The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	3091	61661	3167361	tRNA,transposase	Escherichia_phage(28.57%)	56	NA	NA
WP_017378478.1|3091_4471_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_017378479.1|4585_6478_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_017378480.1|6525_7152_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_017378481.1|7171_8056_+	ParA family protein	NA	Q8JL10	Natrialba_phage	28.4	5.8e-18
WP_027242747.1|8088_8979_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.8	6.7e-14
WP_017378483.1|9093_9492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378484.1|9496_10312_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_016209328.1|10363_10768_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_017378485.1|10822_11293_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_017378486.1|11304_11832_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_017378487.1|11848_13390_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_027242748.1|13415_14276_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_016209339.1|14306_15698_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_017378489.1|15722_16151_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_027242749.1|16244_17609_+	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	40.9	3.9e-37
WP_027242750.1|17665_19501_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.7	5.8e-121
WP_036773290.1|19614_20343_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.2	2.3e-44
WP_027242751.1|20869_22411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378498.1|22677_23334_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_048876081.1|24031_24691_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_017376300.1|24835_25093_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275376.1|25205_25958_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_017376303.1|26016_26730_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	2.2e-28
WP_027242752.1|26921_27554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|29288_30692_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376720.1|30688_30949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081323800.1|30992_31967_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_036815787.1|31986_32304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376724.1|32381_32594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063559.1|32840_33260_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_036816796.1|33357_33804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242563.1|34148_35147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929590.1|35179_35533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929591.1|35577_35850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376728.1|36246_37665_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376729.1|37891_38833_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_026063560.1|38867_40847_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_027242562.1|40843_41449_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211294.1|41450_41792_+	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_027242561.1|41792_42629_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_080963573.1|42794_43112_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027242560.1|43189_44611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376735.1|44607_45303_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_144420744.1|46777_47623_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_017376738.1|47632_47971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420590.1|49974_50919_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046627.1|51123_51297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876079.1|51904_52954_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275379.1|53108_53327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|53646_55050_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|55060_55618_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772663.1|55614_56490_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376269.1|56714_57005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772645.1|59628_60402_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243066.1|60820_61177_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420745.1|61208_61661_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	185879	322840	3167361	tail,protease,tRNA,transposase	Acinetobacter_phage(11.11%)	120	NA	NA
WP_048876075.1|185879_187016_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|187055_187283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053063431.1|187279_187945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377597.1|188169_188376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377599.1|188469_189564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377600.1|189629_190211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377601.1|190451_190895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377602.1|190949_191207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377603.1|191184_191811_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_017377604.1|191888_193871_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	41.1	1.0e-115
WP_017377605.1|194080_195424_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_017377606.1|195690_198360_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_017377607.1|198383_200300_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_026063653.1|200469_201891_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	3.1e-45
WP_017377609.1|202035_203010_+	phospholipase A	NA	NA	NA	NA	NA
WP_027242692.1|203019_203319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377612.1|203436_203658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377613.1|203821_205483_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.5	7.7e-181
WP_016209850.1|205555_205846_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_017377614.1|206072_206528_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_017377615.1|206592_207057_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_027242691.1|207148_208495_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_017377618.1|208494_209400_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_017377619.1|209461_210448_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|210440_210683_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377620.1|210801_212346_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	1.6e-63
WP_062312046.1|212392_213679_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_017377622.1|213721_215125_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_144420750.1|215129_217667_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_144420593.1|218063_218312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963589.1|218243_218705_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017377624.1|219199_219895_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080963590.1|219996_221559_-	APC family permease	NA	NA	NA	NA	NA
WP_017377626.1|221886_223680_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.0	2.2e-117
WP_017377627.1|223766_224039_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_017377628.1|224044_224671_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_017377629.1|224657_226088_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_017377630.1|226409_227465_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.7	5.1e-29
WP_017377631.1|227433_228111_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377632.1|228100_228949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210080.1|229094_229388_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_036772063.1|229499_230312_-	trfA family protein	NA	NA	NA	NA	NA
WP_017377635.1|230610_231465_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_017377636.1|231618_232668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772068.1|232713_233370_-	DedA family protein	NA	NA	NA	NA	NA
WP_017377638.1|233387_234668_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_017377639.1|234941_236303_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_036772069.1|236363_236915_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_017376225.1|242345_243617_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_017376226.1|243673_244657_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_027243088.1|244653_245439_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_017376227.1|245746_246196_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|246289_247693_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376228.1|248130_249612_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_017376229.1|249667_250777_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376234.1|252349_252562_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243087.1|252602_253298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376236.1|256118_256685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243085.1|256842_257403_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_053856766.1|257522_258926_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875886.1|258922_259279_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376838.1|259534_260359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243084.1|261056_261581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|261866_262841_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243083.1|262940_263492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|263604_264258_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_144420594.1|264509_265967_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420595.1|266080_266560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|266797_267403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376843.1|267682_268798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|268736_269423_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_027243079.1|269416_270394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|270428_271592_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243078.1|271931_272156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|272538_272826_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_017376847.1|273000_273756_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|273788_274220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376849.1|274195_274672_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376850.1|274678_276256_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376851.1|276258_277023_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376852.1|277076_277613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|277609_278341_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_027243077.1|278565_279327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|279652_280528_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378284.1|281930_282086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|282279_283989_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375924.1|284642_284951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420596.1|284968_287161_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_069971668.1|287968_288217_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_017375921.1|288329_288563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375920.1|288797_289328_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375919.1|289332_290046_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_144420751.1|290673_291399_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_048875888.1|291407_293471_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_027243033.1|293650_294130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312049.1|294622_295990_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376531.1|296381_297179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243034.1|297290_298580_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_144420597.1|298760_299747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376534.1|299863_300043_+	rubredoxin	NA	NA	NA	NA	NA
WP_017376535.1|300054_300486_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_017376536.1|300698_301058_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	4.4e-25
WP_017376537.1|301227_302853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|303576_305004_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376538.1|305297_306479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243035.1|309081_310380_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420752.1|310735_311629_+	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_047927468.1|311625_311931_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_017376543.1|311956_312736_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_144420598.1|312765_312996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210862.1|313147_313393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376547.1|313579_314371_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_017376548.1|315070_315793_+	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376549.1|315789_316671_+	ROK family protein	NA	NA	NA	NA	NA
WP_027243038.1|316694_318185_+	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_027243039.1|318274_319162_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_017376551.1|319834_320326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|320330_320558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|320650_321625_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971669.1|321601_322840_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	330806	384244	3167361	transposase	Staphylococcus_phage(57.14%)	48	NA	NA
WP_053856767.1|330806_332210_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|332315_332501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|333199_334603_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999963.1|334693_335197_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|335236_336211_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376774.1|336207_336777_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_017376776.1|337263_337956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420601.1|338563_339556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376778.1|339545_341318_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_080963634.1|341318_341507_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_036774259.1|341544_342519_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036815640.1|342577_342772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|342838_343066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|343195_344071_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046623.1|344298_344448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420602.1|344439_344706_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420603.1|344850_345750_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046619.1|345836_346094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|346706_347933_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_027243074.1|348022_348562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243073.1|348683_349322_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275265.1|349355_349844_-	VUT family protein	NA	NA	NA	NA	NA
WP_144420604.1|350090_350393_-	VUT family protein	NA	NA	NA	NA	NA
WP_036772686.1|350373_350862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|351432_352731_-	MFS transporter	NA	NA	NA	NA	NA
WP_017378171.1|352847_353138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|353176_355831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243070.1|356544_356799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062312052.1|357108_357837_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	3.9e-44
WP_017377650.1|358607_359792_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_017377649.1|359810_360755_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_027243069.1|361060_361846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377647.1|361959_362328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377646.1|362556_364134_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_065653746.1|369502_371026_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377643.1|371230_371458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377642.1|371602_371860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|372427_373399_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_144420754.1|373323_373632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155601395.1|373695_373869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|374036_375011_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771744.1|375064_376036_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|376115_377090_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_027242739.1|377450_380120_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036774478.1|380290_381172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378307.1|381182_381839_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_017378308.1|381905_382610_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_048876031.1|382840_384244_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	441241	563627	3167361	tRNA,transposase	Staphylococcus_phage(25.0%)	106	NA	NA
WP_048875895.1|441241_442405_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_144420756.1|442458_443460_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_017378362.1|443541_444111_+	elongation factor P	NA	NA	NA	NA	NA
WP_144420608.1|444324_445296_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.9	7.3e-22
WP_017378364.1|445307_446903_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_036772406.1|446923_447955_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_017378367.1|448286_449390_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_017378368.1|449501_450686_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_017378369.1|450763_452752_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_155046621.1|453202_453424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420609.1|453911_455285_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378374.1|455302_456289_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	2.2e-42
WP_080963622.1|456291_457446_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.2	2.3e-14
WP_017378376.1|457442_458138_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	32.3	8.6e-09
WP_017378377.1|458280_459771_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_017378378.1|459791_460841_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_027242727.1|460907_462302_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378381.1|463234_465166_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
WP_075273353.1|465170_465701_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378382.1|465735_465930_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|465972_466332_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378383.1|466463_467459_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_016211707.1|469860_470148_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_080963621.1|470414_470621_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_017378388.1|472229_473003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378389.1|473004_473946_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378390.1|474079_475657_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_036816949.1|475850_476249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378392.1|476826_476979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378393.1|477249_477456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875897.1|478260_478905_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_069971672.1|478972_480229_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|480484_480664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|480886_481114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377704.1|482389_483148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420757.1|483365_483929_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377702.1|484032_484581_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_087910634.1|485177_486330_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377698.1|486675_486972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|487231_488143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619438.1|488377_488929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046620.1|490079_490217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|490463_491192_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377686.1|491238_491847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210764.1|493121_493382_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377283.1|493555_495094_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_017377282.1|495272_496199_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_048875900.1|496303_497236_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377279.1|497732_500546_+|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_017377278.1|500538_501048_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377277.1|501051_501495_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_027243089.1|501590_502892_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377276.1|503154_503523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377275.1|503514_504237_-	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_017377274.1|505298_506651_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	3.2e-36
