The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013097	Salmonella enterica subsp. enterica serovar Enteritidis strain CMCC50041 chromosome, complete genome	4676329	931424	938737	4676329	protease,integrase	Dickeya_phage(16.67%)	7	920162:920176	938955:938969
920162:920176	attL	AGCCTGCGAGGAGAC	NA	NA	NA	NA
WP_001201751.1|931424_932543_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125875.1|932539_934486_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|934615_934837_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|935160_935481_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_058901163.1|935511_937788_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	1.1e-164
WP_001117984.1|938000_938198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|938359_938737_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
938955:938969	attR	GTCTCCTCGCAGGCT	NA	NA	NA	NA
>prophage 2
NZ_CP013097	Salmonella enterica subsp. enterica serovar Enteritidis strain CMCC50041 chromosome, complete genome	4676329	1010447	1021241	4676329	tail	Escherichia_phage(37.5%)	9	NA	NA
WP_000274547.1|1010447_1011077_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_000729406.1|1011060_1011687_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000583382.1|1011683_1013393_+|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000143167.1|1013392_1013974_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001674638.1|1014451_1015420_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000334547.1|1016067_1016694_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001525490.1|1017053_1017740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1018010_1018202_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193790.1|1018628_1021241_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
>prophage 3
NZ_CP013097	Salmonella enterica subsp. enterica serovar Enteritidis strain CMCC50041 chromosome, complete genome	4676329	1223106	1272356	4676329	protease,integrase,lysis,holin,tail	Salmonella_phage(28.57%)	47	1222942:1222971	1242563:1242592
1222942:1222971	attL	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
WP_000087636.1|1223106_1224186_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
WP_001575998.1|1224160_1224439_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_001237395.1|1224852_1226832_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_000911593.1|1227520_1227769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000940753.1|1227832_1228432_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000784710.1|1228428_1228656_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_001097218.1|1228785_1229475_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_001574213.1|1229571_1230096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798708.1|1230469_1230919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001574215.1|1231279_1231966_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_001574216.1|1232241_1232571_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1232554_1233007_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1233024_1233504_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000877926.1|1234398_1234932_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|1235021_1235717_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000161704.1|1239771_1240494_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_001536069.1|1240973_1241774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077681935.1|1243631_1244126_-	RecE	NA	A0A0U2I1R6	Escherichia_phage	70.3	3.7e-22
1242563:1242592	attR	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
WP_001013467.1|1244315_1244546_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|1244599_1245133_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|1245389_1245557_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001576014.1|1245621_1245810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|1245864_1246356_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_001687735.1|1248460_1248961_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	77.4	1.5e-63
WP_012543349.1|1249057_1249258_-	phage virulence factor PagK family protein	NA	NA	NA	NA	NA
WP_000457876.1|1249827_1249953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951652.1|1250453_1250600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000848072.1|1251087_1251702_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000480735.1|1251711_1251870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233445.1|1252002_1252917_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001576018.1|1256055_1256196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001576019.1|1256361_1256631_-	hypothetical protein	NA	B6SCX2	Bacteriophage	47.9	3.1e-07
WP_001025515.1|1257003_1257423_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000030934.1|1257795_1258272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000422882.1|1258601_1258997_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
WP_000182071.1|1259680_1260403_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_001134856.1|1260687_1260852_+	membrane protein	NA	NA	NA	NA	NA
WP_000986173.1|1261075_1261726_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
WP_000457838.1|1261744_1261936_-	YebW family protein	NA	NA	NA	NA	NA
WP_024131108.1|1262046_1262283_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001531515.1|1262400_1263840_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001529852.1|1263917_1266551_-	PqiB family protein	NA	NA	NA	NA	NA
WP_001207294.1|1266519_1267803_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001518229.1|1267931_1268429_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431401.1|1268526_1269213_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001091237.1|1269232_1271281_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000984498.1|1271474_1272356_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 4
NZ_CP013097	Salmonella enterica subsp. enterica serovar Enteritidis strain CMCC50041 chromosome, complete genome	4676329	1463653	1477929	4676329	tRNA,holin	Escherichia_phage(66.67%)	19	NA	NA
WP_000123686.1|1463653_1465027_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
WP_001156217.1|1465070_1466006_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_001676915.1|1466322_1466940_-	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_000800272.1|1466967_1467285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|1467369_1467591_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_058901165.1|1468028_1468550_+	superinfection exclusion B family protein	NA	NA	NA	NA	NA
WP_085981757.1|1468657_1468813_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_001227859.1|1469197_1469665_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_001676916.1|1469937_1470267_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001033796.1|1470428_1470983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000556389.1|1470979_1471912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000882662.1|1472281_1472494_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000734094.1|1472784_1472955_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	61.8	8.5e-11
WP_000940751.1|1473017_1473617_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000774470.1|1473616_1473907_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000640113.1|1473903_1474440_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_001688615.1|1476927_1477116_+	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000445513.1|1477105_1477387_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_000802786.1|1477383_1477929_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
>prophage 5
NZ_CP013097	Salmonella enterica subsp. enterica serovar Enteritidis strain CMCC50041 chromosome, complete genome	4676329	2131628	2142135	4676329		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2131628_2132942_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565913.1|2132968_2134048_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000648783.1|2134052_2134826_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018223.1|2134841_2135816_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973709.1|2135821_2136373_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000857535.1|2136373_2137252_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_001023658.1|2137299_2138199_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697846.1|2138198_2139284_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|2139660_2140554_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001144948.1|2140731_2142135_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
>prophage 6
NZ_CP013097	Salmonella enterica subsp. enterica serovar Enteritidis strain CMCC50041 chromosome, complete genome	4676329	2209332	2218503	4676329	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195340.1|2209332_2211366_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703145.1|2211606_2212065_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_001197951.1|2212236_2212767_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950414.1|2212823_2213291_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_000598637.1|2213337_2214057_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2214053_2215739_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240421.1|2215961_2216693_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_001261696.1|2216752_2216860_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|2216840_2217572_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569168.1|2217555_2218503_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
