The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013142	Streptomyces sp. 4F, complete genome	8047771	220505	268169	8047771	integrase,transposase	Paenibacillus_phage(75.0%)	35	220943:221002	266088:266588
WP_107115286.1|220505_221386_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	40.9	3.8e-17
220943:221002	attL	CTAGGTGGATCTTGCAGGTCAGGCCGCCCCGGGACCGTCCGAGTCCCTCGTCGGGGCGGT	NA	NA	NA	NA
WP_058915227.1|225948_226221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058915228.1|226509_226722_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_058917765.1|227026_228538_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058915229.1|229322_229679_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079031362.1|229662_232293_+	magnesium-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	25.0	9.8e-29
WP_058915231.1|232493_232919_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_058917766.1|233385_234666_-	MFS transporter	NA	NA	NA	NA	NA
WP_107115287.1|234954_237126_-	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
WP_058915232.1|237122_237452_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_030587617.1|237448_238561_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_107115436.1|239256_239838_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058915236.1|241558_243727_+	FUSC family protein	NA	NA	NA	NA	NA
WP_058915237.1|246051_246933_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_107115288.1|247018_247899_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	38.6	4.1e-16
WP_058915238.1|248006_248807_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_079031364.1|249045_249807_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_058915240.1|250022_250250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058915241.1|250321_251263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107115437.1|251347_251911_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079031365.1|252181_253105_+	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_058915243.1|253207_254011_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_058915244.1|254304_255252_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079031366.1|255262_256291_-	DMT family transporter	NA	NA	NA	NA	NA
WP_058915245.1|256387_256864_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_058915246.1|256986_258441_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_058915247.1|258692_260657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079031367.1|260989_261331_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_079031613.1|261327_262563_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_058915249.1|263004_263316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058915250.1|263406_264288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058915251.1|264422_264698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107115438.1|264781_264988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107115289.1|265227_266071_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	43.6	1.5e-15
WP_058915252.1|267077_268169_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
266088:266588	attR	CTAGGTGGATCTTGCAGGTCAGGCCGCCCCGGGACCGTCCGAGTCCCTCGTCGGGGCGGTGGTGCCGAGGCGTCGTCCTTTTTTCGGGACCCGCGGCCGGGTCTTGCGGGCGCCGGCCGCGTGCTGATGGGCCCGGCAGGACGTCGAGTCGACGCCGATCATCGACCAGTCGATCCGCCCTGCGAGGTCGGCGTCGGCCTGGACCGACTGCAGGATCCGGTCCCAGGTTCCGTCCGCAGACCAGCGGCGGTGCCGTTCGTAGACGGTCTTCCACGAGCCATAGCGTTCCGGCAGATCACGCCAAGGGACACCGGTCCGGATCCGGAACAGGATCCCGTTGACCACCGTGCGGTGGTCGTTCCACCGGCCGCCCCGGCCACCCGCAGGCGGCAGATGTGGCTCCAACAGCGACCACTCGCGATTCGTCAGATCCCCCCGACCCATGACCGAACCAACGAGCGACCAGTCAGAAGGTCACATGATCCGCCGGACACAACCTAG	NA	NA	NA	NA
>prophage 2
NZ_CP013142	Streptomyces sp. 4F, complete genome	8047771	2827515	2892902	8047771	protease,holin,transposase,tRNA	Agrobacterium_phage(18.18%)	50	NA	NA
WP_058916122.1|2827515_2828268_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_107115340.1|2828350_2832706_-	ribonuclease E/G	NA	NA	NA	NA	NA
WP_058916123.1|2832967_2833756_-	DUF2344 domain-containing protein	NA	NA	NA	NA	NA
WP_079031452.1|2833946_2834900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058916125.1|2836226_2837015_+	DUF2637 domain-containing protein	NA	NA	NA	NA	NA
WP_079031453.1|2837111_2837297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058917881.1|2837974_2839594_+	serine recombinase	NA	A0A0K1YA06	Streptomyces_phage	65.8	3.1e-203
WP_107115341.1|2839617_2840163_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	43.1	7.7e-21
WP_058916126.1|2840386_2842351_-	TIGR03960 family B12-binding radical SAM protein	NA	NA	NA	NA	NA
WP_037639484.1|2842455_2844033_-	CYTH and CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_033276880.1|2844104_2845307_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_058916127.1|2845303_2847634_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_033276878.1|2847748_2848417_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_033276877.1|2848430_2849372_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_033276876.1|2849539_2850559_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_033276875.1|2850996_2851410_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	45.5	2.7e-26
WP_058916128.1|2851474_2851825_-	DUF4233 domain-containing protein	NA	NA	NA	NA	NA
WP_033276873.1|2851831_2853352_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_058916129.1|2853406_2854459_-	acyltransferase	NA	NA	NA	NA	NA
WP_058916130.1|2854602_2857227_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.9	9.8e-146
WP_058916131.1|2857363_2858353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058916132.1|2858390_2859347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019527658.1|2859415_2860702_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.8	2.6e-144
WP_033276868.1|2860884_2861592_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	46.9	1.5e-40
WP_033276867.1|2861701_2862361_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	47.7	8.7e-43
WP_106963267.1|2862712_2864206_-	trigger factor	NA	NA	NA	NA	NA
WP_058917882.1|2864650_2865073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024887528.1|2865307_2865502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106963268.1|2866177_2867320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033276864.1|2867316_2867751_-	HD domain-containing protein	NA	A0A0M3LQS1	Mannheimia_phage	41.0	2.6e-11
WP_058916134.1|2867792_2868971_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_058916135.1|2869136_2870387_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_033276861.1|2870400_2871222_-	Fpg/Nei family DNA glycosylase	NA	NA	NA	NA	NA
WP_033276860.1|2871259_2871745_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_033276859.1|2871950_2873420_+	amino acid permease	NA	NA	NA	NA	NA
WP_033276858.1|2873499_2874084_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_033276857.1|2874551_2875751_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_033276856.1|2875973_2877038_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033276855.1|2877034_2877904_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_058916136.1|2877879_2878599_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	25.8	6.2e-10
