The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013831	Escherichia coli strain CD306 chromosome, complete genome	5073822	484063	577825	5073822	transposase,plate,holin,tail,protease,capsid,integrase	Burkholderia_virus(31.48%)	101	527891:527929	584750:584788
WP_000130299.1|484063_485338_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	1.9e-131
WP_001295325.1|485525_487880_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|488088_488361_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_000969359.1|488552_490424_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_000680295.1|490574_490946_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001194552.1|491075_491474_+	long-chain acyl-CoA thioesterase FadM	NA	NA	NA	NA	NA
WP_000817227.1|491525_492221_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
WP_001238258.1|492285_493986_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000113027.1|494085_494904_+	HMP-PP phosphatase	NA	NA	NA	NA	NA
WP_000884589.1|495056_495515_+	DNA-binding transcriptional regulator DecR	NA	NA	NA	NA	NA
WP_001235630.1|495544_497317_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	2.3e-50
WP_001256214.1|497309_499091_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	3.4e-41
WP_000685051.1|499638_500925_+	ammonium transporter AmtB	NA	NA	NA	NA	NA
WP_001295832.1|500973_501834_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_000779831.1|502051_502624_+	YbaY family lipoprotein	NA	NA	NA	NA	NA
WP_000409908.1|502654_502966_-	MGMT family protein	NA	NA	NA	NA	NA
WP_000878135.1|503344_503698_+	DUF1428 family protein	NA	NA	NA	NA	NA
WP_001385227.1|503739_505290_-	cyclic-guanylate-specific phosphodiesterase PdeB	NA	NA	NA	NA	NA
WP_000136192.1|505453_505924_-	YlaC family protein	NA	NA	NA	NA	NA
WP_000102539.1|506039_506591_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_001291435.1|506764_506983_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000344800.1|507008_507383_-	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_001132478.1|507928_511078_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.7e-54
WP_001295833.1|511100_512294_-	multidrug efflux RND transporter periplasmic adaptor subunit AcrA	NA	NA	NA	NA	NA
WP_000101737.1|512435_513083_+	multidrug efflux transporter transcriptional repressor AcrR	NA	NA	NA	NA	NA
WP_000177739.1|513210_516573_+	mechanosensitive channel MscK	NA	NA	NA	NA	NA
WP_000051144.1|516611_516776_-	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_000844862.1|516789_517317_-	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_001188900.1|517386_517764_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_000127356.1|517916_518468_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122044.1|518596_520528_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	3.9e-43
WP_000467098.1|520580_520910_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|520909_521515_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678189.1|521624_523499_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.8	1.0e-117
WP_001220233.1|523679_524324_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250114.1|524455_525418_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801794.1|525414_526374_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	25.0	2.9e-15
WP_000671574.1|526525_527830_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
527891:527929	attL	ATGCCTGATGCGACGCTGGCGCGTCTTATCAGGCCTACA	NA	NA	NA	NA
WP_000546254.1|527959_529636_-	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_001251634.1|529874_531095_-	fosmidomycin MFS transporter	NA	NA	NA	NA	NA
WP_000771748.1|531312_532965_+	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000667000.1|533002_533506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000439798.1|533502_534303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000904922.1|535826_536399_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_024189672.1|536500_536974_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	45.4	2.1e-30
WP_059217998.1|537014_537497_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	44.0	1.1e-26
WP_001529037.1|537496_538111_+|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
WP_077872211.1|538117_540310_-|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	42.9	1.9e-38
WP_000138756.1|540312_540891_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001529034.1|540883_541987_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	55.0	1.4e-106
WP_000859116.1|541977_542325_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	61.5	1.7e-34
WP_000148265.1|542379_542976_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	5.4e-36
WP_001529032.1|542972_544145_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.1	7.3e-85
WP_000478224.1|544132_544345_-|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|544344_545229_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_059217999.1|545228_548441_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.3	7.6e-84
WP_001202894.1|548516_548675_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|548598_548934_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|549031_549313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162832341.1|549315_549840_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	66.7	1.1e-67
WP_000729834.1|549836_551264_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_000666499.1|551253_551505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|551504_551969_-	Gp37 family protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|551968_552415_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_059218000.1|552416_552755_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|552764_553718_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001511580.1|553732_554848_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	7.2e-98
WP_000135514.1|555062_555521_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117556.1|555523_556345_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.5	3.1e-98
WP_059218001.1|556325_557822_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.4	4.4e-167
WP_000137893.1|557821_559345_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.5	1.8e-184
WP_000533684.1|559341_559884_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	53.3	4.9e-44
WP_000227704.1|559886_560198_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	60.6	4.0e-30
WP_000175097.1|560197_560524_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_001299256.1|560520_561132_-	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	34.2	6.9e-10
WP_001104438.1|561160_561898_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.5	2.9e-63
WP_000793145.1|561900_562251_-|holin	putative holin	holin	A4JWP3	Burkholderia_virus	53.9	9.0e-23
