The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011917	Burkholderia cenocepacia strain ST32 chromosome 1, complete sequence	3822749	466	68817	3822749	plate,transposase	Pseudomonas_phage(18.18%)	48	NA	NA
WP_088925042.1|466_1701_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.5	1.1e-102
WP_058901183.1|2117_3011_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_058902250.1|3354_4377_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	48.4	3.5e-83
WP_058901184.1|4373_5159_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	58.8	3.1e-79
WP_095423477.1|10199_11016_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.9	1.9e-07
WP_058901186.1|11231_12284_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_058901187.1|12769_13123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058901188.1|13693_14020_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_058901189.1|14273_16475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077021874.1|16476_17130_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_077021875.1|17126_17969_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0F7L647	uncultured_marine_virus	34.0	7.2e-26
WP_058901190.1|17961_19242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088925042.1|19426_20661_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.5	1.1e-102
WP_058901191.1|22630_23560_-	DUF4007 family protein	NA	NA	NA	NA	NA
WP_058901192.1|24209_24563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077175671.1|24682_25282_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_058901194.1|25439_27197_-	hypothetical protein	NA	A0A1L7N0M1	Ralstonia_phage	35.1	4.1e-63
WP_058901195.1|27389_29399_-	acyltransferase	NA	C6ZR20	Salmonella_phage	41.6	2.1e-84
WP_077021877.1|29599_29929_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058901196.1|30223_33913_+	AAA family ATPase	NA	A0A2P0VMS9	Tetraselmis_virus	30.9	2.9e-10
WP_048989158.1|34131_34770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058901197.1|34772_35072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058901198.1|35389_36196_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_058901199.1|37351_38266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058901200.1|38317_38533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058901201.1|38544_39540_-	endonuclease	NA	A6XMH8	Bacillus_virus	39.2	3.9e-55
WP_058901202.1|39807_40776_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	43.3	2.0e-59
WP_006486519.1|40893_41121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077175672.1|42689_44660_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_058901204.1|45065_45572_-	acetone carboxylase subunit gamma	NA	NA	NA	NA	NA
WP_058901205.1|45611_47936_-	acetone carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_058901206.1|47947_50092_-	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_058901207.1|50531_50738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058901186.1|50994_52047_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_006485326.1|56561_56765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006485337.1|56874_57675_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_006485338.1|57956_58274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006494425.1|58355_58691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006494424.1|58806_59589_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_006477098.1|59585_60932_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_034178609.1|61037_61649_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_043204524.1|62024_62651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006484395.1|62697_63213_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_006484397.1|63228_64719_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_006477093.1|64789_65293_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_006477092.1|65355_65841_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_048986026.1|65917_67753_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_058901209.1|67716_68817_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
NZ_CP011917	Burkholderia cenocepacia strain ST32 chromosome 1, complete sequence	3822749	263248	334279	3822749	transposase	uncultured_virus(62.5%)	58	NA	NA
WP_105773736.1|263248_264427_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.7	1.2e-42
WP_003098996.1|264836_265337_+	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_020924940.1|268078_269047_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_023106332.1|269165_269819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009459591.1|269938_270232_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023103878.1|270254_271145_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023093406.1|271628_272843_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_028698648.1|273309_274251_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020924943.1|276757_278029_-|transposase	IS4-like element ISPa45 family transposase	transposase	NA	NA	NA	NA
WP_058901262.1|278522_278720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105773736.1|278736_279915_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.7	1.2e-42