WP_058916137.1|2878665_2880027_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_058916138.1|2880053_2880965_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_033276851.1|2881105_2882485_+	amino acid permease	NA	NA	NA	NA	NA
WP_037639517.1|2882568_2882811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033276850.1|2882817_2883465_-	DSBA oxidoreductase	NA	NA	NA	NA	NA
WP_033276849.1|2883602_2886179_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	33.1	2.6e-50
WP_107115342.1|2886355_2887477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058917883.1|2887550_2888696_-	peptidase	NA	A0A1D8EXR7	Mycobacterium_phage	29.1	1.2e-23
WP_033276847.1|2888830_2889271_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_058916140.1|2889584_2892902_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP013142	Streptomyces sp. 4F, complete genome	8047771	3556995	3583018	8047771	plate,integrase,tail	Bacillus_phage(20.0%)	24	3544134:3544149	3590828:3590843
3544134:3544149	attL	CCGCGACCAGGACGGT	NA	NA	NA	NA
WP_033274778.1|3556995_3558588_+|tail	tail protein	tail	J9PVC2	Bacillus_phage	33.5	2.8e-63
WP_033274777.1|3558649_3559093_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_058916373.1|3559092_3559581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058916374.1|3559822_3560341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078492931.1|3561087_3561276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058916375.1|3561487_3562057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024886434.1|3563105_3563531_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_033276666.1|3563586_3564321_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_058916376.1|3564324_3566232_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_033276664.1|3566231_3566690_+|plate	baseplate protein	plate	E3SKD2	Synechococcus_phage	32.6	6.1e-11
WP_058916377.1|3566689_3568648_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_079031474.1|3569639_3571478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058916378.1|3571530_3572547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058916379.1|3572612_3572981_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_037640760.1|3573114_3574020_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_058916380.1|3574170_3575604_+	recombinase family protein	NA	A0A1B1PA72	Streptomyces_phage	32.9	1.1e-53
WP_058916381.1|3576268_3576469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079031475.1|3576560_3577070_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_033276656.1|3577066_3577642_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	72.5	8.5e-79
WP_033276655.1|3577738_3577960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079031476.1|3578467_3579088_+	DUF1707 domain-containing protein	NA	NA	NA	NA	NA
WP_030401436.1|3579131_3579590_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_058916382.1|3579607_3581674_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_058916383.1|3581872_3583018_-|integrase	site-specific integrase	integrase	A0A097BXY4	Mycobacterium_phage	34.3	2.9e-46
3590828:3590843	attR	CCGCGACCAGGACGGT	NA	NA	NA	NA
>prophage 4
NZ_CP013142	Streptomyces sp. 4F, complete genome	8047771	6247579	6254232	8047771		Bacillus_phage(66.67%)	6	NA	NA
WP_058917189.1|6247579_6248344_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.8	6.1e-32
WP_058917190.1|6248348_6249458_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.3	7.8e-20
WP_033273994.1|6249598_6250588_-	NAD-dependent epimerase/dehydratase family protein	NA	Q58M85	Prochlorococcus_phage	30.1	1.4e-23
WP_058917999.1|6250640_6252053_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.9	1.8e-21
WP_033273993.1|6252091_6252781_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.2	3.2e-32
WP_033273992.1|6253074_6254232_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	42.2	9.6e-13
>prophage 5
NZ_CP013142	Streptomyces sp. 4F, complete genome	8047771	7768019	7800752	8047771	integrase,tail,transposase	Paenibacillus_phage(50.0%)	32	7761161:7761178	7803008:7803025
7761161:7761178	attL	GCCCTGCGGCGGGTGCGG	NA	NA	NA	NA
WP_107115291.1|7768019_7769200_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	32.8	2.6e-29
WP_058915260.1|7769294_7769561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079031369.1|7769640_7770297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107115440.1|7770521_7770881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107115439.1|7771870_7772284_+|tail	lamin tail domain-containing protein	tail	NA	NA	NA	NA
WP_058915257.1|7772679_7772976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058917769.1|7772972_7773704_-	HNH endonuclease	NA	A0A1S6L216	Vibrio_phage	37.7	2.2e-18
WP_058915256.1|7776088_7776313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058915255.1|7776909_7777224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107115290.1|7777331_7778549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058915253.1|7779408_7779606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058915252.1|7779602_7780694_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107115289.1|7781699_7782544_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	43.6	1.5e-15
WP_107115438.1|7782783_7782990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058917747.1|7783073_7783319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058915250.1|7783483_7784365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058915249.1|7784455_7784767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079031613.1|7785208_7786444_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_079031367.1|7786440_7786782_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_058915247.1|7787114_7789079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058915246.1|7789330_7790785_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_058915245.1|7790907_7791384_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_079031366.1|7791480_7792509_+	DMT family transporter	NA	NA	NA	NA	NA
WP_058915244.1|7792519_7793467_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058915243.1|7793760_7794564_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_079031365.1|7794666_7795590_-	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_107115437.1|7795860_7796424_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058915241.1|7796508_7797450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058915240.1|7797521_7797749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079031364.1|7797964_7798726_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_058915238.1|7798964_7799765_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_107115288.1|7799872_7800752_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	38.6	4.1e-16
7803008:7803025	attR	CCGCACCCGCCGCAGGGC	NA	NA	NA	NA