WP_000194949.1|562381_563125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001573938.1|563100_563502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069609.1|563503_563719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001573937.1|563910_564675_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	4.0e-100
WP_000579778.1|564791_565130_-	helix-turn-helix domain-containing protein	NA	F6MII3	Haemophilus_phage	34.4	4.8e-05
WP_000123378.1|565230_565419_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047758.1|565471_565780_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	3.5e-23
WP_000533819.1|565790_566702_+	hypothetical protein	NA	A4JWN3	Burkholderia_virus	55.3	2.0e-74
WP_059218002.1|566705_568475_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.3	6.2e-229
WP_059218003.1|568485_569652_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	1.3e-121
WP_000843446.1|569654_569924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001381528.1|569951_570482_+	host-nuclease inhibitor Gam family protein	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_042203510.1|570770_571043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000197789.1|571052_571358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000131939.1|571354_572038_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.9	4.5e-34
WP_000631814.1|572034_572265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123379.1|572254_572470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001573929.1|572462_572912_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	1.6e-24
WP_001281696.1|572883_573282_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	55.9	3.9e-30
WP_001571573.1|573396_574029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001571575.1|574032_574194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000057523.1|574583_574886_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	80.0	1.3e-41
WP_000806442.1|574921_575263_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000083947.1|575320_577825_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	1.0e-115
584750:584788	attR	ATGCCTGATGCGACGCTGGCGCGTCTTATCAGGCCTACA	NA	NA	NA	NA
>prophage 2
NZ_CP013831	Escherichia coli strain CD306 chromosome, complete genome	5073822	968050	1037643	5073822	terminase,tRNA,portal,plate,holin,head,tail,protease,capsid,integrase	Enterobacteria_phage(65.57%)	76	977557:977572	1036121:1036136
WP_000520781.1|968050_968371_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|968401_970678_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|971361_971580_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241674.1|971864_972569_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202204.1|972610_974332_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.0	1.4e-20
WP_001043561.1|974332_976099_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001385255.1|976221_977187_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
977557:977572	attL	ACGCCATTCGTGATGT	NA	NA	NA	NA
WP_000228473.1|977730_978225_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077041.1|978359_982466_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|982624_983236_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|983246_984590_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|984680_985973_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000078916.1|986278_986419_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488106.1|986610_986871_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132830.1|986911_988021_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005447.1|988178_989363_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000290462.1|989362_989875_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651577.1|989930_990305_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000333503.1|990313_990469_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000853410.1|990455_993263_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
WP_000979945.1|993275_993764_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905061.1|993792_994392_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_021538277.1|996393_998379_-|tail	tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	86.0	3.2e-173
WP_000071703.1|998381_998912_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_001111954.1|998904_999801_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_001067543.1|999804_1000134_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	99.1	8.4e-55
WP_001295912.1|1000151_1000718_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	6.6e-100
WP_000356366.1|1000729_1001365_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_000921127.1|1001357_1001825_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000202148.1|1001848_1003726_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
WP_000780577.1|1003864_1004260_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000072341.1|1004256_1004649_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_001342221.1|1004645_1004969_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864904.1|1004916_1005171_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	1.3e-31
WP_000063100.1|1005170_1005665_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000632309.1|1005766_1006567_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_001055083.1|1006612_1007665_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_001262655.1|1007688_1008525_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_000613780.1|1008679_1010431_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087814.1|1010430_1011477_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000236495.1|1011491_1012016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|1012739_1013237_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000193205.1|1013276_1014119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211282.1|1014202_1014517_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000686485.1|1014521_1015481_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_000123489.1|1015557_1018380_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
WP_000599382.1|1018386_1018752_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_023142408.1|1018748_1019366_-	ash family protein	NA	S5MQL6	Escherichia_phage	42.0	1.5e-09
WP_000104290.1|1019377_1019677_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_000153700.1|1019673_1019940_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|1019936_1020140_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543036.1|1020163_1020574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021715.1|1020667_1020781_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000514277.1|1020777_1021020_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159455.1|1021031_1021310_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000776267.1|1021320_1021671_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_001287828.1|1021808_1022000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856387.1|1022006_1022429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204236.1|1022433_1022955_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001368591.1|1023059_1023401_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_000850306.1|1024761_1027206_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|1027216_1027834_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534666.1|1027835_1028699_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000165876.1|1028734_1029361_-	hydrolase	NA	NA	NA	NA	NA
