The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008865	Pseudomonas aeruginosa strain S86968 chromosome, complete genome	6934277	650655	703435	6934277	plate,tRNA,tail	uncultured_Caudovirales_phage(28.0%)	55	NA	NA
WP_009875776.1|650655_651681_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	8.3e-109
WP_016852408.1|651759_652329_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|652412_652766_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003099585.1|652756_653299_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003099584.1|653271_654504_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	2.6e-77
WP_016252919.1|654547_655054_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|655147_656701_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|656697_657969_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|658069_659992_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|660270_660603_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003121837.1|660646_661498_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003085085.1|661497_661878_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003161932.1|661914_662721_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003459378.1|662836_663823_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|663819_665112_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_016852409.1|665092_667882_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_003099554.1|668008_669025_+	phosphotransferase	NA	NA	NA	NA	NA
WP_016852410.1|669021_669696_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_016852411.1|669697_670456_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_012613533.1|670456_671518_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
WP_009875783.1|671669_674063_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003085103.1|674108_674741_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|674869_675904_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|676137_677247_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003099539.1|677302_678349_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003109044.1|678463_679711_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003099535.1|679816_680647_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|680770_681445_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003099532.1|681444_682263_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_016852412.1|682335_683814_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003121843.1|684131_684446_-	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
WP_003113202.1|684545_685316_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
WP_003085132.1|685773_685974_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003459419.1|686021_686381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118908.1|686743_687193_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003101620.1|687214_687730_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	1.8e-32
WP_016852413.1|687726_688284_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	70.3	1.3e-44
WP_003085143.1|688436_688763_+	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_003161928.1|688759_689647_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	4.1e-88
WP_003118911.1|689639_690173_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	3.9e-62
WP_003161927.1|690174_692280_+|tail	phage tail protein	tail	Q9ZXK6	Pseudomonas_virus	52.7	3.0e-222
WP_016852415.1|692287_692728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003121848.1|692770_693931_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	1.2e-188
WP_016852416.1|693943_694447_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	72.8	1.8e-64
WP_003085178.1|694461_694806_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_019416282.1|694975_697213_+|tail	phage tail length tape measure protein	tail	NA	NA	NA	NA