WP_154641476.1|280068_281877_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_058901263.1|282027_282933_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017514126.1|283087_283495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007182546.1|283496_284105_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_007182547.1|284101_284992_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_007182548.1|285274_285550_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_105773736.1|286007_287186_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.7	1.2e-42
WP_017514589.1|288140_288539_+	VOC family protein	NA	NA	NA	NA	NA
WP_023106334.1|288721_290056_+	DUF3422 domain-containing protein	NA	NA	NA	NA	NA
WP_011871465.1|290114_290945_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_011871464.1|290961_292269_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011871462.1|293690_295556_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	37.6	5.3e-53
WP_020924950.1|295581_298233_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	33.7	1.3e-153
WP_009876620.1|298313_300158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009876619.1|300463_300781_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009876618.1|300780_301239_+	type II toxin-antitoxin system YhaV family toxin	NA	NA	NA	NA	NA
WP_011871459.1|301266_301644_+	DUF3742 family protein	NA	NA	NA	NA	NA
WP_105773736.1|303028_304207_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.7	1.2e-42
WP_009876615.1|304568_304928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023106340.1|304924_306322_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_009876613.1|306331_307279_-	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_011871456.1|307275_307722_-	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_009876611.1|307880_308375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011871455.1|308559_309324_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_058901265.1|309337_312220_-	conjugative transfer ATPase	NA	NA	NA	NA	NA
WP_003158644.1|312219_312660_-	TIGR03751 family conjugal transfer lipoprotein	NA	NA	NA	NA	NA
WP_011871453.1|312640_314071_-	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_058901266.1|314060_314978_-	TIGR03749 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_009876605.1|314974_315664_-	TIGR03746 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_003158639.1|315660_316071_-	TIGR03750 family conjugal transfer protein	NA	NA	NA	NA	NA
WP_009876604.1|316083_316443_-	TIGR03745 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_009876603.1|316459_316693_-	TIGR03758 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_009876602.1|316689_317070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017514686.1|317206_318109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011871451.1|318213_318888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011871450.1|319039_320092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011871449.1|320192_322817_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_009876598.1|322846_323596_-	TIGR03747 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_058901267.1|323592_325779_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_009876596.1|325783_326332_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_009876595.1|326328_326919_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_009876594.1|326900_327626_-	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_009876593.1|327640_328291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020924956.1|328287_328887_-	PilL	NA	NA	NA	NA	NA
WP_011871446.1|329109_330894_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_077021940.1|330880_332695_+	ATP-dependent helicase	NA	A0A1P8DIG0	Virus_Rctr197k	24.7	5.2e-05
WP_058901268.1|333019_334279_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.0	5.1e-44
>prophage 3
NZ_CP011917	Burkholderia cenocepacia strain ST32 chromosome 1, complete sequence	3822749	345200	396682	3822749	holin,transposase	uncultured_virus(30.0%)	46	NA	NA
WP_105773736.1|345200_346379_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.7	1.2e-42
WP_009876567.1|347406_347730_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_009876566.1|347734_348229_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	43.5	5.0e-27
WP_011871431.1|348239_349310_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_009876564.1|349312_350545_+	MFS transporter	NA	NA	NA	NA	NA
WP_009876563.1|350541_350964_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	75.7	6.3e-55
WP_011871430.1|350956_351679_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	71.7	1.0e-92
WP_006482189.1|352879_354358_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.5	1.6e-15
WP_048989498.1|354542_355475_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_006497713.1|355569_356118_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_058901270.1|356168_356789_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058901271.1|356936_357173_+	ParD-like family protein	NA	NA	NA	NA	NA