WP_000109283.1|1029674_1030823_+	MFS transporter	NA	NA	NA	NA	NA
WP_000067979.1|1030919_1031717_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000023390.1|1031748_1032744_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
WP_000072552.1|1032837_1033149_-	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_001576635.1|1033253_1033610_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	98.3	2.0e-62
WP_164907187.1|1033620_1033791_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.2	1.3e-24
WP_000217677.1|1033787_1034288_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001576637.1|1034351_1034576_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	5.2e-32
WP_001576638.1|1034575_1034878_+	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	96.0	1.6e-44
WP_001576640.1|1034877_1035102_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	97.3	1.5e-34
WP_001576641.1|1035098_1035374_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	98.9	1.9e-44
WP_001576643.1|1035363_1037643_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.9	0.0e+00
1036121:1036136	attR	ACGCCATTCGTGATGT	NA	NA	NA	NA
>prophage 3
NZ_CP013831	Escherichia coli strain CD306 chromosome, complete genome	5073822	1040959	1114027	5073822	terminase,transposase,portal,lysis,plate,holin,head,tail,capsid,integrase	Burkholderia_virus(26.09%)	91	1047477:1047493	1110007:1110023
WP_001576649.1|1040959_1041379_+	hypothetical protein	NA	Q6K1E9	Salmonella_virus	76.3	5.7e-56
WP_001576650.1|1041704_1042739_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	98.8	7.9e-200
WP_000156861.1|1042738_1044511_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085955.1|1044684_1045539_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MH0	Enterobacteria_phage	98.2	5.2e-133
WP_001576652.1|1045597_1046671_+|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	98.9	2.2e-200
WP_001576654.1|1046674_1047418_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.8	1.6e-125
1047477:1047493	attL	CACTGCACCGGCGTCCA	NA	NA	NA	NA
WP_000988633.1|1047517_1048027_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|1048026_1048230_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123124.1|1048233_1048515_+|holin	phage holin family protein	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001576656.1|1048514_1049012_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	3.4e-92
WP_001576658.1|1049026_1049452_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	96.5	1.0e-57
WP_001576659.1|1049439_1049865_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	93.6	1.5e-64
WP_000917151.1|1049972_1050440_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	100.0	6.1e-83
WP_001001786.1|1050432_1050885_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_001576664.1|1050951_1051587_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	1.2e-113
WP_000127163.1|1051583_1051931_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121498.1|1051935_1052844_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	1.7e-161
WP_001576666.1|1052836_1053367_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	99.4	2.3e-102
WP_001576667.1|1053377_1056002_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	95.7	0.0e+00
WP_001298859.1|1056261_1057803_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|1057817_1058564_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001576671.1|1059617_1059995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001576672.1|1060435_1060912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001576673.1|1061223_1062414_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	3.1e-224
WP_001251408.1|1062426_1062945_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1063001_1063277_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|1063309_1063429_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000978911.1|1065882_1066362_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_001576679.1|1066361_1067525_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	97.4	5.9e-204
WP_000468308.1|1067606_1067825_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292822.1|1068144_1070427_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_001295917.1|1070481_1071339_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_000194832.1|1071744_1073505_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642852.1|1073634_1074327_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057158.1|1074525_1075614_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000445240.1|1075684_1076968_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000904922.1|1077223_1077796_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_063269479.1|1077855_1078380_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	48.6	1.8e-35
WP_000072165.1|1078379_1078994_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_023142129.1|1079000_1079462_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_023363137.1|1079472_1080720_-|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	43.7	2.0e-40
WP_000138756.1|1080722_1081301_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001219098.1|1081293_1082397_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000859111.1|1082387_1082735_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_000148266.1|1082789_1083386_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000808007.1|1083382_1084537_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_000478224.1|1084524_1084737_-|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|1084736_1085621_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_000016538.1|1085620_1088572_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_001202894.1|1088647_1088806_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|1088729_1089065_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|1089162_1089444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162832341.1|1089446_1089971_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	66.7	1.1e-67