>prophage 7
NZ_CP013097	Salmonella enterica subsp. enterica serovar Enteritidis strain CMCC50041 chromosome, complete genome	4676329	2454934	2460994	4676329		Salmonella_virus(50.0%)	6	NA	NA
WP_000377779.1|2454934_2455876_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
WP_001576268.1|2457118_2457508_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000703599.1|2457476_2457731_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_000400616.1|2457748_2459671_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_105789228.1|2460660_2460804_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_108630384.1|2460742_2460994_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	68.6	7.6e-08
>prophage 8
NZ_CP013097	Salmonella enterica subsp. enterica serovar Enteritidis strain CMCC50041 chromosome, complete genome	4676329	2690379	2790328	4676329	plate,tRNA,integrase,lysis,head,terminase,portal,tail,capsid,transposase	Salmonella_phage(76.36%)	91	2708752:2708766	2789233:2789247
WP_000083345.1|2690379_2691117_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2691246_2692581_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001675040.1|2692598_2693498_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188410.1|2693600_2694188_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2694249_2694633_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2694951_2695641_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2695756_2696794_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098733.1|2696997_2697417_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	39.0	5.9e-13
WP_000183642.1|2697489_2698170_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_000082648.1|2698223_2700884_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_058901173.1|2700998_2702354_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264473.1|2702398_2702722_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807815.1|2702718_2704020_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.6	1.8e-44
WP_000985655.1|2704123_2704579_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	49.3	3.9e-34
2708752:2708766	attL	TTTGAGTTCCCGGCC	NA	NA	NA	NA
WP_001235093.1|2710358_2712932_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.0e-127
WP_000992636.1|2713061_2713793_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|2713789_2714770_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|2714901_2715639_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|2715910_2716249_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|2716352_2716400_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200077.1|2716499_2717660_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210984.1|2717620_2718529_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225188.1|2718586_2719708_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|2719717_2720788_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|2721227_2721746_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|2721738_2722959_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|2723115_2723463_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|2723503_2724271_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2724315_2724864_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2724882_2725131_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2725383_2726745_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2726910_2727702_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|2727721_2729008_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287926.1|2729128_2729734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2729768_2730359_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059151.1|2730482_2731361_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2731446_2733108_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2733256_2733595_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2733760_2734051_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2734040_2734517_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2734666_2735149_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_058901174.1|2735763_2747238_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533863.1|2747302_2748712_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196151.1|2748708_2750889_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_012543392.1|2750896_2752060_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000980500.1|2752611_2752830_-	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_001102269.1|2752898_2753999_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980411.1|2753995_2754481_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
WP_001282768.1|2754477_2757285_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.9	0.0e+00
WP_000763316.1|2757277_2757397_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001280963.1|2757411_2757714_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
WP_001207651.1|2757768_2758284_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_000046108.1|2758293_2759466_-|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	100.0	8.9e-224
WP_000974843.1|2759568_2759793_-	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000143187.1|2760662_2761238_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_001274649.1|2761237_2763091_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	100.0	0.0e+00
WP_001086804.1|2763087_2763693_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_000268332.1|2763685_2764594_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_000189373.1|2764580_2764940_-	GPW/gp25 family protein	NA	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_001672413.1|2764936_2765515_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000958562.1|2765592_2766444_+	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_000343949.1|2766445_2766892_-	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_001039958.1|2766884_2767316_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000196199.1|2767411_2767840_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_001069923.1|2767836_2768352_-	lysozyme	NA	E5G6N1	Salmonella_phage	100.0	5.3e-96
WP_000171565.1|2768332_2768548_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868184.1|2768551_2768755_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000673537.1|2768754_2769219_-|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	100.0	9.9e-86
WP_000059173.1|2769312_2769963_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000730759.1|2769966_2771028_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	100.0	2.1e-195
WP_000216276.1|2771044_2771878_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_001098395.1|2772020_2773787_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_001542203.1|2773786_2774827_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001284991.1|2774930_2776595_-	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_001673609.1|2776908_2777586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|2777699_2777933_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154433.1|2777943_2778132_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_000017507.1|2778284_2780699_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	100.0	0.0e+00
WP_000104187.1|2780695_2781553_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	100.0	6.8e-165
WP_000752613.1|2781549_2781777_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244219.1|2781776_2782010_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
WP_000963474.1|2782077_2782419_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	100.0	1.2e-56
WP_000956190.1|2782382_2782583_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_000460848.1|2782590_2783100_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
WP_000102105.1|2783133_2783376_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000932273.1|2783497_2784130_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000218402.1|2784132_2785149_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	100.0	5.0e-199
WP_000360326.1|2785701_2786364_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	100.0	3.4e-124
WP_001142974.1|2786625_2787219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000445376.1|2787617_2788421_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
WP_089113803.1|2789216_2790328_-|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
2789233:2789247	attR	TTTGAGTTCCCGGCC	NA	NA	NA	NA
>prophage 1
NZ_CP013098	Salmonella enterica subsp. enterica serovar Enteritidis strain CMCC50041 plasmid pCMCC50041, complete sequence	59373	45626	52534	59373	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_000925628.1|45626_46049_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
WP_000457542.1|46048_47323_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.9e-156
WP_000064277.1|47404_48379_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	5.1e-84
WP_000427676.1|48378_49584_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728919.1|49998_50940_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
WP_000176303.1|50936_51542_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|51598_51934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|52117_52534_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