WP_003113194.1|697222_698095_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.4	2.5e-74
WP_003101635.1|698069_698276_+|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_003113193.1|698333_699323_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	7.5e-107
WP_003113192.1|699355_699985_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	1.6e-86
WP_003121852.1|699981_700344_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	4.2e-15
WP_003118919.1|700340_700598_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003113175.1|700945_701551_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	4.6e-75
WP_003085203.1|701552_702602_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085205.1|702598_703435_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
>prophage 2
NZ_CP008865	Pseudomonas aeruginosa strain S86968 chromosome, complete genome	6934277	883957	925222	6934277	lysis,terminase,protease,integrase,tRNA,holin,portal	Pseudomonas_phage(92.31%)	59	879655:879672	916690:916707
879655:879672	attL	CGCTGCTGCAACTGGTCC	NA	NA	NA	NA
WP_059319210.1|883957_885007_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	53.7	7.7e-102
WP_003158850.1|885006_885249_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	60.3	1.1e-16
WP_033977737.1|885232_885589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059319188.1|885593_886283_-	hypothetical protein	NA	A0A0A0YUE3	Pseudomonas_phage	95.2	1.4e-120
WP_003085682.1|886279_886471_-	hypothetical protein	NA	A0A0A0YQ21	Pseudomonas_phage	100.0	9.2e-30
WP_186291206.1|886597_887893_-	hypothetical protein	NA	A0A0A0YUE9	Pseudomonas_phage	85.5	5.1e-55
WP_023101751.1|887967_888753_-	hypothetical protein	NA	A0A1W6JTB0	Pseudomonas_phage	94.7	4.8e-141
WP_023101752.1|888763_889054_-	hypothetical protein	NA	A0A1W6JTA7	Pseudomonas_phage	96.9	1.8e-45
WP_023101753.1|889064_889448_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JTA9	Pseudomonas_phage	98.4	1.1e-58
WP_065427460.1|889768_890128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031642139.1|890124_890418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023101755.1|890530_891304_-	helix-turn-helix transcriptional regulator	NA	A0A2K8HKD5	Pseudomonas_phage	77.7	3.9e-79
WP_049306316.1|891392_891731_+	hypothetical protein	NA	A0A1W6JTD1	Pseudomonas_phage	49.4	2.5e-09
WP_031642140.1|891727_892120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124202346.1|892425_892743_+	hypothetical protein	NA	A0A1W6JTB5	Pseudomonas_phage	71.4	7.1e-35
WP_031642681.1|892739_893018_+	hypothetical protein	NA	A0A1W6JTC3	Pseudomonas_phage	95.7	1.4e-39
WP_031642682.1|893014_893323_+	hypothetical protein	NA	A0A1W6JTC0	Pseudomonas_phage	98.0	9.3e-48
WP_023083810.1|893319_893598_+	hypothetical protein	NA	A0A0A0YR77	Pseudomonas_phage	78.3	2.1e-30
WP_059319189.1|893590_893824_+	hypothetical protein	NA	A0A0A0YRU7	Pseudomonas_phage	97.4	9.8e-34
WP_185838774.1|893820_894312_+	hypothetical protein	NA	A0A0A0YUG0	Pseudomonas_phage	96.3	1.0e-85
WP_003119037.1|894308_895073_+	hypothetical protein	NA	A0A0A0YQ39	Pseudomonas_phage	35.6	3.0e-23
WP_019486509.1|895069_895426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055327983.1|895560_895878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019486507.1|895874_896300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003119041.1|897396_899208_+	AAA family ATPase	NA	A0A0U4B0G9	Pseudomonas_phage	70.1	1.8e-260
WP_059319190.1|899204_899489_+	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	98.9	5.4e-42
WP_015980945.1|899485_900043_+	hypothetical protein	NA	A0A0A0YRV6	Pseudomonas_phage	98.6	3.8e-76
WP_015980946.1|900455_900986_+	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	37.9	7.0e-27
WP_015649339.1|901069_901384_+|holin	phage holin, lambda family	holin	A0A0A0YUH2	Pseudomonas_phage	100.0	5.7e-53
WP_059319191.1|901383_902001_+	glycoside hydrolase family 19 protein	NA	A0A1B0Z086	Pseudomonas_phage	94.1	7.2e-108
WP_019486502.1|901997_902240_+	hypothetical protein	NA	A0A0H5AWC3	Pseudomonas_phage	53.2	2.9e-20