WP_000729834.1|1089967_1091395_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_000666499.1|1091384_1091636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|1091635_1092100_-	Gp37 family protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|1092099_1092546_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|1092547_1092886_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|1092895_1093849_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|1093863_1094979_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135514.1|1095193_1095652_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117548.1|1095654_1096476_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000090684.1|1096456_1097953_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_169711462.1|1097952_1099494_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.3e-185
WP_000124060.1|1099544_1100090_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_000227701.1|1100089_1100401_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175099.1|1100400_1100727_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000264665.1|1100723_1101374_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_001104440.1|1101357_1102098_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000793146.1|1102100_1102451_-|holin	putative holin	holin	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_000194951.1|1102581_1103310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295927.1|1103285_1103687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069611.1|1103688_1103904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783854.1|1104094_1104859_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_000031013.1|1104975_1105332_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000123378.1|1105425_1105614_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047759.1|1105666_1105975_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000533817.1|1105985_1106906_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_001095645.1|1106905_1107223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000186588.1|1107238_1109008_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_000960679.1|1109018_1110185_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
1110007:1110023	attR	TGGACGCCGGTGCAGTG	NA	NA	NA	NA
WP_000843446.1|1110187_1110457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|1110484_1111015_+	host-nuclease inhibitor Gam family protein	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000632576.1|1111303_1111576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|1111585_1111882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763554.1|1111896_1112112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|1112108_1112792_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000631813.1|1112788_1113019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206212.1|1113008_1113215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001170114.1|1113216_1113666_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_001281701.1|1113637_1114027_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
>prophage 4
NZ_CP013831	Escherichia coli strain CD306 chromosome, complete genome	5073822	1329405	1375112	5073822	terminase,tRNA,portal,tail,lysis,head,holin,capsid,integrase	Enterobacteria_phage(55.1%)	57	1327723:1327737	1356317:1356331
1327723:1327737	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_001295972.1|1329405_1330512_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1330565_1331027_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248677.1|1331036_1331690_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1331861_1333112_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|1333225_1334368_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|1334357_1334594_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|1334733_1334973_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|1334956_1335283_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|1335282_1335504_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_021533932.1|1335602_1335884_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000548516.1|1335894_1336086_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|1336058_1336241_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|1336237_1336918_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|1336914_1337700_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995418.1|1337705_1338002_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000233576.1|1338077_1338284_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000858975.1|1338879_1339569_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|1339673_1339904_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182900.1|1339973_1340513_+	toxin YdaT domain-containing protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_000147894.1|1340509_1341529_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.8e-111
WP_000788794.1|1341525_1342227_+	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_022645049.1|1342476_1346742_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000700202.1|1346778_1347822_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072147164.1|1348171_1348273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053005.1|1348269_1348725_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_000224914.1|1348724_1348895_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774479.1|1348887_1349178_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_001099488.1|1349174_1349537_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000971096.1|1349533_1349674_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001097224.1|1349670_1350360_+	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000544528.1|1350681_1350987_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180486.1|1350973_1351450_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_001228695.1|1351666_1351849_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|1351939_1352233_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|1352713_1353040_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|1353246_1353429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453620.1|1353992_1354538_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_001027261.1|1354512_1356438_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
1356317:1356331	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