WP_017377273.1|506644_506884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|507418_508393_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017377271.1|508803_509133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377270.1|509518_509884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377269.1|510007_510868_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|510854_511634_+	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_016210168.1|511709_512393_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036771941.1|512553_513159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377265.1|513375_513879_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_017377264.1|514080_514335_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377263.1|514836_515304_+	DoxX family protein	NA	NA	NA	NA	NA
WP_036771922.1|515870_517061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|517895_519299_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275269.1|519605_520226_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875903.1|520405_521380_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017376501.1|521545_521812_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_144420759.1|521808_522309_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_048875904.1|522429_523305_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375999.1|524964_525495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376000.1|525494_526019_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_017376001.1|526181_527297_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376003.1|527533_528694_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	2.8e-121
WP_017376004.1|529145_531149_+	transketolase	NA	NA	NA	NA	NA
WP_017376005.1|531217_532225_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017376006.1|532298_533483_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017376007.1|533492_534947_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376008.1|534977_536015_+	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_017376009.1|536337_536628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|537982_538957_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_146619442.1|539090_539753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|540276_540528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377795.1|540732_541896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275388.1|541918_542608_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377798.1|542755_543406_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_017377799.1|543506_544166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|546227_546989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|547407_547668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|547753_548416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|548532_549660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|550035_550197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420613.1|552328_552700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243006.1|552979_554221_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_075275272.1|554358_554589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377811.1|554722_555607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243005.1|555635_556262_-	ribonuclease T	NA	NA	NA	NA	NA
WP_036773165.1|556292_557492_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_144420614.1|557730_558828_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_017377815.1|558981_560520_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_017375632.1|560840_561176_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377700.1|561988_562282_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_036773116.1|562652_563627_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 5
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	573742	679240	3167361	tRNA,transposase	Bacillus_phage(16.67%)	108	NA	NA
WP_017377787.1|573742_573970_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048875857.1|574226_575201_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_048876031.1|575624_577028_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420615.1|577061_577850_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_017376557.1|577980_578676_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_017376558.1|579180_579687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242585.1|579780_580338_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_081323801.1|580635_581985_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046619.1|582071_582329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376564.1|582396_583107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420761.1|583251_583431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376566.1|583954_585214_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_017376567.1|585346_585820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376568.1|585828_587211_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_026063542.1|587203_587818_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_017376570.1|587897_588614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376571.1|588788_591113_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.7	7.6e-25
WP_036771330.1|591279_592254_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420616.1|593417_594926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376574.1|595097_596189_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376575.1|596221_596860_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376576.1|596898_597171_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_144420763.1|597269_597512_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376578.1|597529_597832_-	YciI family protein	NA	NA	NA	NA	NA
WP_017376579.1|597915_598458_-	septation protein A	NA	NA	NA	NA	NA
WP_016210074.1|598618_599245_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376580.1|599250_600090_+	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_017376581.1|600079_600730_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_026063543.1|600733_601567_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376583.1|601656_602784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|603050_603203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|603310_603505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376585.1|603697_604348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376586.1|604602_605694_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376587.1|605690_607055_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376588.1|607179_608376_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_144420764.1|608432_608996_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376590.1|609928_610597_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_017376591.1|610743_612045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376593.1|613535_613940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243040.1|614173_615256_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376596.1|615240_615861_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|615925_616801_+	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376598.1|616878_617454_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017377700.1|618262_618556_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_080999967.1|618672_618822_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|620150_621125_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420617.1|621223_621379_-	phosphatase	NA	NA	NA	NA	NA
WP_080999968.1|621297_621558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046618.1|621734_622262_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_026063680.1|622516_622741_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_144420618.1|622885_623707_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_017377700.1|623664_623958_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_027243138.1|625434_625722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|626214_626985_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|627054_628467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|628833_630204_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|630200_630365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|630424_630712_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017377833.1|631743_632334_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_026063682.1|632460_633846_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377835.1|633943_634141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243136.1|634233_635067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|635604_635958_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243135.1|635970_636207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243134.1|636206_636413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377840.1|636574_637294_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_017377841.1|637382_639167_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_155601396.1|639473_639629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377842.1|639555_639810_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|639955_640777_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_080963580.1|640959_641184_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|641289_642693_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377200.1|643257_643446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243131.1|643575_643842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377198.1|644227_645868_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_017377197.1|645980_647330_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	3.0e-74
WP_027243130.1|647326_648196_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	9.3e-69
WP_017377194.1|649120_650434_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_048875913.1|650430_651201_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_017375625.1|651197_651425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875914.1|652129_653290_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_069971647.1|653258_653855_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|654823_655051_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_062312071.1|656018_656429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875923.1|656425_657421_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963657.1|657406_658588_-	MFS transporter	NA	NA	NA	NA	NA
WP_036774946.1|658535_659150_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_155046615.1|659846_660008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377737.1|660287_660833_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_017377736.1|660866_661532_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_062312074.1|661591_662548_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.4	2.0e-32
WP_144420767.1|662826_663504_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_048875918.1|663546_664128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|664272_664944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927746.1|665546_666134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|667102_667330_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773915.1|667302_667698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377727.1|668126_668942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377726.1|669032_670019_+	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377725.1|670188_670710_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377724.1|670743_670995_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377723.1|671005_672283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377722.1|672974_673502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377721.1|673618_675931_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_036773913.1|676059_676875_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377718.1|677131_677596_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017377787.1|679012_679240_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 6
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	686597	758839	3167361	tRNA,transposase	Staphylococcus_phage(66.67%)	48	NA	NA
WP_062312081.1|686597_686870_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420621.1|689472_690234_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771325.1|692424_693399_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376309.1|696636_696924_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_017376311.1|698182_699082_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_017376312.1|699078_699597_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376313.1|699666_700284_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_026063524.1|700293_701781_+	ribonuclease G	NA	NA	NA	NA	NA
WP_027242903.1|701790_705471_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_017376318.1|705544_706354_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_017376319.1|706353_707034_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_036773116.1|707658_708633_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|708675_709671_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|709723_710698_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376224.1|711010_711895_-	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_017376223.1|712025_712847_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376222.1|712848_713886_-	asparaginase	NA	NA	NA	NA	NA
WP_017376221.1|713889_716547_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_017376220.1|716624_717434_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376219.1|717840_718608_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_017376218.1|718772_719651_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_017376217.1|719654_720392_+	UMP kinase	NA	NA	NA	NA	NA
WP_017376216.1|720395_720953_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_026063514.1|720960_721707_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	44.0	6.6e-23
WP_080963646.1|721621_722521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771906.1|722609_723485_+	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_144420622.1|723581_725159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420623.1|725358_725556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376212.1|725603_727514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376211.1|728050_728590_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_017376210.1|728586_729615_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_017376209.1|729604_730669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069468.1|730656_732870_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_027242906.1|732871_733939_-	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_036771893.1|734223_736641_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_017376207.1|736721_737255_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_017376206.1|737365_738415_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_075275393.1|738432_738879_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_017376204.1|738878_739652_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_027242907.1|739670_740825_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_017376201.1|741038_741608_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	43.4	3.4e-27
WP_027242908.1|745218_746178_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_017376198.1|746152_747613_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_080999970.1|749213_750617_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155049759.1|752522_754343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|754427_755831_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876031.1|755976_757380_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|757864_758839_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 7
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	771312	831536	3167361	transposase	Acinetobacter_phage(18.18%)	51	NA	NA
WP_048876012.1|771312_772716_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_082300719.1|772934_773360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243151.1|773411_774899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377221.1|775208_775748_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_082300723.1|776037_776265_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377224.1|777510_778086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999971.1|778199_779603_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377226.1|779599_779890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377227.1|780257_780671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106211.1|781359_783147_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017377229.1|783313_783934_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_155046612.1|784280_784421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377230.1|784440_786417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377231.1|786789_788247_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.1	9.4e-98
WP_017377232.1|788315_789896_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	1.1e-16
WP_017377234.1|790536_794433_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	3.4e-118
WP_016210741.1|794439_794763_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_017377235.1|794836_795310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772195.1|795341_796337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243012.1|796588_798226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910659.1|798585_799533_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.3e-35
WP_017377238.1|799851_800196_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_144420626.1|800289_800961_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_017377240.1|801001_801829_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_036772199.1|801915_802443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243013.1|803328_803748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106212.1|803857_804439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377245.1|804793_806074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377246.1|806194_807058_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_017377247.1|807146_807941_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036772212.1|808178_809165_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_027243014.1|809170_810697_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_144420771.1|810792_812037_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017377251.1|812090_813470_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_026063614.1|813587_814373_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	3.7e-32