WP_031637954.1|902236_902707_+|lysis	lysis protein	lysis	A0A1B0Z001	Pseudomonas_phage	91.7	2.4e-71
WP_019396612.1|902703_903447_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	99.2	8.3e-135
WP_023083814.1|903566_904112_+|terminase	terminase small subunit	terminase	A0A1B0Z033	Pseudomonas_phage	86.7	3.4e-85
WP_023124265.1|904083_906048_+|terminase	phage terminase large subunit family protein	terminase	A0A1B0Z2K0	Pseudomonas_phage	90.8	0.0e+00
WP_003159069.1|906038_906254_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	100.0	6.5e-32
WP_019486499.1|906253_907900_+|portal	phage portal protein	portal	A0A1W6JTB6	Pseudomonas_phage	99.8	0.0e+00
WP_113774872.1|907859_909953_+|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	97.8	0.0e+00
WP_023110592.1|910019_910337_+	DUF2190 family protein	NA	A0A1B0YZT7	Pseudomonas_phage	100.0	1.6e-50
WP_010791970.1|910333_910663_+	hypothetical protein	NA	A0A1W6JT71	Pseudomonas_phage	100.0	3.1e-57
WP_023083801.1|910659_911130_+	hypothetical protein	NA	A0A1W6JT75	Pseudomonas_phage	100.0	1.8e-87
WP_003129703.1|911133_911328_+	hypothetical protein	NA	A0A1W6JT79	Pseudomonas_phage	93.8	2.8e-26
WP_021205304.1|911329_912082_+	hypothetical protein	NA	A0A1B0YZT8	Pseudomonas_phage	99.2	9.0e-137
WP_023114589.1|912163_912805_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	A0A1W6JT76	Pseudomonas_phage	93.9	6.8e-109
WP_019396608.1|912866_913169_+	hypothetical protein	NA	A0A1W6JT80	Pseudomonas_phage	100.0	4.1e-48
WP_023114588.1|913271_915755_+	tape measure protein	NA	A0A1B0YZV6	Pseudomonas_phage	98.5	0.0e+00
WP_023114587.1|915794_916316_+	hypothetical protein	NA	A0A1W6JT98	Pseudomonas_phage	99.4	4.4e-98
WP_023114586.1|916315_918025_+	hypothetical protein	NA	A0A1W6JTA3	Pseudomonas_phage	88.9	8.5e-300
916690:916707	attR	GGACCAGTTGCAGCAGCG	NA	NA	NA	NA
WP_023114585.1|918027_918438_+	hypothetical protein	NA	A0A1W6JT78	Pseudomonas_phage	93.2	1.2e-53
WP_021205046.1|918437_918983_+	hypothetical protein	NA	A0A1B0YZV4	Pseudomonas_phage	92.3	1.2e-90
WP_021205047.1|918993_919398_+	hypothetical protein	NA	A0A0U4B0P9	Pseudomonas_phage	99.3	1.2e-66
WP_023114584.1|919394_921053_+	hypothetical protein	NA	A0A0U4IJ51	Pseudomonas_phage	98.5	0.0e+00
WP_059319192.1|921082_921670_+	hypothetical protein	NA	A0A0U4B0K9	Pseudomonas_phage	93.8	1.1e-100
WP_003159486.1|921662_921854_+	hypothetical protein	NA	A0A1B0Z2L3	Pseudomonas_phage	100.0	7.0e-30
WP_023114582.1|921858_922419_+	hypothetical protein	NA	A0A1B0YZW5	Pseudomonas_phage	98.4	5.5e-99
WP_034009147.1|922418_922700_+	hypothetical protein	NA	A0A1W6JTD4	Pseudomonas_phage	96.8	5.1e-45
WP_059319193.1|923255_923558_+	hypothetical protein	NA	A0A0A0YUD8	Pseudomonas_phage	89.0	8.0e-44
WP_031691369.1|923554_923788_+	hypothetical protein	NA	A0A1B0YZV9	Pseudomonas_phage	97.4	1.3e-33
WP_003105684.1|923983_925222_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2C9CX69	Yersinia_phage	33.3	7.8e-53
>prophage 3
NZ_CP008865	Pseudomonas aeruginosa strain S86968 chromosome, complete genome	6934277	1488670	1497699	6934277		Bacillus_phage(33.33%)	8	NA	NA
WP_003098558.1|1488670_1489306_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_016852568.1|1489351_1490245_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1490349_1491354_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003119354.1|1491780_1492104_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003113873.1|1492170_1494738_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
WP_003098486.1|1494863_1495871_-	TolB family protein	NA	NA	NA	NA	NA
WP_003129950.1|1496018_1496525_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	1.8e-56
WP_003092260.1|1496658_1497699_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 4
NZ_CP008865	Pseudomonas aeruginosa strain S86968 chromosome, complete genome	6934277	1618169	1660811	6934277	integrase,transposase,head,protease	Pseudomonas_phage(98.11%)	55	1612569:1612586	1651261:1651278