WP_000198149.1|1356434_1356641_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001295977.1|1356637_1358239_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000123268.1|1358219_1359539_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295978.1|1359548_1359881_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063293.1|1359936_1360962_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_000158908.1|1361003_1361402_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000753018.1|1361413_1361767_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000985120.1|1361777_1362356_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000683150.1|1362352_1362748_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_001295979.1|1362755_1363496_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000479203.1|1363511_1363934_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_000459457.1|1363915_1364350_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000847375.1|1366899_1367229_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_001152626.1|1367228_1367927_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_023146277.1|1367931_1368675_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_023149564.1|1368611_1369214_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_001531667.1|1369274_1372757_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_000290538.1|1372815_1374837_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_000654172.1|1374833_1375112_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
>prophage 5
NZ_CP013831	Escherichia coli strain CD306 chromosome, complete genome	5073822	1513967	1583680	5073822	terminase,transposase,portal,tail,head,holin,protease,capsid,integrase	Escherichia_phage(23.21%)	78	1510141:1510155	1516051:1516065
1510141:1510155	attL	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_000113700.1|1513967_1515098_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1515075_1515324_-	excisionase	NA	NA	NA	NA	NA
WP_016230610.1|1515388_1517860_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
1516051:1516065	attR	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_001090200.1|1517952_1518144_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449179.1|1518140_1518329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171951.1|1518894_1519113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|1519272_1519428_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000103687.1|1519700_1520417_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000471549.1|1520466_1520682_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693845.1|1520678_1521104_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095675.1|1521126_1522089_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000788950.1|1522095_1522842_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000450998.1|1522863_1523634_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151161.1|1523649_1524075_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000150294.1|1524249_1524915_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018429.1|1525095_1525308_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001329966.1|1525475_1525748_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265085.1|1525749_1526805_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_000140014.1|1526805_1527186_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001513213.1|1527182_1528004_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000917751.1|1528230_1528428_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_000024331.1|1528579_1529629_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_023142244.1|1530430_1530562_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000871291.1|1530842_1531178_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_016230612.1|1531438_1533292_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000284510.1|1533442_1533658_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|1533662_1534007_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|1533972_1534245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|1534350_1534884_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_032140280.1|1535438_1535525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|1535746_1535932_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000736382.1|1536017_1536233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095741.1|1536431_1536632_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829185.1|1536673_1537039_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_001296023.1|1537887_1539549_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000173031.1|1539612_1541550_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001063099.1|1541594_1541816_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267294.1|1541761_1544347_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_000125990.1|1544343_1544670_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|1544679_1545030_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1545026_1545473_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1545469_1545814_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|1545880_1546597_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710949.1|1546611_1546986_+|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|1547081_1547291_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212991.1|1547338_1550581_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_000807937.1|1550573_1550915_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_001296027.1|1550914_1551613_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000194730.1|1551623_1552367_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_061089814.1|1552312_1552945_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000514710.1|1553287_1556761_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_001298859.1|1557401_1558943_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|1558957_1559704_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_023363168.1|1560165_1562991_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q858V4	Yersinia_virus	63.6	9.0e-04
WP_000972097.1|1562992_1563526_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_001164137.1|1563556_1564084_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_001513292.1|1564099_1565068_-	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	38.8	6.5e-47
WP_001421220.1|1565193_1565376_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_000240999.1|1565574_1566243_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|1566299_1566569_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000251936.1|1566683_1566854_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001348267.1|1566980_1567538_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_001296031.1|1567534_1567810_-	ash family protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_000443082.1|1568185_1568992_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|1568991_1570185_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195273.1|1570196_1571555_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000763535.1|1571558_1573154_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194644.1|1573153_1574716_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1574807_1574852_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285702.1|1574989_1575871_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1575867_1576488_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001296033.1|1576515_1578411_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|1578623_1579499_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_000622024.1|1579668_1580691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000715.1|1580700_1581009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278898.1|1581065_1581656_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559273.1|1581652_1582411_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422062.1|1582630_1583680_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 6