WP_016211687.1|814715_815360_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_017377253.1|815394_817200_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|817223_817799_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036771330.1|818848_819823_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_053093666.1|822359_823037_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_144420627.1|824535_824757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|825637_825799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|825735_826236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|826331_826760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|827019_827469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420628.1|827521_827956_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999973.1|827932_828898_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_017377288.1|829116_829377_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_087910637.1|829471_830206_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_155046611.1|830234_830387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|830591_831536_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	845199	989406	3167361	integrase,protease,tRNA,transposase	Staphylococcus_phage(16.67%)	115	869978:870037	920402:921162
WP_017377305.1|845199_846501_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_017377306.1|846568_849001_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	1.2e-219
WP_016209655.1|849104_849377_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075275280.1|849459_851358_+	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_017377308.1|851389_852274_+	hypothetical protein	NA	A0A1W6JP29	Morganella_phage	35.7	2.2e-41
WP_017377309.1|852282_852678_-	CrcB family protein	NA	NA	NA	NA	NA
WP_048875932.1|853101_855249_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.2	3.1e-25
WP_017377313.1|855220_856570_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377314.1|856566_858687_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_017377315.1|858683_860387_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.0	3.4e-22
WP_017377316.1|860521_861664_-	galactokinase	NA	NA	NA	NA	NA
WP_017377317.1|861720_862749_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_026063623.1|862875_864390_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_017377319.1|864496_864697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420630.1|864841_865177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275281.1|865321_865558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420772.1|865828_866707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875933.1|867343_868288_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155601397.1|868561_869716_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|869736_869964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420631.1|869968_870754_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
869978:870037	attL	GTCTTAGAGGTCATTGAAGGAGATCAGACGCTCAACCAAATATGCTCGAAATATGAGCTA	NA	NA	NA	NA
WP_075275282.1|871144_871987_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377467.1|871983_872280_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_017377471.1|873761_874373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377472.1|874441_875248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|875551_876526_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377475.1|876697_878590_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_144420632.1|879162_881478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|881892_883296_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|883736_884216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155601398.1|884283_884895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062312091.1|884933_885539_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772665.1|885685_886210_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017376899.1|886614_886755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|886952_887657_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376902.1|888511_888823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376903.1|888886_889066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|889628_889811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376905.1|889874_890102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063576.1|890309_891074_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_026063577.1|891300_891594_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_048875878.1|892119_893523_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376909.1|893992_894970_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_027243158.1|895066_896527_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376911.1|896553_897207_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_017376912.1|897331_897898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774028.1|898194_899928_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_047927497.1|899999_901706_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_017376916.1|901697_902756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|903009_903858_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017375855.1|904452_904899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420773.1|905588_907001_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375857.1|907392_908835_+	MFS transporter	NA	NA	NA	NA	NA
WP_144420774.1|908966_909035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420634.1|909233_910565_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081323802.1|910676_911648_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.0	8.0e-29
WP_017377669.1|911697_912402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|912842_913655_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420636.1|913713_916224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|916569_917745_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420637.1|919092_919317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875940.1|919345_920509_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_036774146.1|922751_923897_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
920402:921162	attR	TAGCTCATATTTCGAGCATATTTGGTTGAGCGTCTGATCTCCTTCAATGACCTCTAAGACAACTTTAGTTTTAAATTCAGCGCTTGGCTTCTTTCTTTTTTGACTCATCTCATAGCTCCTAAAATGTTAAGCATCATTTTAACCTTTCAGGAATAAATCGTTAAATTATCCTGTCTGAAAACTCGGGAGCATTCGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGGCCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTAGTGGAGTGTGCCGATTCAAGGCACGTAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGATATTGCGTTGGCGGTTGCGGCCATTCCAGAAGGTTTACCGGCGGCGTTTACAATTATTTTAGCGATTGGTGTGTCGCGTATGGCACGTAAAGGTGCGATTATTCGTAAGTTACCCGCAGTGGAAACATTGGGTAGTACGACGGTCGTCTGTTCTGATAAAACGGGTACACTGACAAAAAATCAGATGACAGTAAAAGAAGTGGTGGTTGGTCAGGAGCGTTATACTATCAGCGGCGCCGGTTATGAGCCTGTTGGTACGGTGAAAAATTCGGCAGGGCA	NA	NA	NA	NA
WP_027243152.1|924489_925425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875941.1|926922_927234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|927230_928313_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377679.1|928628_928835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243160.1|928932_929463_+	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_017377681.1|929750_930929_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.6	7.7e-50
WP_144420775.1|931077_934842_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_017377683.1|934900_936403_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_036773927.1|936954_937590_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_016211781.1|938101_939349_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_075275285.1|939571_941008_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|941183_942401_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999976.1|942862_943642_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|944648_945623_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048875941.1|946668_946980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|946976_948059_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046609.1|948369_948576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243178.1|950296_951658_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_017375734.1|951768_952140_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_017375735.1|952362_953013_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375736.1|953055_954138_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_069971648.1|954864_955839_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_082300723.1|956709_956937_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017376860.1|959117_960671_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017376859.1|961459_961696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|961815_962859_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375571.1|963105_963507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774710.1|963680_964580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|964974_966186_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036771959.1|966196_966421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046608.1|966742_966907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|966999_968403_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243219.1|968569_968878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046607.1|969162_969345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875947.1|969961_971011_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875948.1|971079_972102_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_017378198.1|972147_973062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|974030_974258_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378197.1|974214_975084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093667.1|976521_977238_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376026.1|977682_979554_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_027243175.1|979645_981391_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376029.1|981470_981920_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_016211035.1|981972_982188_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376030.1|982434_983451_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_017376031.1|983499_984129_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376032.1|984469_985681_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_048875949.1|985713_986064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|986029_986710_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376035.1|986986_987406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875951.1|987551_988388_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|988431_989406_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 9
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	1008468	1051661	3167361	protease,tRNA,transposase	Orpheovirus(20.0%)	44	NA	NA
WP_026063502.1|1008468_1009344_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420642.1|1009608_1009803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|1009947_1010421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046586.1|1010690_1010864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1011068_1012382_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376055.1|1012378_1013023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|1013541_1014729_-	MFS transporter	NA	NA	NA	NA	NA
WP_027242844.1|1014909_1015551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376060.1|1015624_1016974_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_048876123.1|1017077_1019258_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_036772169.1|1019327_1020203_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080999977.1|1020249_1020546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376065.1|1020669_1021077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420776.1|1021056_1021635_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376067.1|1022057_1022720_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|1022750_1023119_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376068.1|1023129_1024446_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420644.1|1024692_1025304_+	DedA family protein	NA	NA	NA	NA	NA
WP_065653731.1|1025379_1025559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211261.1|1025729_1026023_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_036772670.1|1026263_1026566_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_017376072.1|1026620_1028894_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_016211259.1|1028953_1029199_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_048875954.1|1029323_1030079_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875955.1|1030187_1031162_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_036771709.1|1031369_1032131_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_017376076.1|1032114_1033071_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_017376077.1|1033333_1035832_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376078.1|1035835_1036576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376079.1|1037025_1037820_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376080.1|1037982_1038771_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376081.1|1038767_1039979_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_144420777.1|1039971_1040328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376083.1|1040422_1040851_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_036771725.1|1041002_1042112_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376085.1|1042108_1042837_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_017376086.1|1042894_1043782_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376087.1|1043866_1044241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376088.1|1044340_1045618_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_080963644.1|1045629_1046361_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_048875956.1|1046347_1047589_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_027242841.1|1047698_1049102_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_155046606.1|1049254_1049425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|1050830_1051661_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	1055207	1112456	3167361	tRNA,protease,transposase	Staphylococcus_phage(20.0%)	51	NA	NA
WP_048875957.1|1055207_1055864_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375746.1|1055860_1056169_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_036771957.1|1056517_1057489_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377899.1|1057793_1058585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875958.1|1058574_1059438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377897.1|1059464_1059884_-	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_017377896.1|1059936_1060893_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_027242839.1|1061375_1064048_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377894.1|1064128_1064755_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_026063687.1|1064911_1066510_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377892.1|1066599_1068021_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377891.1|1068051_1068573_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	2.0e-10
WP_017377890.1|1068569_1069175_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_017377889.1|1069251_1070262_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	6.9e-07
WP_017377888.1|1070374_1071079_+	protein TolQ	NA	NA	NA	NA	NA
WP_017377887.1|1071113_1071545_+	protein TolR	NA	NA	NA	NA	NA
WP_036771700.1|1071547_1072642_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_048875959.1|1072701_1074054_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_017377882.1|1074089_1074731_+	OmpA family protein	NA	NA	NA	NA	NA
WP_144420778.1|1074803_1075703_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_027242836.1|1075705_1076353_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	38.6	1.6e-36
WP_027242835.1|1076403_1077207_-	AAA family ATPase	NA	A0A0E3G5H5	Synechococcus_phage	43.1	6.8e-42
WP_017377879.1|1077388_1077604_+	SlyX family protein	NA	NA	NA	NA	NA
WP_017377878.1|1077607_1077841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377877.1|1077902_1079495_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_017377875.1|1079697_1080627_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.9	7.0e-14
WP_017377874.1|1080628_1081396_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047927659.1|1081761_1082532_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_048875960.1|1082590_1083565_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377870.1|1083672_1084035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377869.1|1084204_1085914_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_048875961.1|1086154_1087558_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619530.1|1087609_1087867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|1088615_1089923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773793.1|1090382_1090760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|1090904_1091306_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875964.1|1091870_1092650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|1092717_1092858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|1093058_1093256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|1093393_1093993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771696.1|1094175_1095636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|1096050_1097796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|1098231_1099092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378007.1|1099609_1101553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|1101698_1103102_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378006.1|1103221_1103851_-	response regulator	NA	NA	NA	NA	NA
WP_017378005.1|1104089_1104809_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378004.1|1104922_1108462_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378003.1|1108528_1109359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773465.1|1109345_1111385_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_027243145.1|1111400_1112456_+|protease	protease SohB	protease	NA	NA	NA	NA
>prophage 11
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	1119320	1153462	3167361	transposase	Burkholderia_virus(33.33%)	28	NA	NA
WP_144420650.1|1119320_1120577_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|1120832_1121012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420651.1|1121331_1121985_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_075275295.1|1122189_1122516_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876012.1|1123287_1124691_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377761.1|1124861_1126232_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_144420780.1|1126278_1127178_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377763.1|1127158_1129963_-	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377764.1|1130042_1130639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377765.1|1131052_1131808_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377787.1|1131897_1132125_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027242898.1|1133241_1133883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377768.1|1134152_1135478_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_047927230.1|1135474_1137532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377771.1|1137509_1138082_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144420781.1|1138164_1138497_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_017377773.1|1138561_1139596_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_027242897.1|1139583_1140705_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|1140798_1141782_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_027242896.1|1141938_1143606_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.3	1.2e-19
WP_027242895.1|1143892_1144744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377782.1|1145152_1147621_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_017377783.1|1147634_1148609_+	homoserine kinase	NA	NA	NA	NA	NA
WP_017377784.1|1148595_1149864_+	threonine synthase	NA	NA	NA	NA	NA
WP_027242894.1|1149897_1151646_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017375591.1|1151825_1152029_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420652.1|1152247_1152925_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_047927086.1|1153204_1153462_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
>prophage 12