WP_006482199.1|357172_357979_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_006482190.1|358099_358603_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_105773736.1|358918_360097_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.7	1.2e-42
WP_006476181.1|360281_361247_+|transposase	IS110-like element ISBcen8 family transposase	transposase	Q75QL1	Wolbachia_phage	34.2	1.3e-23
WP_048989496.1|361263_362181_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006482192.1|362292_363159_+	pirin family protein	NA	NA	NA	NA	NA
WP_006482188.1|363300_363792_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_006491689.1|363814_364684_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_006488671.1|364694_365141_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_006497709.1|365149_365785_-	SCO family protein	NA	NA	NA	NA	NA
WP_006488667.1|366063_366816_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_058901272.1|366812_368198_+	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
WP_058901273.1|368280_370107_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	8.0e-38
WP_006476459.1|370671_371736_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_006491691.1|371971_372775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006497708.1|372814_373279_+	DUF2214 family protein	NA	NA	NA	NA	NA
WP_034200817.1|373359_374712_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_006484310.1|375070_375820_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006497706.1|375958_377107_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006484309.1|377478_379623_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_006484315.1|379900_380761_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_058901274.1|380945_382007_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_006492947.1|382043_383042_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_058901275.1|383680_384856_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_058901276.1|385011_386433_+	hopanoid biosynthesis associated radical SAM protein HpnJ	NA	NA	NA	NA	NA
WP_006493052.1|386436_387321_+	hopanoid biosynthesis-associated protein HpnK	NA	NA	NA	NA	NA
WP_006497701.1|387317_388367_+	membrane protein	NA	NA	NA	NA	NA
WP_058901277.1|388455_389010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006488734.1|389377_390067_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006488739.1|390063_390777_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_006488736.1|390797_391598_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.2	8.4e-24
WP_006488743.1|391620_392661_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_034200813.1|394159_395410_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_058901279.1|395449_396682_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.6	1.6e-42
>prophage 4
NZ_CP011917	Burkholderia cenocepacia strain ST32 chromosome 1, complete sequence	3822749	2819571	2892389	3822749	plate,tail,holin,transposase,integrase	Burkholderia_phage(66.67%)	69	2869763:2869793	2892458:2892488
WP_006477367.1|2819571_2819925_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_006484031.1|2820027_2821446_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	30.1	9.9e-44
WP_006484033.1|2821697_2822432_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_006491878.1|2822454_2823273_-	flagellar biosynthesis protein FlhG	NA	NA	NA	NA	NA
WP_058901981.1|2823265_2825050_-	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_058901982.1|2825046_2827149_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_006485884.1|2827145_2828345_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_006485888.1|2828774_2829272_-	VOC family protein	NA	NA	NA	NA	NA
WP_006497451.1|2829436_2830675_-	DUF3443 family protein	NA	NA	NA	NA	NA
WP_012492269.1|2830691_2831195_-	DUF2844 domain-containing protein	NA	NA	NA	NA	NA
WP_006497453.1|2831454_2832186_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_006485893.1|2832188_2832584_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	6.0e-07
WP_012492268.1|2832651_2833743_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_006497454.1|2833739_2834498_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_058901983.1|2834494_2835487_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_058901984.1|2835490_2837467_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.0	1.5e-10
WP_006486165.1|2837504_2838020_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_058901985.1|2838067_2840323_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_006482646.1|2840356_2840734_-	response regulator	NA	NA	NA	NA	NA
WP_058901986.1|2840758_2841778_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_006482649.1|2841791_2842652_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_006493184.1|2842832_2843387_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_006477348.1|2843479_2843833_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_006489318.1|2844464_2845529_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_006489320.1|2845632_2845929_-	H-NS histone family protein	NA	F8TUP5	EBPR_podovirus	41.1	1.9e-10
WP_006489324.1|2846228_2846972_+	aquaporin Z	NA	A0A1B1ISL4	uncultured_Mediterranean_phage	50.8	8.1e-05