NZ_CP013831	Escherichia coli strain CD306 chromosome, complete genome	5073822	2075622	2163869	5073822	terminase,transposase,tRNA,portal,plate,holin,tail,capsid,integrase	Escherichia_phage(22.73%)	103	2121319:2121378	2163931:2164055
WP_099156422.1|2075622_2076971_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	8.7e-74
WP_000568520.1|2077080_2078091_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2078099_2078711_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072093883.1|2078849_2078915_-	stress response small protein YobI	NA	NA	NA	NA	NA
WP_001024911.1|2078985_2079588_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2079589_2080111_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|2080145_2080886_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077249130.1|2080914_2081367_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258676.1|2081359_2083132_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891625.1|2083441_2084008_+	hydrolase	NA	NA	NA	NA	NA
WP_000639277.1|2084004_2084823_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|2084875_2085271_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|2085311_2086055_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564759.1|2086051_2087023_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176764.1|2087058_2089488_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214293.1|2089512_2090613_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001185734.1|2091000_2091747_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001490174.1|2091760_2092327_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|2092542_2094276_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001202076.1|2094328_2094721_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066973.1|2094720_2096799_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278946.1|2096791_2097940_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983600.1|2098128_2098773_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2098783_2099173_-	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|2099187_2100237_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204320.1|2100239_2101100_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001296146.1|2101390_2103052_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|2103196_2103700_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001531763.1|2103720_2105685_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795641.1|2105689_2106616_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906342.1|2106612_2107500_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2107626_2108205_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|2108207_2108558_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122413.1|2109337_2109766_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001296148.1|2109772_2111197_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001296149.1|2111171_2111972_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|2112138_2113125_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187827.1|2113139_2114654_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000548680.1|2114723_2115713_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|2116507_2117011_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|2117088_2117340_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2117454_2117541_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237881.1|2117804_2118128_+	YecR-like lipofamily protein	NA	NA	NA	NA	NA
WP_000917208.1|2118299_2118797_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2118834_2119074_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797555.1|2119264_2120476_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2120526_2121192_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
2121319:2121378	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001296152.1|2121663_2122083_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_001531767.1|2123297_2123522_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_001531768.1|2123683_2124073_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001018353.1|2124108_2125749_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_000444667.1|2125857_2126139_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000785563.1|2126151_2126664_-|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_000117510.1|2126681_2128184_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000626358.1|2128180_2128570_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000829621.1|2128569_2129754_-|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000203868.1|2129746_2130373_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000633314.1|2130375_2131296_-|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000901289.1|2131292_2131634_-	GPW/gp25 family protein	NA	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000079174.1|2131636_2132539_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000015612.1|2132519_2133056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|2133052_2133733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531773.1|2133764_2134145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105179.1|2134141_2134561_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001283997.1|2134595_2135630_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000206292.1|2135688_2136018_-	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001145892.1|2136017_2137325_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000126513.1|2137324_2138899_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_000203897.1|2138895_2139129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148195.1|2139128_2140991_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000168117.1|2140977_2141544_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_001531775.1|2141912_2142158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734931.1|2142217_2142412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131873.1|2142419_2142899_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000172496.1|2142898_2143171_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_001294589.1|2143170_2143554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064384.1|2143666_2144338_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_000717783.1|2144337_2144631_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000057010.1|2144627_2145224_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_001025459.1|2145301_2145481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|2145632_2146274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000536919.1|2146517_2146751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|2147149_2147638_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_001138663.1|2147647_2148253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000536231.1|2148715_2149414_-	