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	1193938	1254286	3167361	tRNA,transposase	uncultured_Mediterranean_phage(28.57%)	49	NA	NA
WP_051929562.1|1193938_1194643_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036771332.1|1194893_1195868_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_017376395.1|1196755_1199482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|1200005_1200980_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376397.1|1201177_1202659_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1203118_1203781_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_017376399.1|1205412_1208184_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
WP_017376400.1|1208252_1208696_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_017376401.1|1208848_1210321_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.2	1.8e-43
WP_017376402.1|1210432_1211494_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_027242800.1|1211490_1212525_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_017376405.1|1212527_1213568_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_026063528.1|1213752_1214868_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376407.1|1214906_1215260_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_017376408.1|1215280_1217149_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376409.1|1217170_1218115_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376410.1|1218348_1218627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|1218989_1219628_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376411.1|1219602_1221027_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_017376412.1|1221227_1221905_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_027242801.1|1222025_1223300_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376414.1|1223367_1224123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376415.1|1224174_1225092_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_144420654.1|1225518_1226298_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1226350_1226638_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929627.1|1226697_1227048_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046603.1|1227241_1227394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999981.1|1227321_1227795_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_048875973.1|1227807_1228443_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773947.1|1228954_1229830_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376433.1|1231436_1232795_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_026063530.1|1233018_1233207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376430.1|1233220_1234354_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_048875975.1|1234554_1238427_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_062312104.1|1238461_1239187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|1239576_1240305_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1240707_1241436_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_075275409.1|1241499_1242327_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242802.1|1242508_1242877_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_017376425.1|1242873_1243692_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_017376424.1|1243792_1244608_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376423.1|1244891_1246952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|1246948_1247374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376421.1|1247559_1249053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|1249185_1250001_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376419.1|1250096_1250513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376418.1|1250895_1251435_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_144420656.1|1252351_1252513_-	phosphatase	NA	NA	NA	NA	NA
WP_144420657.1|1253224_1254286_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	1282959	1299574	3167361	transposase	Acinetobacter_phage(50.0%)	15	NA	NA
WP_048876031.1|1282959_1284363_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378296.1|1285803_1286589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1286679_1288329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378294.1|1288473_1289319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1289432_1290836_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774189.1|1291301_1292309_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1292308_1292566_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242792.1|1293099_1293759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378290.1|1293777_1294653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275303.1|1294788_1295778_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420658.1|1295754_1296516_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_144420659.1|1296548_1297328_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875973.1|1297604_1298240_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1298236_1298401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1298599_1299574_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 14
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	1334221	1406384	3167361	tRNA,protease,transposase	Klosneuvirus(15.38%)	54	NA	NA
WP_017378228.1|1334221_1335142_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_016211418.1|1340984_1341446_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378221.1|1341462_1342386_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_027242798.1|1342409_1343459_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_062312220.1|1343596_1344169_+	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	30.3	7.3e-14
WP_016211840.1|1346741_1347206_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_017378214.1|1347644_1349117_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_017378213.1|1349233_1349686_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155046599.1|1349810_1349966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1350110_1350314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378212.1|1350504_1350903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1351088_1351694_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017375549.1|1351702_1351999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1352003_1352540_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875985.1|1352684_1353290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875986.1|1354301_1354799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910640.1|1355206_1355623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1355690_1357094_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275305.1|1357090_1357711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312136.1|1359128_1359749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376443.1|1361845_1362499_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376444.1|1362667_1363843_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376445.1|1364196_1365522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063532.1|1365614_1366403_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376447.1|1366504_1367377_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_017376448.1|1367563_1368826_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376449.1|1368899_1369430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376451.1|1370971_1371637_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376452.1|1371730_1373491_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_036773947.1|1373768_1374644_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376455.1|1374980_1375442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376456.1|1375475_1378046_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376457.1|1378153_1378639_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376458.1|1378813_1379854_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_017376459.1|1379831_1380314_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_017376460.1|1380310_1382905_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376461.1|1383211_1383475_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_069971651.1|1383847_1384723_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046597.1|1384837_1385014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376465.1|1385558_1387121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772167.1|1387662_1388610_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_017376467.1|1388829_1390305_-	APC family permease	NA	NA	NA	NA	NA
WP_017376469.1|1390824_1391847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376470.1|1392203_1393571_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_026063533.1|1393846_1394101_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_048876132.1|1394149_1395403_+	GTPase HflX	NA	NA	NA	NA	NA
WP_027242811.1|1395422_1396637_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_017376474.1|1396636_1397530_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_017376475.1|1397727_1399026_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_027242812.1|1399115_1400393_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_036772166.1|1400406_1402806_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_017376476.1|1402802_1403561_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_017376477.1|1403737_1404127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|1405655_1406384_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
>prophage 15
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	1424236	1469720	3167361	tRNA,transposase	Acinetobacter_phage(15.38%)	48	NA	NA
WP_048875989.1|1424236_1425640_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242819.1|1425788_1426151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377447.1|1426322_1426541_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242820.1|1427086_1429114_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377445.1|1429195_1430446_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377444.1|1430745_1431081_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_016211283.1|1431392_1431641_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377443.1|1431676_1432186_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_017377442.1|1432185_1432965_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377441.1|1432982_1433330_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377440.1|1433439_1433715_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_080963600.1|1433876_1434233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816484.1|1434631_1434967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875990.1|1435171_1435948_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420664.1|1435904_1436777_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_017376231.1|1437061_1437349_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_080999985.1|1437432_1438152_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275310.1|1438282_1438891_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|1439696_1440671_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_051929549.1|1440750_1441128_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_047927093.1|1441226_1442330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|1443990_1444488_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875992.1|1444632_1445031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420665.1|1445116_1446022_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_047927606.1|1446240_1446561_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_036773204.1|1446642_1447416_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|1447992_1448826_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420786.1|1448855_1449710_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_144420667.1|1450086_1451097_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_017377585.1|1451241_1451499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312138.1|1451612_1451936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155601399.1|1451887_1452868_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|1453123_1453303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377584.1|1453796_1454039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377583.1|1454064_1455423_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_026063647.1|1455704_1456064_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377580.1|1456495_1458130_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_017377579.1|1458136_1458973_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377578.1|1458994_1460272_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377577.1|1460358_1460676_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377576.1|1460698_1461790_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377575.1|1461980_1463570_+	APC family permease	NA	NA	NA	NA	NA
WP_017377574.1|1463630_1464404_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377573.1|1464574_1465624_+	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_036816899.1|1466352_1466544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|1467373_1468150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420668.1|1468350_1468662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|1468754_1469720_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	1540898	1675994	3167361	integrase,protease,tRNA,transposase	Staphylococcus_phage(21.88%)	126	1551936:1551995	1622181:1622472
WP_048876002.1|1540898_1541882_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
WP_087910642.1|1542681_1543835_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876004.1|1543956_1544649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242833.1|1544657_1545845_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_017376484.1|1545994_1546621_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_017376485.1|1546666_1547896_+	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_144420789.1|1548090_1548537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1548728_1550087_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_075275317.1|1550752_1550926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876005.1|1551055_1551973_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
1551936:1551995	attL	CAAACGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGT	NA	NA	NA	NA
WP_053093673.1|1552314_1552974_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1553054_1553558_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_017376491.1|1553530_1553818_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771628.1|1554110_1555232_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_036771330.1|1555494_1556469_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376496.1|1556735_1557857_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_144420790.1|1557953_1558169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772303.1|1558255_1559026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155601400.1|1560166_1560379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816364.1|1560278_1560497_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048876006.1|1562360_1562954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046592.1|1562929_1563076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929832.1|1563278_1563539_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017375982.1|1563737_1564358_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|1564431_1565715_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_027243165.1|1566055_1567366_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_036773519.1|1567513_1568902_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243163.1|1569037_1570366_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375989.1|1570436_1570937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1571456_1572431_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420675.1|1572506_1572824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275321.1|1572827_1573196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243029.1|1573929_1574898_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_027243028.1|1575107_1576520_-	MFS transporter	NA	NA	NA	NA	NA
WP_017375994.1|1576707_1577421_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_017375995.1|1577441_1577855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1577955_1579029_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_027243027.1|1579165_1580065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1580320_1580572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243025.1|1580620_1581256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772872.1|1581380_1582238_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_053856766.1|1582425_1583829_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927520.1|1584004_1584508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377328.1|1584584_1585886_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_027243023.1|1587507_1587750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772851.1|1587743_1588061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1589283_1589511_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036774927.1|1590121_1590592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1590814_1591114_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|1591110_1591356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420676.1|1591648_1592605_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
WP_017375591.1|1592889_1593093_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_065653736.1|1593223_1594252_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_047927336.1|1594615_1594861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971648.1|1595223_1596198_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_075275420.1|1597669_1599376_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_036773893.1|1599421_1600273_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_146619459.1|1600475_1602932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420677.1|1603451_1603853_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|1604439_1605414_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378512.1|1605454_1606783_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|1607046_1607616_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378513.1|1607631_1607943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1607952_1608921_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1609033_1609387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378515.1|1609390_1610455_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_017378516.1|1610455_1612195_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378517.1|1612201_1612624_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378518.1|1612607_1613237_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075275322.1|1613472_1613571_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_047927346.1|1613603_1615475_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_048876007.1|1615622_1616597_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_017378522.1|1616640_1616820_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243017.1|1616993_1618337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420678.1|1618835_1619114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1619381_1620338_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_017375696.1|1620664_1621048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420680.1|1621063_1621984_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_036774017.1|1622299_1623175_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
1622181:1622472	attR	ACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGTTTGAAAAACCAGTGGTTTTGCGGCTAAATAGAGTCTAAATTTAGTTCTAAAGAAGCAATAAAATGGACTTAACATTGATTTCTCTCTTTTGTGTAATAGATGATTTCTGCCAAGAGTTATTACCTCAATGGAATGCTATTTTGCTAGAAGATACGAATAAAAAACGTAATAAGCCTTCACAAATGTCAACAAGTGAAATAATGACAATTATGATTTATTTTCACAAATCTAATTA	NA	NA	NA	NA
WP_155046590.1|1623176_1623341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420681.1|1623520_1623706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876008.1|1623749_1624724_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_027242577.1|1624720_1626022_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_027242578.1|1626039_1626576_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_017376784.1|1626612_1626798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376785.1|1627038_1627944_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144420682.1|1629350_1629512_+	phosphatase	NA	NA	NA	NA	NA