WP_112750434.1|2847089_2848453_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	54.0	2.7e-78
WP_006489316.1|2848563_2849388_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_034201116.1|2850548_2851151_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_058902303.1|2851235_2852471_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_058901987.1|2852700_2854824_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_006401410.1|2854990_2855203_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_058901988.1|2855733_2856888_+	flagellin	NA	NA	NA	NA	NA
WP_058901989.1|2857020_2858529_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_006484091.1|2858554_2858854_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_058901990.1|2859111_2861454_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_058901991.1|2861478_2862627_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A9YVU0	Ostreococcus_tauri_virus	24.9	7.3e-13
WP_058901992.1|2864510_2864924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058901993.1|2865031_2865784_-	WbqC family protein	NA	NA	NA	NA	NA
WP_058901994.1|2865850_2867770_-	glycosyltransferase family protein	NA	NA	NA	NA	NA
WP_058901995.1|2868009_2869629_-	TIGR04222 domain-containing membrane protein	NA	NA	NA	NA	NA
2869763:2869793	attL	GGGATCGAACCAGCAACCCCTGCCTTCGGAG	NA	NA	NA	NA
WP_006484103.1|2870190_2870397_+|tail	tail protein	tail	E5E3W5	Burkholderia_phage	64.7	5.1e-18
WP_006484093.1|2870413_2870758_+	membrane protein	NA	A4JWU2	Burkholderia_virus	77.9	5.7e-38
WP_006484102.1|2870759_2871026_+|holin	phage holin family protein	holin	E5E3W3	Burkholderia_phage	65.5	6.2e-24
WP_063822421.1|2871022_2871880_+	DUF3380 domain-containing protein	NA	A4JWZ0	Burkholderia_virus	65.8	2.9e-91
WP_154641491.1|2871804_2872380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058901998.1|2872433_2872883_+|tail	phage tail protein	tail	E5E3V9	Burkholderia_phage	54.2	1.5e-30
WP_058901999.1|2873397_2874084_+|plate	phage baseplate assembly protein V	plate	K4NXJ5	Burkholderia_phage	68.7	1.3e-81
WP_034201129.1|2874080_2874443_+|plate	baseplate assembly protein	plate	K4PAX6	Burkholderia_phage	69.2	3.4e-41
WP_006484106.1|2874439_2875354_+|plate	baseplate assembly protein	plate	E5FFH3	Burkholderia_phage	72.6	1.5e-117
WP_006484097.1|2875346_2875889_+|tail	phage tail protein I	tail	E5FFH2	Burkholderia_phage	70.9	5.2e-70
WP_058902000.1|2875895_2878223_+|tail	phage tail protein	tail	E5E3V2	Burkholderia_phage	61.2	2.0e-259
WP_006491896.1|2878238_2878964_+|tail	caudovirales tail fiber assembly protein	tail	E5E3V1	Burkholderia_phage	84.2	1.8e-89
WP_058902001.1|2879018_2880191_+|tail	phage tail sheath protein	tail	A4JWS7	Burkholderia_virus	81.5	8.7e-187
WP_077175722.1|2880225_2880729_+|tail	phage major tail tube protein	tail	E5E3U9	Burkholderia_phage	74.3	2.2e-70
WP_006484110.1|2880805_2881177_+|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	65.5	2.2e-27
WP_006484104.1|2881185_2881299_+|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	85.7	1.1e-09
WP_058902002.1|2881314_2883885_+	hypothetical protein	NA	E5E3U6	Burkholderia_phage	46.7	1.7e-134
WP_034201134.1|2883907_2884339_+|tail	phage tail protein	tail	K4NXK5	Burkholderia_phage	67.4	8.2e-42
WP_006485451.1|2884335_2885406_+	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	70.6	1.1e-135
WP_006485449.1|2885593_2885890_-	hypothetical protein	NA	E5E3U3	Burkholderia_phage	50.5	1.6e-12
WP_077175721.1|2886207_2886663_-	helix-turn-helix transcriptional regulator	NA	E5E3U2	Burkholderia_phage	62.9	3.2e-44
WP_006485450.1|2886789_2887005_+	hypothetical protein	NA	E5E3U1	Burkholderia_phage	80.0	4.4e-20
WP_006485448.1|2887186_2887435_+	ogr/Delta-like zinc finger family protein	NA	K4PAZ0	Burkholderia_phage	91.5	3.5e-37
WP_034201136.1|2887562_2887820_+	hypothetical protein	NA	A4JWQ9	Burkholderia_virus	56.0	2.1e-13
WP_034201137.1|2887825_2890618_+	hypothetical protein	NA	E5E3N5	Burkholderia_phage	91.0	0.0e+00
WP_077021587.1|2890614_2890986_+	hypothetical protein	NA	A0A089FGR9	Burkholderia_phage	50.6	6.6e-08
WP_059721111.1|2891037_2891310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006484045.1|2891312_2892389_+|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	81.7	7.2e-164
2892458:2892488	attR	GGGATCGAACCAGCAACCCCTGCCTTCGGAG	NA	NA	NA	NA
>prophage 5
NZ_CP011917	Burkholderia cenocepacia strain ST32 chromosome 1, complete sequence	3822749	3040313	3099623	3822749	transposase	Paenibacillus_phage(28.57%)	45	NA	NA
WP_095423477.1|3040313_3041131_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.9	1.9e-07
WP_006495415.1|3041543_3042425_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_058902046.1|3042527_3043043_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_058902047.1|3044016_3044277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058902048.1|3044308_3044638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006487296.1|3044656_3044902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058902049.1|3045097_3045415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095423477.1|3045921_3046738_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.9	1.9e-07