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001237642.1|2150602_2151526_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001531776.1|2151700_2152489_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_000661082.1|2153170_2153395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|2153391_2153703_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000918616.1|2153699_2153936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214056.1|2153937_2154348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609322.1|2154386_2155802_-	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_001023813.1|2155791_2156547_-	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000943914.1|2156543_2156768_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_000431205.1|2156807_2157284_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000360804.1|2157342_2157573_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_001296165.1|2157671_2158085_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000388260.1|2159095_2159416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151806.1|2159446_2161663_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000100753.1|2161659_2162229_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000916334.1|2162228_2162411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833838.1|2162620_2162884_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_001531780.1|2162852_2163869_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
2163931:2164055	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 7
NZ_CP013831	Escherichia coli strain CD306 chromosome, complete genome	5073822	2305455	2311907	5073822	transposase	Acidithiobacillus_phage(16.67%)	9	NA	NA
WP_001298859.1|2305455_2306997_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|2307011_2307758_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000846703.1|2308206_2308617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|2308837_2309656_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_001164966.1|2309655_2309901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542276.1|2309994_2310468_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001186200.1|2310483_2310960_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|2311022_2311244_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000086752.1|2311262_2311907_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
>prophage 8
NZ_CP013831	Escherichia coli strain CD306 chromosome, complete genome	5073822	2342710	2349013	5073822		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001100793.1|2342710_2343253_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
WP_000857525.1|2343257_2344136_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001023641.1|2344193_2345093_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000699407.1|2345092_2346178_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_000183040.1|2346550_2347444_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_001116066.1|2347618_2349013_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
>prophage 9
NZ_CP013831	Escherichia coli strain CD306 chromosome, complete genome	5073822	2443189	2452634	5073822		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292786.1|2443189_2444326_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
WP_001296230.1|2444322_2446326_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|2446450_2446912_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|2446952_2447423_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2447469_2448189_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2448185_2449871_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240408.1|2450092_2450824_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001216963.1|2450883_2450991_+	protein YohO	NA	NA	NA	NA	NA
WP_000783109.1|2450971_2451703_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569347.1|2451707_2452634_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
>prophage 10
NZ_CP013831	Escherichia coli strain CD306 chromosome, complete genome	5073822	3029227	3036367	5073822		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|3029227_3031789_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141293.1|3031894_3032551_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_001296319.1|3032601_3033369_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847996.1|3033564_3034473_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_000590411.1|3034469_3035732_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279004.1|3035728_3036367_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 11
NZ_CP013831	Escherichia coli strain CD306 chromosome, complete genome	5073822	3285635	3347725	5073822	transposase,tRNA,lysis,protease,integrase	Staphylococcus_phage(50.0%)	52	3286844:3286861	3347122:3347139
WP_001296354.1|3285635_3286394_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105562.1|3286823_3287744_-	agmatinase	NA	NA	NA	NA	NA
3286844:3286861	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000758881.1|3287879_3288611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|3288756_3290733_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|3290741_3290873_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001331575.1|3291008_3291224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3291527_3292682_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3293117_3294512_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001296359.1|3294588_3295086_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|3295180_3295888_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|3295967_3296699_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593274.1|3296711_3297662_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|3297770_3298334_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|3298333_3298750_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001296360.1|3298864_3299845_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3299862_3300567_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3300584_3301151_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277229.1|3301147_3301438_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174754.1|3301445_3302039_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239963.1|3302031_3303168_