WP_155046588.1|1630046_1630256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243099.1|1631371_1632685_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
WP_027243098.1|1632920_1634066_+	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_155049745.1|1634140_1634317_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_027243096.1|1634352_1634985_-	MarC family protein	NA	NA	NA	NA	NA
WP_144420683.1|1635161_1635818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243095.1|1635806_1638092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376797.1|1638365_1638725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376798.1|1639006_1639642_+	LysE family translocator	NA	NA	NA	NA	NA
WP_017376801.1|1640829_1641654_+	hypothetical protein	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
WP_144420791.1|1641709_1642921_-	protein kinase	NA	NA	NA	NA	NA
WP_027243094.1|1643704_1644412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619422.1|1644474_1644654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312151.1|1644715_1645048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376807.1|1645145_1645889_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_017376808.1|1645902_1646946_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017376809.1|1647084_1648854_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_048876146.1|1649078_1650212_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	2.6e-15
WP_017376814.1|1654254_1654980_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_081377820.1|1657574_1658135_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
WP_051929542.1|1658339_1658672_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1658731_1659019_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_048876009.1|1659671_1660697_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1660824_1661799_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243041.1|1661993_1662947_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_144420684.1|1663116_1663365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420792.1|1663547_1664072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1664526_1665354_+	DsbA family protein	NA	NA	NA	NA	NA
WP_144420685.1|1665422_1665608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1665808_1666267_+	amino acid permease	NA	NA	NA	NA	NA
WP_017376829.1|1666407_1666635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1666799_1668185_-	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376830.1|1668480_1668795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243043.1|1668903_1670529_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376832.1|1670941_1671931_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1672252_1672438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376833.1|1672827_1674783_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_080963614.1|1674854_1674977_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1675019_1675994_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 17
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	1695758	1754672	3167361	tRNA,transposase	Acinetobacter_phage(16.67%)	53	NA	NA
WP_048876011.1|1695758_1696808_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772296.1|1697007_1697385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243051.1|1698081_1698291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1698574_1698862_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_036773200.1|1698921_1699218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1699362_1700019_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_017377324.1|1700258_1700639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1701290_1702694_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910660.1|1702690_1702972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1703366_1703831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927610.1|1704011_1704605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876007.1|1704790_1705765_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_051929845.1|1706168_1706993_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027243222.1|1707067_1708216_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_027243221.1|1708231_1709860_-	cytochrome d terminal oxidase subunit I	NA	NA	NA	NA	NA
WP_017375698.1|1710203_1711397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063486.1|1717511_1718012_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_155046587.1|1718425_1718566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062312154.1|1718688_1720149_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.4	5.2e-56
WP_026063485.1|1720226_1720709_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_017375881.1|1720867_1722133_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	1.2e-48
WP_027243180.1|1722217_1723477_+	phosphoesterase	NA	NA	NA	NA	NA
WP_017375878.1|1723548_1723821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876014.1|1724158_1724494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375877.1|1724854_1725103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876016.1|1725373_1725784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1725928_1726465_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420687.1|1726475_1726661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376772.1|1727096_1728068_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027243181.1|1728049_1729021_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420793.1|1729134_1729908_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017376768.1|1730178_1730508_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876149.1|1730763_1731282_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1731334_1731562_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420688.1|1732543_1733419_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1733610_1733988_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876011.1|1734547_1735597_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376108.1|1735910_1737296_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_017376107.1|1737302_1738841_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376106.1|1738883_1739609_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376105.1|1739779_1741012_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376104.1|1741211_1742033_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376103.1|1742082_1742892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876018.1|1743047_1746914_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376100.1|1747079_1747955_+	ParA family protein	NA	NA	NA	NA	NA
WP_075275424.1|1748019_1748298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1748442_1749018_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_017376099.1|1749066_1749225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1749973_1750690_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063521.1|1751818_1752235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420690.1|1753149_1754079_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_144420691.1|1754050_1754209_+	phosphatase	NA	NA	NA	NA	NA
WP_017376276.1|1754357_1754672_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
>prophage 18
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	1758586	1818736	3167361	tRNA,transposase	Burkholderia_virus(50.0%)	44	NA	NA
WP_048876152.1|1758586_1759531_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420693.1|1759518_1759662_+	phosphatase	NA	NA	NA	NA	NA
WP_036771585.1|1760023_1760356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275332.1|1763248_1764250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376676.1|1764322_1764787_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_081329473.1|1765159_1765579_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420694.1|1766439_1766676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376672.1|1766969_1770026_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242910.1|1770107_1771562_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027242911.1|1771996_1773013_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017376669.1|1773121_1773520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242912.1|1775381_1778684_+	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_036772026.1|1778788_1779664_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376663.1|1779701_1780616_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_027242913.1|1780680_1781310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376662.1|1781354_1781789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376661.1|1781769_1782510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376660.1|1782523_1783921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242914.1|1783923_1786872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772028.1|1786871_1788593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242917.1|1788607_1789012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376655.1|1789012_1791892_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_075275426.1|1791894_1792617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242919.1|1792978_1794871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376650.1|1794902_1797443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242920.1|1797474_1798638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242921.1|1798643_1799267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275427.1|1802571_1802643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275333.1|1802825_1803008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971656.1|1804209_1804482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420695.1|1804497_1805931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420696.1|1806075_1807341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242924.1|1807626_1809378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242925.1|1809390_1810554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420697.1|1810557_1810854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1810893_1811121_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036771639.1|1812989_1813964_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_081000010.1|1814022_1814286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1814295_1815609_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|1815813_1815987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1816054_1816198_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_027243218.1|1816216_1816414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772025.1|1816431_1816938_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_036772663.1|1817860_1818736_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	1848491	1962308	3167361	tRNA,transposase	Staphylococcus_phage(23.08%)	94	NA	NA
WP_048876022.1|1848491_1849343_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_087910645.1|1849755_1850909_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876023.1|1850999_1852103_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_017375861.1|1852442_1852943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|1853639_1853993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375862.1|1854293_1856021_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_047927270.1|1856124_1856850_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	6.4e-31
WP_017375864.1|1856842_1858081_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017375865.1|1858218_1859256_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_017375866.1|1859310_1860213_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	3.2e-56
WP_017375867.1|1860322_1861576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242968.1|1861633_1865125_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_144420795.1|1865241_1865919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375871.1|1866046_1866595_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017375873.1|1868465_1868627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063558.1|1869818_1870385_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	2.8e-74
WP_087910646.1|1870387_1871512_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_026063557.1|1871596_1872415_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_027242970.1|1872545_1874525_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_017376714.1|1874584_1875238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1875922_1877293_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376707.1|1879008_1879656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376706.1|1879693_1880086_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376705.1|1880338_1881085_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243123.1|1881683_1882589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1882704_1883679_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376701.1|1883824_1884553_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_017376700.1|1884672_1885254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243124.1|1885276_1888117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155601401.1|1892128_1892377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1892917_1893562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1893595_1894240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376691.1|1894288_1895143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1895280_1895793_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_107517381.1|1895860_1896055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1896268_1896622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1897830_1898805_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376683.1|1899552_1900254_-	cyclase family protein	NA	NA	NA	NA	NA
WP_087910647.1|1900328_1900988_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_026063554.1|1901125_1902382_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_017376681.1|1902656_1903319_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_017376680.1|1903308_1904541_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_027243127.1|1904672_1905290_+	VOC family protein	NA	NA	NA	NA	NA
WP_036773258.1|1905367_1905874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1905884_1906112_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876026.1|1907394_1907661_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420796.1|1907890_1909009_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774270.1|1909153_1909489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1909499_1909913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375562.1|1911121_1911286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1911322_1912198_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929862.1|1912384_1912897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1915328_1916528_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_017375900.1|1916781_1917063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927375.1|1917118_1919110_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_026063491.1|1919183_1920161_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_027242984.1|1920296_1921079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774087.1|1921235_1921559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876030.1|1921626_1922730_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772169.1|1922799_1923675_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_047927184.1|1923671_1924016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963581.1|1924025_1924487_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_027242985.1|1924500_1925892_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_027242986.1|1925933_1928921_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_027242987.1|1928990_1929824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910648.1|1929878_1931066_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_027242989.1|1931053_1931758_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_027242990.1|1931803_1932589_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_027242991.1|1932616_1933354_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|1933458_1935654_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_027242992.1|1935728_1936412_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_027242993.1|1936422_1936854_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_027242994.1|1936899_1937298_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_027242995.1|1937674_1938382_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_027242996.1|1938446_1938743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242997.1|1938784_1939261_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_027242998.1|1939314_1939836_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	3.8e-25
WP_027242999.1|1939917_1941012_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_048876031.1|1941978_1943382_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375890.1|1943551_1944115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375891.1|1944250_1945726_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375892.1|1945732_1945939_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375893.1|1945996_1947067_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017375757.1|1949883_1951443_+	APC family permease	NA	NA	NA	NA	NA
WP_144420701.1|1952039_1952396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243002.1|1953236_1953896_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027243003.1|1953991_1955353_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_017377787.1|1955494_1955722_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375762.1|1956773_1958114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963648.1|1958764_1958926_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036815628.1|1959025_1959853_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420702.1|1960206_1961082_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036771330.1|1961125_1962100_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_047927692.1|1962119_1962308_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	1979810	2046170	3167361	transposase	Burkholderia_virus(22.22%)	49	NA	NA
WP_048876034.1|1979810_1980503_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375561.1|1980499_1980643_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1981986_1982214_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375766.1|1983520_1985551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|1985617_1986643_-	FUSC family protein	NA	NA	NA	NA	NA
WP_027242772.1|1986635_1987682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771312.1|1987822_1988818_+	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_048876036.1|1989115_1989754_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_017375978.1|1990467_1991655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375977.1|1991820_1992774_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036771316.1|1992796_1994815_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375975.1|1994903_1995227_-	YqcC family protein	NA	NA	NA	NA	NA
WP_155046584.1|1995475_1995652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093677.1|1995879_1996599_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_016209463.1|1997214_1997598_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_048876037.1|1998242_1998716_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_027242774.1|1998821_2000192_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_048876038.1|2000307_2001039_+	hypothetical protein	NA	M1IDP9	Pelagibacter_phage	35.8	9.1e-09
WP_027242775.1|2001063_2002161_-	alanine racemase	NA	NA	NA	NA	NA
WP_048876039.1|2002196_2003615_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	2.0e-153
WP_027242777.1|2003824_2004277_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209480.1|2004288_2004516_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_027242778.1|2004565_2004892_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_027242779.1|2005095_2005785_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036771340.1|2005933_2006422_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_036771342.1|2006462_2007563_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_027242782.1|2007608_2008691_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.4	4.5e-73
