bac_id	bac_def	spacer_id	hit_contig_id	hit_contig_def	identity	alignment_length	mismatch	gapopen	query_start	query_end	hit_start	hit_end	crispr_array_of_hit_genome	evalue	bitscore	coverage	spacer_sequence	hit_contig_region	hit_contig_sequence	hmm_mismatch
NZ_CP008697	Escherichia coli strain ST648 isolate Pleural Effusion of Patients with Empyema Thoracis chromosome, complete genome	3.7|3816089|32|NZ_CP008697|CRISPRCasFinder,CRT	NZ_CP008697.1	Escherichia coli strain ST648 isolate Pleural Effusion of Patients with Empyema Thoracis chromosome, complete genome	96.88	32	1	0	1	32	3836777	3836746	1755007-1755154|3789324-3790147|3815693-3816944|4959142-4959247	4e-08	49.1	1.0	GGATGAGCAGGGAGCAACAAAAGTAGCCGGAA	3836746-3836777	TTCCAGCTACTTTTGTTGCTCCCTGCTCATCC	1
NZ_CP008697	Escherichia coli strain ST648 isolate Pleural Effusion of Patients with Empyema Thoracis chromosome, complete genome	3.27|3816089|33|NZ_CP008697|PILER-CR	NZ_CP008697.1	Escherichia coli strain ST648 isolate Pleural Effusion of Patients with Empyema Thoracis chromosome, complete genome	96.97	33	1	0	1	33	3836777	3836745	1755007-1755154|3789324-3790147|3815693-3816944|4959142-4959247	2e-08	50.7	1.0	GGATGAGCAGGGAGCAACAAAAGTAGCCGGAAT	3836745-3836777	ATTCCAGCTACTTTTGTTGCTCCCTGCTCATCC	1