1612569:1612586	attL	GCGCTGCGCAGCCTGCTG	NA	NA	NA	NA
WP_003127781.1|1618169_1618538_-	hypothetical protein	NA	J9SGX4	Pseudomonas_phage	100.0	1.1e-63
WP_003117363.1|1618534_1619083_-	hypothetical protein	NA	J9RWB3	Pseudomonas_phage	100.0	2.1e-98
WP_015649391.1|1619082_1619649_-	regulatory protein GemA	NA	J9SVT5	Pseudomonas_phage	99.5	2.1e-101
WP_016852433.1|1619635_1620103_-	hypothetical protein	NA	J9STM8	Pseudomonas_phage	100.0	8.5e-77
WP_016852434.1|1620102_1620294_-	hypothetical protein	NA	J9RW45	Pseudomonas_phage	100.0	5.0e-28
WP_016852435.1|1620295_1620985_-	DUF2786 domain-containing protein	NA	Q5ZR11	Pseudomonas_phage	98.7	4.2e-125
WP_016852436.1|1620986_1621610_-	DUF3164 family protein	NA	Q5ZR10	Pseudomonas_phage	99.5	1.3e-109
WP_016852437.1|1621602_1621803_-	hypothetical protein	NA	J9SVU3	Pseudomonas_phage	97.0	6.7e-31
WP_016852438.1|1621795_1622329_-	hypothetical protein	NA	J9STN6	Pseudomonas_phage	98.9	3.3e-93
WP_016852439.1|1622318_1622999_-	hypothetical protein	NA	J9SNC1	Pseudomonas_phage	98.7	2.4e-128
WP_014603990.1|1622998_1623283_-	hypothetical protein	NA	J9SGZ7	Pseudomonas_phage	100.0	3.4e-44
WP_016852440.1|1623279_1623621_-	hypothetical protein	NA	J9RWC3	Pseudomonas_phage	99.1	3.5e-56
WP_016852441.1|1623622_1624789_-	AAA family ATPase	NA	J9SVV1	Pseudomonas_phage	100.0	1.0e-216
WP_016852442.1|1624788_1626573_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	J9SGQ3	Pseudomonas_phage	98.5	0.0e+00
WP_023101705.1|1626576_1627551_-	hypothetical protein	NA	J9RW58	Pseudomonas_phage	97.8	8.9e-153
WP_003142307.1|1627560_1627875_-	hypothetical protein	NA	J9SUN0	Pseudomonas_phage	98.1	2.9e-49
WP_003142306.1|1627871_1628132_-	hypothetical protein	NA	J9RWD0	Pseudomonas_phage	95.3	1.5e-38
WP_010791820.1|1628124_1628613_-	hypothetical protein	NA	J9SNL8	Pseudomonas_phage	99.4	2.8e-91
WP_015649394.1|1628736_1628961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003142304.1|1629245_1629476_-	DNA-binding protein	NA	J9RW65	Pseudomonas_phage	100.0	2.5e-37
WP_157783244.1|1629660_1629921_+	hypothetical protein	NA	J9SH16	Pseudomonas_phage	82.6	1.8e-12
WP_003094225.1|1630631_1630889_+	membrane protein	NA	A0A0S4L5C0	Pseudomonas_phage	100.0	7.2e-38
WP_003094227.1|1630891_1631050_+	hypothetical protein	NA	J9SNF4	Pseudomonas_phage	100.0	3.4e-22
WP_016852445.1|1631046_1631676_+	transglycosylase SLT domain-containing protein	NA	J9SH25	Pseudomonas_phage	98.6	1.9e-119
WP_015649412.1|1631877_1632501_+	hypothetical protein	NA	J9SVX5	Pseudomonas_phage	90.3	3.6e-99
WP_003117315.1|1632500_1632821_+	DUF2730 family protein	NA	J9STR5	Pseudomonas_phage	100.0	5.1e-49
WP_003121465.1|1632817_1633120_+	hypothetical protein	NA	J9SNG3	Pseudomonas_phage	99.0	4.1e-48
WP_003121466.1|1633122_1633671_+	DUF3486 family protein	NA	J9SH37	Pseudomonas_phage	98.9	6.4e-76
WP_003138156.1|1633672_1635346_+	hypothetical protein	NA	J9RWF2	Pseudomonas_phage	99.5	0.0e+00
WP_023093201.1|1635339_1636914_+	DUF935 domain-containing protein	NA	J9SVY0	Pseudomonas_phage	96.2	7.6e-287
WP_016852447.1|1636903_1638142_+	hypothetical protein	NA	J9STS2	Pseudomonas_phage	99.5	5.8e-242
WP_016852448.1|1638143_1638719_+	phage virion morphogenesis protein	NA	J9SNH3	Pseudomonas_phage	99.0	2.9e-103
WP_003138161.1|1638929_1640039_+|protease	phage protease	protease	J9SH47	Pseudomonas_phage	99.2	2.9e-200
WP_003121593.1|1640044_1640449_+	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	100.0	1.8e-67
WP_003127513.1|1640463_1641360_+|head	Mu-like prophage major head subunit gpT family protein	head	J9SVY7	Pseudomonas_phage	100.0	1.3e-171
WP_015649419.1|1641372_1641807_+	hypothetical protein	NA	J9STT1	Pseudomonas_phage	99.0	1.1e-49
WP_003121492.1|1641809_1642325_+	DUF1320 domain-containing protein	NA	J9SNI4	Pseudomonas_phage	100.0	3.5e-92
WP_003138162.1|1642321_1642774_+	hypothetical protein	NA	J9SH57	Pseudomonas_phage	99.3	2.1e-80
WP_003127509.1|1642770_1642974_+	hypothetical protein	NA	J9RWG5	Pseudomonas_phage	100.0	1.7e-29