WP_080963651.1|2008683_2009244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771345.1|2009234_2010539_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_144420704.1|2010592_2011621_-	chorismate mutase	NA	NA	NA	NA	NA
WP_027242785.1|2011639_2012656_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_051929892.1|2013088_2016211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929877.1|2016607_2017231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378208.1|2018013_2019564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378207.1|2019858_2020614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2021322_2022297_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378201.1|2025205_2025877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2026955_2028359_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242788.1|2029946_2033348_-	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_017378193.1|2033344_2036038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378192.1|2036341_2037841_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_027242789.1|2038507_2039329_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_017378190.1|2039400_2039892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2040034_2041438_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378188.1|2041434_2042505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242790.1|2042750_2044925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|2044947_2045628_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_036774233.1|2045656_2045890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2045942_2046170_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 21
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	2057206	2108283	3167361	transposase	Acinetobacter_phage(27.27%)	46	NA	NA
WP_075275340.1|2057206_2057815_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|2058345_2059221_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929548.1|2059461_2060136_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999996.1|2060164_2060653_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_080999997.1|2061698_2062133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2062338_2063742_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927811.1|2063989_2065501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876046.1|2066461_2066755_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_144420706.1|2066712_2067291_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876047.1|2067376_2068252_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378015.1|2068244_2068601_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_017378014.1|2068609_2069005_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_082300708.1|2070329_2070890_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046583.1|2072012_2073914_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_027243106.1|2073936_2075142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155601402.1|2075144_2076419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155051397.1|2076399_2077539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243103.1|2077672_2078473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377848.1|2078469_2078868_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_027243102.1|2078864_2079173_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|2079566_2080295_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377851.1|2080335_2080980_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_062312172.1|2081096_2081462_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|2081516_2082491_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963625.1|2082520_2083138_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|2083116_2083578_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_017377856.1|2083621_2084557_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377857.1|2084584_2085580_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377858.1|2085823_2086786_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377694.1|2088213_2088942_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_080963626.1|2088992_2090627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|2090897_2092085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377863.1|2092686_2093124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|2095657_2095930_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_036772457.1|2096005_2096314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772454.1|2098789_2099107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2099263_2100238_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420708.1|2100234_2100624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876052.1|2100704_2101451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|2101419_2102148_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017377223.1|2102892_2103180_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2103239_2103404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2103400_2104804_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420658.1|2104836_2105598_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_017376296.1|2105883_2106600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|2107377_2108283_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	2123446	2184304	3167361	protease,tRNA,transposase	Burkholderia_virus(20.0%)	55	NA	NA
WP_036771957.1|2123446_2124418_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080963609.1|2126605_2127772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|2128111_2128423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046580.1|2128900_2129143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242870.1|2129527_2130058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|2130504_2131434_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_144420711.1|2131590_2132016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2132132_2132360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2132513_2133488_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999998.1|2133754_2134024_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420803.1|2134168_2135125_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963583.1|2135285_2136212_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242871.1|2136507_2137269_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211971.1|2137470_2138082_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_051929560.1|2138102_2139302_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_017377024.1|2139396_2139537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|2139549_2139954_-	SufE family protein	NA	NA	NA	NA	NA
WP_017377022.1|2140184_2140754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377021.1|2140820_2141861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2141887_2142115_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027242872.1|2143165_2144023_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_144420712.1|2144019_2144781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242873.1|2144865_2147595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|2147728_2148604_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_065653747.1|2148868_2150209_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209885.1|2150271_2150985_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027242875.1|2151153_2151645_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_017377014.1|2151784_2152276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242876.1|2152478_2153369_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_026063591.1|2153753_2154338_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242877.1|2154418_2155357_-	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_036771855.1|2155408_2156503_-	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_047927528.1|2156627_2157950_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_053856760.1|2157997_2162884_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_017377007.1|2162978_2163281_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_027242879.1|2163391_2165314_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_027242880.1|2165335_2166631_+	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_017377006.1|2166627_2168238_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_052106204.1|2168344_2169238_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377003.1|2169347_2169971_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_017377001.1|2170677_2171376_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377000.1|2171519_2172089_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_026063589.1|2172404_2173031_-	porin family protein	NA	NA	NA	NA	NA
WP_017376998.1|2173227_2173974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376997.1|2174069_2174909_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_016210463.1|2174959_2175307_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376996.1|2175497_2176385_+	ROK family protein	NA	NA	NA	NA	NA
WP_017376995.1|2176499_2177102_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_080963631.1|2177888_2179601_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376991.1|2179748_2181686_+	AsmA family protein	NA	NA	NA	NA	NA
WP_027242882.1|2181798_2182848_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376990.1|2182847_2183123_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_017376989.1|2183203_2183752_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_016210338.1|2183871_2184009_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2184076_2184304_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 23
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	2209198	2253493	3167361	transposase	Staphylococcus_phage(50.0%)	41	NA	NA
WP_036771330.1|2209198_2210173_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046579.1|2210488_2210650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2210646_2212050_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|2212163_2212931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2213289_2214693_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963604.1|2215513_2215714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377826.1|2215954_2217400_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875904.1|2218595_2219471_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243174.1|2220922_2221204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046578.1|2221422_2221602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927196.1|2221761_2222781_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_017376520.1|2222767_2223190_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_017376521.1|2223191_2223665_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376522.1|2223790_2224447_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376523.1|2224443_2225118_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376524.1|2225123_2226272_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376525.1|2226268_2226730_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376526.1|2226805_2228056_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376527.1|2228182_2229862_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_027243172.1|2229973_2230855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772261.1|2231956_2232550_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075275347.1|2232911_2233427_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|2234366_2234651_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420804.1|2235200_2235476_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2235848_2236823_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242983.1|2236979_2237618_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_017377745.1|2237699_2238098_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377746.1|2238250_2238568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377747.1|2238646_2238901_-	LapA family protein	NA	NA	NA	NA	NA
WP_017377748.1|2239053_2240715_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_017377749.1|2240775_2241459_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_036773645.1|2241458_2242544_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_036773644.1|2242585_2245222_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	1.5e-98
WP_155046577.1|2246183_2246345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377754.1|2247026_2248346_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|2248349_2249066_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377756.1|2249062_2249704_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_144420715.1|2249696_2249831_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242981.1|2250079_2250535_-	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_027242980.1|2250626_2250971_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048876031.1|2252089_2253493_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	2308413	2355121	3167361	tRNA,transposase	Synechococcus_phage(20.0%)	41	NA	NA
WP_048875859.1|2308413_2309208_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036773621.1|2309497_2310421_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_017377984.1|2310688_2310982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377983.1|2312184_2313108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377982.1|2313243_2314086_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_017377981.1|2314173_2314824_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.6	2.7e-20
WP_017377980.1|2314837_2315878_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	45.3	2.9e-69
WP_036773623.1|2316000_2317086_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_027243121.1|2317112_2318222_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377976.1|2318526_2318844_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377975.1|2318840_2319200_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377974.1|2319302_2322035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081000000.1|2323524_2324202_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_144420807.1|2324448_2324667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|2324811_2326020_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_065653755.1|2326447_2327905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|2328740_2329016_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773050.1|2331719_2331899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063690.1|2331895_2332267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|2332277_2333360_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420718.1|2333356_2333578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|2334563_2334782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|2335272_2335539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420719.1|2335797_2336118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243154.1|2337503_2338754_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377905.1|2338742_2339624_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_017377906.1|2339616_2340702_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377907.1|2340698_2341958_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377908.1|2342126_2342786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065653730.1|2342956_2343619_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_026063691.1|2343965_2344913_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_017377911.1|2345009_2345636_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_017377912.1|2345641_2346223_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377913.1|2346294_2347386_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377914.1|2347475_2348189_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_027243155.1|2348282_2349107_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_144420808.1|2349340_2350018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377920.1|2351695_2351953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2352353_2353328_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048876067.1|2353502_2354147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046574.1|2354326_2355121_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	2360816	2397095	3167361	protease,transposase	Acinetobacter_phage(25.0%)	34	NA	NA
WP_087910651.1|2360816_2360993_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_053856762.1|2361288_2361723_-	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_017377929.1|2361916_2363386_-	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_027243054.1|2363379_2364756_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377930.1|2364768_2365161_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_017377931.1|2365157_2366261_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_144420809.1|2366439_2367732_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377933.1|2367742_2368690_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_027243055.1|2368701_2369514_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_087910662.1|2369516_2370296_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017377934.1|2370310_2371369_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_017377935.1|2371365_2372376_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209904.1|2372382_2372580_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_048876070.1|2372640_2375547_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_017377937.1|2375588_2376440_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_144420810.1|2376522_2377068_-	chorismate lyase	NA	NA	NA	NA	NA
WP_027243057.1|2377165_2378026_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_155048031.1|2378168_2378534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377942.1|2378615_2379122_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_027243059.1|2379167_2382119_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_017377945.1|2382140_2382473_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	4.7e-05
WP_047927125.1|2382590_2383100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046571.1|2383633_2383789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774650.1|2384863_2386030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377687.1|2386174_2386927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2387282_2388257_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016209908.1|2388389_2389100_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_017377690.1|2389096_2390131_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_017377691.1|2390234_2390576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876071.1|2391086_2392247_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_069971647.1|2392215_2392812_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046570.1|2393780_2393951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2393947_2394922_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_087910645.1|2395941_2397095_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
>prophage 26
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	2442243	2507865	3167361	plate,tRNA,transposase	Staphylococcus_phage(18.18%)	57	NA	NA
WP_027242858.1|2442243_2443551_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_027242859.1|2443555_2444266_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242860.1|2444278_2447449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|2447515_2448652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376336.1|2449514_2450372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376335.1|2450513_2451314_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376334.1|2451412_2451988_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_027242862.1|2452070_2452742_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_027242863.1|2452787_2453687_+	DUF3530 family protein	NA	NA	NA	NA	NA
WP_017376331.1|2453721_2454105_-	response regulator	NA	NA	NA	NA	NA
WP_155601403.1|2454255_2454375_-	molecular chaperone DnaJ	NA	NA	NA	NA	NA
WP_062312176.1|2454355_2454631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312179.1|2454611_2455022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376328.1|2455723_2456749_-	phosphotransferase	NA	NA	NA	NA	NA