WP_006495421.1|3046919_3047678_-	anti-sigma factor	NA	NA	NA	NA	NA
WP_058902050.1|3047674_3048196_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_058902051.1|3048354_3049443_+	catalase family peroxidase	NA	NA	NA	NA	NA
WP_058902052.1|3049439_3049973_+	cytochrome b	NA	NA	NA	NA	NA
WP_154641492.1|3052237_3052399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105773736.1|3055455_3056634_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.7	1.2e-42
WP_058902053.1|3057106_3057370_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_139349397.1|3057522_3057987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058902055.1|3057983_3063941_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_077021643.1|3064425_3064671_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_143258264.1|3064868_3065648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077175760.1|3065611_3066292_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_058902056.1|3067683_3069522_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	28.0	1.1e-34
WP_077021594.1|3069518_3070895_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_058902058.1|3070891_3071824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105848468.1|3074995_3075397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105848424.1|3075448_3076610_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.2	9.5e-85
WP_006492556.1|3076782_3078051_+|transposase	IS256-like element ISBcen18 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	26.8	2.5e-30
WP_077188661.1|3078031_3078382_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_058902060.1|3078488_3079685_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_006476662.1|3079755_3080193_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_006476661.1|3080189_3080705_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	38.0	6.2e-20
WP_048985375.1|3080758_3081901_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	36.7	2.2e-49
WP_058902061.1|3082058_3082577_-	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_058902062.1|3082906_3083536_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	40.4	1.8e-29
WP_006484247.1|3083550_3084672_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2I2L4R9	Orpheovirus	34.3	5.2e-48
WP_058902063.1|3084687_3085971_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_006484248.1|3086152_3086605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058902064.1|3086854_3088072_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	26.6	4.2e-27
WP_006484254.1|3088176_3090105_-	bifunctional transcriptional regulator/glucokinase	NA	NA	NA	NA	NA
WP_006496597.1|3090082_3090763_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_006491174.1|3090851_3092321_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.1	3.9e-75
WP_006491170.1|3092753_3094001_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011544827.1|3094139_3095078_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_006496594.1|3095067_3095925_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_006496593.1|3096037_3097156_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.3	5.3e-24
WP_077613735.1|3098354_3099623_-|transposase	IS256-like element ISBcen18 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	26.5	3.3e-30
>prophage 6
NZ_CP011917	Burkholderia cenocepacia strain ST32 chromosome 1, complete sequence	3822749	3512994	3522045	3822749		Hokovirus(16.67%)	7	NA	NA
WP_006484920.1|3512994_3514947_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.3	2.5e-146
WP_006476837.1|3515200_3516337_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	5.0e-22
WP_058902158.1|3516340_3518263_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	37.2	5.2e-56
WP_006485002.1|3518374_3519190_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	34.2	1.8e-37
WP_006484932.1|3519233_3519920_-	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	26.4	7.2e-08
WP_006476832.1|3519916_3520459_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_006484964.1|3520494_3522045_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.3	9.5e-24
>prophage 1
NZ_CP011918	Burkholderia cenocepacia strain ST32 chromosome 2, complete sequence	3086109	27356	63988	3086109	transposase,protease	Wolbachia_phage(33.33%)	36	NA	NA
WP_006494258.1|27356_28082_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_058902332.1|28078_28945_-	DUF2167 domain-containing protein	NA	NA	NA	NA	NA
WP_058902333.1|29141_29990_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_034203259.1|30022_30649_-	LysE family translocator	NA	NA	NA	NA	NA
WP_006494255.1|30817_31282_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_058902334.1|31278_32649_-	dihydroorotase	NA	NA	NA	NA	NA
WP_006491343.1|32652_33213_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_058902335.1|33212_33791_-	6-carboxytetrahydropterin synthase	NA	NA	NA	NA	NA
WP_006491344.1|33784_34705_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_048985318.1|34765_36037_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_105848287.1|36140_37325_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_058902337.1|37348_38191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006491339.1|38242_38899_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012493575.1|38891_40076_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.7	2.3e-30