WP_016852449.1|1642980_1643721_+	hypothetical protein	NA	J9SVZ4	Pseudomonas_phage	98.8	1.8e-134
WP_016852450.1|1643723_1644206_+	hypothetical protein	NA	J9STT8	Pseudomonas_phage	99.4	2.8e-83
WP_049967619.1|1644160_1644343_-	hypothetical protein	NA	J9SNJ6	Pseudomonas_phage	100.0	1.2e-26
WP_016852451.1|1644459_1648101_+	tape measure protein	NA	J9SH65	Pseudomonas_phage	92.3	0.0e+00
WP_016852452.1|1648100_1649057_+	hypothetical protein	NA	J9RWP3	Pseudomonas_phage	95.0	3.1e-182
WP_016852453.1|1649059_1649983_+	hypothetical protein	NA	A0A0S4L5N6	Pseudomonas_phage	98.7	3.3e-181
WP_016852454.1|1649985_1651692_+	hypothetical protein	NA	J9STL4	Pseudomonas_phage	97.5	0.0e+00
1651261:1651278	attR	GCGCTGCGCAGCCTGCTG	NA	NA	NA	NA
WP_016852455.1|1651678_1652497_+	phage BR0599 family protein	NA	J9SN93	Pseudomonas_phage	99.3	3.8e-165
WP_003094285.1|1652506_1652737_+	hypothetical protein	NA	Q5ZQW1	Pseudomonas_phage	100.0	1.2e-36
WP_003094286.1|1652950_1655161_+	hypothetical protein	NA	Q5ZQV9	Pseudomonas_phage	97.8	0.0e+00
WP_003094288.1|1655157_1656306_+	hypothetical protein	NA	J9SP76	Pseudomonas_phage	92.9	9.0e-213
WP_003094290.1|1656302_1656593_+	hypothetical protein	NA	A0A0A7DJU8	Pseudomonas_phage	95.7	2.6e-44
WP_071534095.1|1656731_1656923_+	Com family DNA-binding transcriptional regulator	NA	Q5ZQW8	Pseudomonas_phage	74.6	3.0e-20
WP_003094291.1|1656892_1657687_+	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	90.2	1.8e-143
WP_003112894.1|1658360_1659347_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_016852582.1|1659377_1660811_+	adenylosuccinate lyase	NA	A0A1B1ISB0	uncultured_Mediterranean_phage	24.4	3.4e-07
>prophage 5
NZ_CP008865	Pseudomonas aeruginosa strain S86968 chromosome, complete genome	6934277	2578447	2618706	6934277	integrase,transposase	Salmonella_phage(22.22%)	38	2571246:2571262	2596827:2596843
2571246:2571262	attL	CGCGGCGGGCAACCCGG	NA	NA	NA	NA
WP_001067855.1|2578447_2579152_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_059319200.1|2581379_2584346_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	94.3	0.0e+00
WP_003090771.1|2584349_2584910_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	96.8	1.8e-57
WP_000429838.1|2585129_2585564_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294667.1|2585635_2585986_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000735441.1|2586001_2586277_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_054471484.1|2586279_2586525_+	mercury resistance system transport protein MerF	NA	NA	NA	NA	NA
WP_000136268.1|2586521_2588168_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	1.0e-39
WP_003465059.1|2588184_2588550_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087809.1|2588546_2588783_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000904941.1|2588835_2589450_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	51.9	1.3e-37
WP_003465063.1|2589510_2590728_-	TniQ family protein	NA	NA	NA	NA	NA
WP_003465065.1|2590724_2591633_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_003465068.1|2591635_2593315_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_003458515.1|2593364_2593634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011911868.1|2593623_2595162_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_004423345.1|2595283_2595628_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	33.7	1.1e-12
WP_004423344.1|2595624_2595915_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_001276635.1|2596217_2597207_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
2596827:2596843	attR	CGCGGCGGGCAACCCGG	NA	NA	NA	NA
WP_003090697.1|2597203_2597440_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_003090698.1|2597436_2597802_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_003090700.1|2597819_2599505_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.2	1.3e-39