WP_048876074.1|2456879_2459384_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376325.1|2459390_2460659_+	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_017376324.1|2460660_2461644_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376323.1|2461656_2462478_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376322.1|2462522_2462915_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376321.1|2462989_2463796_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_036774104.1|2463983_2464412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2464470_2465445_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375660.1|2465468_2465906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2465940_2467344_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376011.1|2467924_2468086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376015.1|2469306_2469678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242569.1|2469785_2471336_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376017.1|2471368_2472208_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017376018.1|2472204_2472720_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376019.1|2472723_2473716_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376020.1|2474094_2475465_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_027242570.1|2475673_2476813_+	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_075275355.1|2477026_2478001_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_036816881.1|2478024_2478243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376024.1|2478320_2478569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|2484224_2484905_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376634.1|2484969_2486256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376633.1|2486857_2487127_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_144420813.1|2487310_2488282_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376631.1|2488349_2489324_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_017376630.1|2489421_2490498_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_144420721.1|2490578_2491571_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_036772145.1|2491575_2493378_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027243118.1|2494714_2495998_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_017376625.1|2496130_2496523_+	RidA family protein	NA	NA	NA	NA	NA
WP_017376624.1|2496629_2497715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376623.1|2497930_2498947_-	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376622.1|2498949_2499957_-	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_026063550.1|2499960_2501115_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_016209558.1|2501129_2501492_-	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_027243117.1|2501488_2503204_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_026063546.1|2503303_2503978_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2504006_2504411_+	RidA family protein	NA	NA	NA	NA	NA
WP_017376618.1|2504435_2504576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376616.1|2505529_2506312_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275357.1|2506413_2507373_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376613.1|2507517_2507865_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	2511866	2575639	3167361	transposase	Planktothrix_phage(10.0%)	53	NA	NA
WP_144420814.1|2511866_2512784_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875883.1|2512928_2513465_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929685.1|2513724_2514627_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376607.1|2515616_2516606_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_017376606.1|2516774_2517113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|2517109_2517685_+	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376604.1|2517733_2517949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|2518135_2518975_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376601.1|2522671_2523580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875882.1|2523710_2524367_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856764.1|2524475_2525402_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772137.1|2525720_2526281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377036.1|2526750_2528070_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_017377037.1|2528137_2529004_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_036772169.1|2528996_2529872_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377039.1|2529930_2530149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377041.1|2531549_2531879_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_026063593.1|2532113_2532818_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377043.1|2532798_2535027_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_017377044.1|2535289_2536303_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377045.1|2536411_2536633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377046.1|2536637_2538275_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377047.1|2538413_2538947_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377048.1|2539067_2540186_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_027242608.1|2540178_2541501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|2541487_2542624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|2542854_2543280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242609.1|2546609_2546963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2546997_2547873_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929903.1|2548029_2548434_-	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_051929897.1|2548581_2549757_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_027242610.1|2550016_2550520_-	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_017377059.1|2550559_2552044_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_017377060.1|2552267_2553221_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_027242611.1|2553201_2554293_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_027242612.1|2554595_2554838_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_155048025.1|2555738_2555924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|2555905_2556481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420722.1|2556597_2556780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377065.1|2557355_2557628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|2557780_2558035_-	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_027242613.1|2558149_2559553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|2559637_2560144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|2560708_2562529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|2562595_2563126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774569.1|2564672_2565389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774567.1|2565431_2565869_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017377073.1|2565906_2567286_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377074.1|2567680_2569675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377075.1|2570139_2570952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|2571135_2572599_-	nuclease	NA	NA	NA	NA	NA
WP_017377077.1|2572958_2574338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772726.1|2575090_2575639_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
>prophage 28
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	2607430	2650789	3167361	transposase	Staphylococcus_phage(22.22%)	43	NA	NA
WP_036773116.1|2607430_2608405_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971661.1|2608401_2608839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|2609013_2610417_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377105.1|2610427_2610703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377106.1|2610980_2611451_-	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377107.1|2611753_2613124_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_075275363.1|2613453_2613921_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377110.1|2613933_2614944_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_017375571.1|2615145_2615547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312182.1|2615528_2616548_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242632.1|2616974_2617763_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047927448.1|2617749_2618778_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_017377113.1|2618755_2619160_-	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_017377115.1|2619387_2621355_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377116.1|2621550_2622042_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_026063598.1|2622076_2622919_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377118.1|2622964_2623417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377119.1|2623706_2624339_+	LysE family translocator	NA	NA	NA	NA	NA
WP_017377120.1|2624339_2625590_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_027242633.1|2625623_2626721_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_144420723.1|2627050_2628436_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|2628475_2628733_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048876012.1|2631148_2632552_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375801.1|2632548_2633589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927106.1|2633981_2634377_+	YchJ family protein	NA	NA	NA	NA	NA
WP_144420816.1|2634373_2635162_-	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_017375804.1|2635347_2636073_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017375805.1|2636317_2637505_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375806.1|2637797_2638340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375807.1|2638336_2639023_-	acireductone synthase	NA	NA	NA	NA	NA
WP_017375808.1|2639026_2639638_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375809.1|2639684_2640704_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375810.1|2640806_2641601_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375811.1|2641614_2642415_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375812.1|2642493_2643543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063478.1|2643718_2644999_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_027242634.1|2645044_2645722_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_017375815.1|2645807_2646089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275366.1|2646180_2647035_-	MFS transporter	NA	NA	NA	NA	NA
WP_026063480.1|2646974_2647373_-	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_027242636.1|2647900_2648842_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017375821.1|2649560_2649782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|2649778_2650789_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	2703484	2739424	3167361	transposase	Staphylococcus_phage(16.67%)	32	NA	NA
WP_048876031.1|2703484_2704888_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377364.1|2705007_2705844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2705993_2706968_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242659.1|2707276_2708302_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	76.9	2.0e-17
WP_087910663.1|2708409_2709612_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	1.7e-36
WP_017377360.1|2709849_2710263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063625.1|2710368_2710746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377358.1|2710764_2711334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377357.1|2711336_2711675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377356.1|2711667_2712201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377355.1|2712219_2712510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242660.1|2712596_2714228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377353.1|2714780_2715284_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	41.2	1.9e-13
WP_017377352.1|2715246_2715954_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_017377351.1|2716018_2716879_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_017377350.1|2716859_2717633_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377349.1|2717663_2718902_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_036773024.1|2718901_2719864_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_017377348.1|2719907_2720660_+	ComF family protein	NA	NA	NA	NA	NA
WP_017377345.1|2723188_2723425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420819.1|2723443_2723893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377343.1|2724113_2725538_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.0e-16
WP_052106221.1|2725602_2726652_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_036818827.1|2726942_2727674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420730.1|2727704_2728595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377336.1|2729937_2732748_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_048875864.1|2733040_2734066_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080963630.1|2734449_2735307_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_017377694.1|2735476_2736205_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_048876012.1|2736405_2737809_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|2737954_2738452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|2738521_2739424_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	2762633	2802853	3167361	tRNA,protease,transposase	Staphylococcus_phage(42.86%)	44	NA	NA
WP_069971662.1|2762633_2763608_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_027242664.1|2763891_2765094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929598.1|2765390_2765648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|2765605_2766046_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_053856769.1|2766151_2766718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875862.1|2766862_2767117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875861.1|2767261_2768131_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774534.1|2768135_2768561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063584.1|2768652_2769612_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_017376953.1|2769608_2770256_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_017376954.1|2770284_2771136_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376955.1|2771150_2772428_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376956.1|2772468_2772984_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376957.1|2773061_2774123_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_017376959.1|2775279_2777115_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2777157_2777628_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2777664_2778000_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080963574.1|2778012_2778729_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_036772771.1|2778665_2779706_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_017376963.1|2779678_2780158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376964.1|2780244_2782725_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_036772765.1|2782787_2783219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376966.1|2783419_2783710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242666.1|2783769_2785368_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	7.1e-06
WP_017376969.1|2785532_2785868_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_017376970.1|2785896_2787561_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.8	6.4e-34
WP_027242667.1|2787560_2788202_-	lipoprotein	NA	NA	NA	NA	NA
WP_017376972.1|2788201_2788945_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_017376973.1|2789003_2789240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376974.1|2789390_2790758_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_017376975.1|2790768_2791320_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_065653729.1|2791400_2792504_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376977.1|2792505_2794263_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_062312189.1|2794485_2795109_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|2795163_2795583_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_047927116.1|2795723_2796338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000001.1|2796395_2797181_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376980.1|2797814_2798831_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_144420820.1|2798833_2799346_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_017376982.1|2799387_2799861_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_048875860.1|2799916_2800702_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_036771653.1|2800745_2801486_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
WP_017376985.1|2801575_2801824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|2802199_2802853_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	2868936	2923561	3167361	tRNA,protease,transposase	Staphylococcus_phage(28.57%)	57	NA	NA
WP_036771330.1|2868936_2869911_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771442.1|2869930_2870716_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017378082.1|2870732_2871086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378083.1|2871115_2871694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242676.1|2871811_2872573_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_048875857.1|2872811_2873786_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378088.1|2873889_2874246_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_017378089.1|2874235_2874952_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017378090.1|2874959_2875445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062312192.1|2875603_2876527_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	2.1e-26
WP_017378092.1|2876681_2877146_+	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_062312195.1|2877649_2878993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081323804.1|2879034_2879469_-	transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_062312201.1|2879401_2879998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378095.1|2880192_2881602_+	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	30.0	7.6e-28
WP_017378096.1|2881598_2882096_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4VNV0	Pandoravirus	32.9	9.2e-13
WP_017378097.1|2882292_2883471_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_017378098.1|2883554_2884307_+	acetoacetyl-CoA reductase	NA	NA	NA	NA	NA
WP_017378099.1|2884414_2884930_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_017378100.1|2885060_2885471_+	phasin family protein	NA	NA	NA	NA	NA
WP_027242678.1|2885610_2885958_+	phasin family protein	NA	NA	NA	NA	NA
WP_017378103.1|2886023_2887091_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017378104.1|2887084_2887603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378105.1|2887698_2889870_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_016209298.1|2889937_2890204_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_017378106.1|2890267_2891212_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_017378107.1|2891211_2891565_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_017378108.1|2891613_2894289_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.1	1.3e-25
WP_017378109.1|2894305_2895823_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_016209273.1|2895899_2896352_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_017378110.1|2896570_2898010_-	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_017378111.1|2898009_2899548_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_017378112.1|2899562_2901533_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_016209309.1|2901536_2901842_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_017378113.1|2901865_2902489_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_017378114.1|2902508_2902997_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_027242679.1|2903010_2904036_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_017378117.1|2904040_2906434_-	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_016209307.1|2906483_2907773_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_017378118.1|2907779_2908280_-	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_017378119.1|2908279_2909533_-	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_017378120.1|2909534_2910212_-	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_016209262.1|2910229_2910715_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_016209283.1|2910705_2911074_-	NADH-ubiquinone/plastoquinone oxidoreductase chain 3	NA	NA	NA	NA	NA