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000783999.1|3303482_3304469_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577034.1|3304513_3305017_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378955.1|3305016_3306318_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745240.1|3306373_3307381_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394132.1|3307497_3308544_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3308719_3309439_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001296361.1|3309459_3309600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107566.1|3309622_3309949_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3309948_3310668_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001296362.1|3310828_3311881_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3311908_3312184_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|3312248_3313328_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001296363.1|3313529_3314786_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839781.1|3314834_3316970_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|3317362_3318070_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218869.1|3318448_3319714_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_000147017.1|3319969_3321013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774069.1|3322706_3323258_-	HTH-type transcriptional regulator PapX	NA	NA	NA	NA	NA
WP_000006213.1|3325749_3325983_+	major pilus subunit operon transcriptional regulator PapI	NA	NA	NA	NA	NA
WP_001513409.1|3327850_3327964_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_001110186.1|3329797_3330058_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109147.1|3330099_3330660_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|3330699_3331128_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_000074472.1|3331845_3333039_-	MFS transporter	NA	NA	NA	NA	NA
WP_001296374.1|3333174_3334899_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287500.1|3334899_3335847_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015715.1|3335846_3337589_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|3337585_3338863_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973516.1|3338944_3341146_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_011076574.1|3341696_3341840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034083.1|3342089_3345977_+|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_001254932.1|3346573_3347725_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
3347122:3347139	attR	CCTGAATATACAGCATCT	NA	NA	NA	NA
>prophage 1
NZ_CP013832	Escherichia coli strain CD306 plasmid pCD306, complete sequence	145221	6000	72056	145221	integrase,transposase,protease	Escherichia_phage(30.77%)	53	20683:20697	56249:56263
WP_000179844.1|6000_7680_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000344784.1|7682_8543_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000287615.1|8593_10138_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
WP_001324342.1|10260_11784_+|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000983249.1|11770_12556_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	3.3e-33
WP_000376623.1|12731_13232_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|13359_14199_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|14192_14540_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|14745_15534_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|15664_16138_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_001067855.1|17145_17850_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012372823.1|18075_18891_+	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000118029.1|19237_21124_+	FTR1 family iron permease	NA	NA	NA	NA	NA
20683:20697	attL	CAGCTTCCTGGCGGT	NA	NA	NA	NA
WP_000178050.1|21164_21692_+	iron transporter	NA	NA	NA	NA	NA
WP_000119836.1|21795_23175_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000964653.1|23177_24461_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000729220.1|24450_25581_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000117262.1|25585_26281_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_001267177.1|26267_26753_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000874189.1|26777_27263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067834.1|27972_28677_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000476108.1|30596_31907_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000950177.1|31899_32973_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	2.6e-28
WP_000922702.1|32978_33803_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_001271561.1|33813_34701_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_000338039.1|34690_35569_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_001077068.1|36540_37431_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_000710783.1|37455_37836_+	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_001022265.1|37868_38834_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_000562172.1|38879_39632_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001387467.1|40236_40521_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421272.1|40520_40796_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001105060.1|40901_41195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001072355.1|41390_42560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042344623.1|43702_43885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066953.1|44005_44746_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361611.1|45030_46008_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_000949004.1|48989_49904_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983710.1|49903_50731_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_001101723.1|50727_51585_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968139.1|51581_52439_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001318207.1|53681_54062_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.9e-26
WP_000095526.1|54441_55635_-	MFS transporter	NA	NA	NA	NA	NA
WP_000602863.1|55770_57495_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
56249:56263	attR	ACCGCCAGGAAGCTG	NA	NA	NA	NA
WP_001015721.1|58441_60184_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|60180_61458_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973519.1|61539_63741_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_001128474.1|66076_67642_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001034044.1|67716_68133_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261286.1|68129_68360_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001398199.1|70718_71120_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|71052_71310_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|71402_72056_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