WP_000732290.1|2599576_2599852_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294666.1|2599867_2600218_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000414383.1|2600289_2600724_+	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_024014384.1|2603119_2604499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021219117.1|2604910_2605603_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_042855648.1|2605815_2607042_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_021219115.1|2607038_2607611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090707.1|2607701_2608409_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_023104037.1|2608919_2609882_-	SdiA-regulated domain-containing protein	NA	NA	NA	NA	NA
WP_003090764.1|2609927_2610287_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003090760.1|2610286_2611138_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	64.0	1.0e-96
WP_003090759.1|2611152_2612640_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	87.7	4.3e-239
WP_023098557.1|2613555_2614761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090694.1|2615007_2616258_+	TerD family protein	NA	NA	NA	NA	NA
WP_034023821.1|2616543_2617572_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_034023821.1|2617677_2618706_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP008865	Pseudomonas aeruginosa strain S86968 chromosome, complete genome	6934277	2770765	2777659	6934277	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_003119978.1|2770765_2772046_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.2	1.8e-97
WP_003113366.1|2772047_2773445_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_016852739.1|2773449_2774424_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003108776.1|2774511_2775495_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.3	9.3e-142
WP_003119979.1|2775491_2775827_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	1.5e-38
WP_003090391.1|2775823_2776129_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_016562012.1|2776128_2776488_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.1e-34
WP_016562011.1|2776484_2776880_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	71.3	3.5e-47
WP_003090386.1|2776990_2777659_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
>prophage 7
NZ_CP008865	Pseudomonas aeruginosa strain S86968 chromosome, complete genome	6934277	3108185	3146648	6934277	plate,tail	Planktothrix_phage(33.33%)	33	NA	NA
WP_003114503.1|3108185_3109469_-|tail	pyoverdine-tailoring periplasmic protein PvdN	tail	NA	NA	NA	NA
WP_003450962.1|3109491_3110838_-|tail	pyoverdine-tailoring dipeptidase-like protein PvdM	tail	NA	NA	NA	NA
WP_003163333.1|3111051_3112698_+	pyoverdine maturation tyrosinase PvdP	NA	NA	NA	NA	NA
WP_004343750.1|3112746_3114171_-	pyoverdine export/recycling transporter outer membrane subunit OmpQ	NA	NA	NA	NA	NA
WP_003131508.1|3114176_3116168_-	pyoverdine export/recycling transporter ATP-binding/permease subunit PvdT	NA	G9BWD6	Planktothrix_phage	39.3	6.9e-35
WP_003089547.1|3116167_3117343_-	pyoverdine export/recycling transporter periplasmic adaptor subunit PvdR	NA	NA	NA	NA	NA
WP_003144014.1|3117443_3118439_-	FecR family protein	NA	NA	NA	NA	NA
WP_003122684.1|3118599_3119079_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_016852870.1|3119195_3120527_+	SidA/IucD/PvdA family monooxygenase	NA	NA	NA	NA	NA
WP_016852871.1|3120649_3122938_+	acylase	NA	NA	NA	NA	NA
WP_003089535.1|3123118_3123442_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003124571.1|3123483_3124404_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003104946.1|3124500_3125652_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003089526.1|3125728_3125971_-	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_003104944.1|3126265_3126502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003089521.1|3126766_3127237_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_003114512.1|3127233_3129549_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_023082412.1|3129965_3131171_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003110901.1|3131371_3132013_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003089513.1|3132289_3132685_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_003104933.1|3132707_3133244_-	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_003114515.1|3133254_3135261_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.5	7.7e-42