WP_017378122.1|2911752_2912115_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_017378123.1|2912128_2912890_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_017378124.1|2913191_2914538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771461.1|2914634_2915177_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	NA	NA	NA	NA
WP_017378126.1|2915292_2916126_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_027242680.1|2916147_2916741_+	thymidine kinase	NA	A0A0B7MRR0	Enterobacteria_phage	53.6	6.4e-53
WP_048875856.1|2916916_2917936_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375571.1|2918206_2918608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378129.1|2918618_2918942_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_065653735.1|2918965_2919976_-	lipase	NA	NA	NA	NA	NA
WP_017378132.1|2920042_2920891_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_026063707.1|2921007_2921919_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_036772169.1|2922685_2923561_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	2929640	2977750	3167361	transposase	Erwinia_phage(18.18%)	40	NA	NA
WP_036773116.1|2929640_2930615_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017378141.1|2930673_2931726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378142.1|2932044_2933010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378143.1|2933312_2934137_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378144.1|2934338_2935415_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378145.1|2935499_2936486_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378146.1|2936504_2937149_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_027242684.1|2937160_2938270_+	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_027242685.1|2938336_2938999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242686.1|2939258_2941142_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_017378149.1|2941455_2942955_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_017378150.1|2943045_2943828_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378151.1|2943955_2944876_+	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378152.1|2944899_2945358_+	NfeD family protein	NA	NA	NA	NA	NA
WP_017378154.1|2946387_2947653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2947840_2948716_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|2948914_2949106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|2949310_2950606_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275379.1|2950925_2951144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375941.1|2951180_2952560_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_017375942.1|2952587_2953046_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_036773720.1|2953023_2954241_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375944.1|2954433_2954670_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2954683_2954839_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375945.1|2954919_2955882_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375947.1|2956041_2957358_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375948.1|2957367_2958036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|2958446_2960261_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_144420736.1|2960976_2961162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375951.1|2961343_2961802_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|2962520_2963396_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420737.1|2963627_2964026_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081000012.1|2964029_2964272_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375794.1|2965161_2966913_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017375795.1|2966923_2967724_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375796.1|2967826_2968315_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_047927156.1|2968814_2969738_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375799.1|2969834_2970179_+	DMT family protein	NA	NA	NA	NA	NA
WP_017377528.1|2975873_2976836_-	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_036772663.1|2976874_2977750_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP013944	Piscirickettsia salmonis strain PSCGR01, complete genome	3167361	3072544	3106943	3167361	tRNA,transposase	Staphylococcus_phage(50.0%)	31	NA	NA
WP_017376171.1|3072544_3073519_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046560.1|3073785_3073959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|3074064_3075468_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875844.1|3075472_3076492_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275373.1|3077108_3077438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378398.1|3077663_3078062_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_017378399.1|3078929_3079880_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378400.1|3079879_3081958_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378401.1|3082099_3082615_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378402.1|3082623_3083187_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378403.1|3083167_3083914_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378404.1|3084052_3084505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927132.1|3084640_3085477_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_027242707.1|3085473_3086370_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017378407.1|3086402_3087470_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_080963575.1|3088170_3089622_-	potassium transporter	NA	NA	NA	NA	NA
WP_017378410.1|3089628_3091008_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_036773239.1|3091048_3092362_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_026063734.1|3092351_3093326_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_017378413.1|3093419_3093923_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_017378414.1|3094057_3095209_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3095205_3095685_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_027242705.1|3095831_3098153_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_080963576.1|3098097_3098724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378416.1|3098728_3099628_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_036773242.1|3099815_3100370_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|3100409_3101384_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|3101973_3102351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|3103085_3104060_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036773655.1|3104620_3105025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856772.1|3105491_3106943_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP013946	Piscirickettsia salmonis strain PSCGR01 plasmid pPsCRG01-1, complete sequence	179831	1736	67874	179831	integrase,transposase,portal	Streptococcus_phage(35.71%)	57	15514:15573	67908:68422
WP_036771347.1|1736_2714_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_053093683.1|3714_3927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|4084_5062_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_144420843.1|5180_7064_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_047927782.1|7859_8249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|8164_9142_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_048876196.1|9171_10320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243215.1|12133_13156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774350.1|13638_14367_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
15514:15573	attL	CGTATAGCGAAAATCTCGGGGGATTGCCCCCGTGATGGGCATTGTGGTTCTGTCGCAATT	NA	NA	NA	NA
WP_048876194.1|15606_16140_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_080963665.1|16320_16662_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_080963664.1|16842_17109_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_027243206.1|17181_19047_-	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_047927778.1|19214_19499_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|19842_20571_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046637.1|20652_21144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|21876_22104_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876191.1|23655_24084_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_081000015.1|24019_24406_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|24435_25164_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|25175_25325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|25571_26300_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036774388.1|27677_28640_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027242592.1|28663_28993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|29059_30100_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_144420833.1|30113_30305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774378.1|30509_31079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774316.1|31121_31421_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155046638.1|31417_31882_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036774373.1|32155_32884_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_048876188.1|33057_33831_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_027243202.1|34544_35480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|35754_36483_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046639.1|36648_36852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929623.1|36951_40293_+	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_036772541.1|40450_41179_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_144420834.1|41472_41868_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036815648.1|41920_42649_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772541.1|43132_43861_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_027243197.1|44031_44601_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_087910667.1|44605_45289_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_036772541.1|45440_46169_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_080963627.1|46187_46406_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774644.1|47385_48447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|48955_49702_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_027243200.1|49702_50107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|50413_51388_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_036771293.1|51927_52194_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772437.1|52489_54388_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_048876182.1|54743_56639_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017375632.1|57338_57674_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017375836.1|57868_58072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243203.1|58165_58960_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
WP_080999971.1|63136_64540_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000017.1|64804_65056_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_048875857.1|65456_66431_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	2.2e-26
WP_048876221.1|67418_67874_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
67908:68422	attR	AATTGCGACAGAACCACAATGCCCATCACGGGGGCAATCCCCCGAGATTTTCGCTATACGGTTAAAAAATAATTTTTTCTTTAGAAAAGAAATTATTATTGCTAACTACTCTAAAGTCATAATAATGACCGTACATTCCTCCACCATTATCTCCCTGTCTATGAGCTAAATATGCAGGATCTTCTGCTTTTGCACTTTTATCGATTTTTTGACATATTTTATCAATAGCGTTCATTTGACTTTGACTAACATCATAATAGTTATCTTTGCCTCCAACATTATTTATATAAATAACATTTACAAGGCGAGCTGGATGATATGCACATGTGAAGCCTTCAGGTGCTTGTCCATCAGAACATCGCGCTGAATAATAAGATGTTTGATCAAAAGGATCTCCTCCTCCTTCAGGATAGACTTTATGCGTTGCTCCTCCACAAACAATCCAAGGACTCCAGGCAACTGCCCAGCCACTTGATATAACACTTAACACAATCACTCCAATAGTTTTTTTTATA	NA	NA	NA	NA
>prophage 2
NZ_CP013946	Piscirickettsia salmonis strain PSCGR01 plasmid pPsCRG01-1, complete sequence	179831	72592	128586	179831	transposase	Streptococcus_phage(56.52%)	57	NA	NA
WP_017377509.1|72592_73321_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_144420837.1|73462_74395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377511.1|74424_75153_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|75155_75428_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|76278_77007_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420838.1|77062_77683_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|78831_79560_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420839.1|79755_80682_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377667.1|81351_81522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619477.1|81666_81960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036815609.1|83824_84280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816769.1|84523_84922_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_047927763.1|84918_85182_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243210.1|85595_86330_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.9e-36
WP_017377525.1|88209_89007_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_075275471.1|89547_90522_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.3e-26
WP_155046640.1|91157_91325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876214.1|91293_92022_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.1e-38
WP_017377521.1|92530_92884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|93811_94540_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243190.1|95122_98467_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_048876213.1|98775_99666_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275473.1|100904_101081_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_027243191.1|101197_101905_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_048876212.1|101858_102737_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_027243193.1|102767_103310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876211.1|103581_104286_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_036772541.1|104297_105026_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929563.1|105055_105445_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|105467_106196_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|106198_106807_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
WP_155046641.1|106987_107152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420841.1|107178_107403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243184.1|107395_107734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133264.1|107747_108152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375840.1|108196_108415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275474.1|109383_110496_+	replication initiation protein	NA	A0A218MNI2	uncultured_virus	29.8	2.1e-25
WP_017377655.1|110837_111083_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|111079_111466_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_036772434.1|111553_112282_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_080963659.1|112260_112881_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377658.1|113226_113913_+	Fic family protein	NA	NA	NA	NA	NA
WP_082304501.1|114862_115225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|115227_116967_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046629.1|117368_117521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929558.1|117548_118232_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_036771347.1|118313_119291_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_081000019.1|119366_119537_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|119577_120306_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
WP_036771293.1|120851_121118_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772437.1|121413_123312_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017377694.1|123733_124462_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_080999960.1|124529_124682_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046630.1|125098_125263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375754.1|125283_126570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771359.1|126752_127481_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_036771347.1|127608_128586_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
>prophage 3
NZ_CP013946	Piscirickettsia salmonis strain PSCGR01 plasmid pPsCRG01-1, complete sequence	179831	163497	168428	179831	transposase,terminase,portal	Streptococcus_phage(42.86%)	7	NA	NA
WP_027242929.1|163497_163881_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|163967_164450_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_048876205.1|164452_165784_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_047927581.1|165988_166423_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_087910668.1|166509_166896_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|166933_167668_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|167714_168428_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
>prophage 1
NZ_CP013947	Piscirickettsia salmonis strain PSCGR01 plasmid pPsCRG01-2, complete sequence	33556	2595	16033	33556	terminase,transposase,capsid,tail,head	unidentified_phage(33.33%)	18	NA	NA
WP_016211078.1|2595_2949_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_081323805.1|3125_4100_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.4	3.7e-26
WP_027242954.1|4632_4998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242953.1|5142_5397_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_080963620.1|5380_5737_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_036771330.1|5834_6809_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242951.1|7434_8301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242950.1|8513_8897_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242949.1|8983_9466_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242948.1|9468_9654_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_036771330.1|9673_10648_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_075275490.1|10744_11137_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_027242946.1|11172_11754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|12134_13109_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_144420855.1|13182_13398_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_027242945.1|14201_14717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242944.1|15062_15620_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242943.1|15616_16033_+	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
>prophage 1
NZ_CP013948	Piscirickettsia salmonis strain PSCGR01 plasmid pPsCRG01-3, complete sequence	51569	7327	21123	51569	head,transposase,capsid,tail	Moraxella_phage(18.18%)	18	NA	NA
WP_036771639.1|7327_8302_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_075275454.1|8351_8891_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_027242598.1|8904_9489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375778.1|9873_10185_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_017375779.1|10181_10607_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375780.1|10785_11181_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375781.1|11177_11528_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375782.1|11527_11950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375783.1|11951_12275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375784.1|12331_12598_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_036771950.1|12601_14680_+|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375786.1|14672_15014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375787.1|15010_15682_+|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_144420832.1|15611_16397_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375789.1|16386_16944_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_027242568.1|16940_19631_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375652.1|19689_20118_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|20145_21123_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