WP_006493142.1|40094_41507_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_058902338.1|41517_42348_-	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006481998.1|42782_44147_+	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_006494245.1|44267_46172_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_058902339.1|46161_47523_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_006484473.1|47548_47878_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_006484487.1|48116_48968_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_006484477.1|49079_49520_-	PACE efflux transporter	NA	NA	NA	NA	NA
WP_058902288.1|49631_50576_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	32.7	1.5e-24
WP_058902340.1|50798_51689_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058902341.1|51753_52182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058902342.1|52309_52906_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058902343.1|52996_53410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058902344.1|53674_54133_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_105773736.1|54084_55263_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.7	1.2e-42
WP_058902345.1|55613_55937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143272477.1|55933_56533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058902346.1|56507_57512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105848424.1|58233_59395_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.2	9.5e-85
WP_095423477.1|61479_62297_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.9	1.9e-07
WP_154641174.1|62584_62749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006476181.1|63022_63988_+|transposase	IS110-like element ISBcen8 family transposase	transposase	Q75QL1	Wolbachia_phage	34.2	1.3e-23
>prophage 1
NZ_CP011919	Burkholderia cenocepacia strain ST32 chromosome 3, complete sequence	989585	935121	983927	989585	transposase	Mycobacterium_phage(20.0%)	36	NA	NA
WP_006482428.1|935121_936147_+|transposase	IS110-like element ISBcen4 family transposase	transposase	NA	NA	NA	NA
WP_058903937.1|938786_939362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058903938.1|939654_941121_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058903939.1|941299_942781_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	32.1	1.1e-32
WP_006483275.1|942831_943428_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058903940.1|943559_945032_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_034178445.1|945142_945634_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_034203509.1|945719_947120_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_006498158.1|947280_948207_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_058903941.1|948219_949080_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_034203511.1|949484_950153_+	haloacid dehalogenase type II	NA	NA	NA	NA	NA
WP_006482802.1|950592_952176_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006482806.1|952255_953209_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_058903942.1|953239_954199_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_058903943.1|954198_956067_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.1	4.8e-14
WP_077175825.1|956206_957541_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_034203514.1|957564_957996_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058903944.1|958115_958850_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_058903945.1|958852_960178_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_006498168.1|960271_961741_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_058903946.1|961810_962998_+	amidohydrolase	NA	NA	NA	NA	NA
WP_006498170.1|963103_964624_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_006481900.1|964949_966245_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.7	8.1e-61
WP_006481888.1|966303_967086_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_058903947.1|967110_968439_-	C4-dicarboxylate transporter DctA	NA	NA	NA	NA	NA
WP_058903948.1|968473_969397_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006481878.1|969552_969744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058903949.1|970303_972448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058903950.1|972481_973717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006498175.1|973823_974837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006481895.1|975016_975331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058902288.1|975549_976494_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	32.7	1.5e-24
WP_058903124.1|976798_977809_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_058903124.1|979913_980924_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_058903951.1|981084_982623_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	38.0	1.0e-49
