D5LGZ3	Escherichia_phage	36.7	1.4e-21
WP_069435758.1|1432921_1433206_-	hypothetical protein	NA	A0A2H4JE52	uncultured_Caudovirales_phage	46.4	3.0e-08
WP_156412524.1|1433271_1433442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893525.1|1433441_1435205_-|terminase	phage terminase large subunit family protein	terminase	A0A0C5ABH4	Bacteriophage	48.4	4.8e-149
WP_058893526.1|1435201_1435861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893527.1|1436241_1436760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893528.1|1436759_1437824_-|integrase	site-specific integrase	integrase	A0A067ZJC0	Vibrio_phage	27.1	1.2e-22
WP_058893529.1|1437908_1438115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893530.1|1438111_1438807_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_058893531.1|1438810_1439575_-	helix-turn-helix domain-containing protein	NA	R9TPU9	Vibrio_phage	42.2	7.3e-09
WP_156412525.1|1439650_1439824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058893532.1|1439833_1440022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893533.1|1440122_1440434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058893534.1|1440436_1440664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893535.1|1440788_1441499_+	S24 family peptidase	NA	NA	NA	NA	NA
WP_058893536.1|1441500_1441746_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
1441719:1441734	attL	CTTTTTTACCTTTTAC	NA	NA	NA	NA
WP_058893537.1|1441723_1441957_-	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_069435759.1|1442026_1443475_-	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	46.5	5.0e-43
WP_058893539.1|1443485_1443782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058893540.1|1444368_1444611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058893541.1|1444612_1444801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058893542.1|1444791_1444995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058893543.1|1445004_1445454_+	DUF736 family protein	NA	NA	NA	NA	NA
WP_058893544.1|1445464_1446016_+	hypothetical protein	NA	A0A1B0XW37	Campylobacter_phage	34.4	1.2e-16
WP_058893545.1|1446134_1446980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058893546.1|1446990_1447230_+	transcriptional regulator	NA	M5A9C2	Nitratiruptor_phage	42.1	2.5e-08
WP_156412526.1|1447791_1448031_+	transcriptional regulator	NA	X2KQ78	Campylobacter_phage	47.1	1.9e-08
WP_058893548.1|1448429_1449110_+	Rha family transcriptional regulator	NA	X2KM03	Campylobacter_phage	41.4	1.1e-29
WP_058893769.1|1449137_1449371_+	DUF3310 domain-containing protein	NA	Q774Z7	Bordetella_phage	59.0	1.2e-15
WP_058893549.1|1449380_1449587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058893550.1|1449576_1450743_-|integrase	tyrosine-type recombinase/integrase	integrase	X2KXI6	Campylobacter_phage	24.7	6.9e-19
WP_038454820.1|1451059_1453135_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.8	5.7e-64
1452091:1452106	attR	CTTTTTTACCTTTTAC	NA	NA	NA	NA