WP_058903124.1|982916_983927_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP011920	Burkholderia cenocepacia strain ST32 plasmid pBCEN1232, complete sequence	191945	962	69965	191945	transposase,integrase,plate	Acinetobacter_phage(11.76%)	60	58831:58846	77655:77670
WP_143272455.1|962_2161_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	3.0e-49
WP_058903124.1|3129_4140_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_058903992.1|4509_7446_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	21.8	2.3e-50
WP_058903993.1|7646_7949_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_058903994.1|8176_9613_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_058904124.1|9617_11729_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.2	6.0e-61
WP_058903995.1|11862_13740_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_058903996.1|13740_14313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058903997.1|14333_14711_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_088925042.1|15162_16397_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.5	1.1e-102
WP_058903998.1|16487_17318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058903999.1|17585_18005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058904000.1|18011_19031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063812477.1|19210_20011_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_058904001.1|20018_20267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058904002.1|20434_21379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058904003.1|21474_23325_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_058904126.1|23328_23757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058904004.1|24021_24357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058904005.1|24367_24613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077175733.1|24599_24998_-	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	47.5	5.1e-22
WP_058904007.1|25003_26089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058904008.1|26116_26458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058904009.1|26743_27253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058904010.1|27276_27483_-	hypothetical protein	NA	B5UAR3	Ralstonia_phage	66.7	2.5e-17
WP_058904011.1|27509_28208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058904012.1|28393_28723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058904013.1|28870_29218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058904014.1|29529_29940_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_058904127.1|29936_30179_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_058904015.1|30296_31328_-	DNA polymerase	NA	A0A068CDF3	Rhizobium_phage	36.7	5.9e-54
WP_058904016.1|31783_32455_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	31.2	2.9e-17
WP_058904017.1|32454_33420_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_058904018.1|34164_35022_+	TrfA family protein	NA	NA	NA	NA	NA
WP_105773736.1|35773_36952_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.7	1.2e-42
WP_058904019.1|37386_40536_-	error-prone DNA polymerase	NA	A0A291AVS4	Streptomyces_phage	27.7	2.7e-94
WP_143272455.1|41144_42342_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	3.0e-49
WP_058904020.1|43225_43942_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_058904021.1|44015_44927_-	DUF159 family protein	NA	NA	NA	NA	NA
WP_058904022.1|45161_48146_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	27.1	5.6e-81
WP_058904128.1|49630_49894_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058904024.1|50153_50711_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	58.8	2.1e-53
WP_058904025.1|50750_51566_+	creatininase	NA	NA	NA	NA	NA
WP_058904026.1|51627_52800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143272456.1|52865_53108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058904027.1|53287_54709_-	heavy metal sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.1	1.0e-16
WP_058904028.1|54705_55377_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.2	6.6e-30
WP_058904030.1|56206_56506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058904031.1|56502_58008_+	TolC family protein	NA	NA	NA	NA	NA
WP_058904032.1|58009_59305_+	copper oxidase	NA	NA	NA	NA	NA
58831:58846	attL	CGCGGGCACCGACGGC	NA	NA	NA	NA
WP_058904033.1|59368_59716_+	copper-binding protein	NA	NA	NA	NA	NA
WP_143272461.1|59782_60154_+	copper homeostasis periplasmic binding protein CopC	NA	NA	NA	NA	NA
WP_058904035.1|60153_61095_+	copper resistance protein CopD	NA	NA	NA	NA	NA
WP_077021550.1|61364_61697_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_058904036.1|62412_63927_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_077021551.1|63999_66294_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.1	1.3e-88
WP_058904037.1|66692_66890_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_058904038.1|66921_67353_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_143272457.1|68053_68275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154641512.1|68267_69965_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VH72	Gordonia_phage	24.9	1.4e-07
77655:77670	attR	GCCGTCGGTGCCCGCG	NA	NA	NA	NA