WP_003104930.1|3135260_3135449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003122693.1|3135608_3136181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016852873.1|3136202_3138752_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.4	5.5e-77
WP_016852874.1|3138753_3139770_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_003104926.1|3139733_3141527_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_003450950.1|3141510_3141936_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003089495.1|3141948_3142446_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003089494.1|3142519_3144004_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016852875.1|3144026_3144572_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_016852876.1|3144780_3145257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059319203.1|3145316_3146648_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
NZ_CP008865	Pseudomonas aeruginosa strain S86968 chromosome, complete genome	6934277	4762534	4807481	6934277	transposase	Shigella_phage(50.0%)	42	NA	NA
WP_086937300.1|4762534_4763697_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.6	4.3e-85
WP_023093037.1|4763771_4764554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023093038.1|4765010_4765868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023093040.1|4767280_4769899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023093041.1|4769895_4773072_+	UvrD-helicase domain-containing protein	NA	E3T5J8	Cafeteria_roenbergensis_virus	30.5	1.3e-06
WP_023093042.1|4773110_4774322_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_023093043.1|4774558_4775791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021264362.1|4776563_4776857_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_033937086.1|4776853_4777720_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	47.0	1.0e-59
WP_003159697.1|4779061_4779277_-	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_086009751.1|4779678_4780840_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.2	6.1e-84
WP_019726861.1|4781704_4782259_-	OsmC family protein	NA	NA	NA	NA	NA
WP_019727266.1|4782326_4782998_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_024928862.1|4783050_4783392_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_019726864.1|4783486_4784047_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019726865.1|4784108_4784894_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023093047.1|4785050_4785464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088376620.1|4786319_4787457_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.7	2.2e-46
WP_023093050.1|4787708_4788398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023093051.1|4788408_4789164_+	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_015648301.1|4789148_4789730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012076862.1|4789726_4790227_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_012076863.1|4790235_4790505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012076864.1|4790508_4792740_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_023093052.1|4792739_4793486_+	TIGR03747 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_023093053.1|4793496_4794978_+	UvrD-helicase domain-containing protein	NA	A0A2I7RIK5	Vibrio_phage	30.3	7.7e-39
WP_023093054.1|4795109_4796219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003117074.1|4796263_4796575_-	DUF2845 domain-containing protein	NA	NA	NA	NA	NA
WP_003109393.1|4796747_4797047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020751097.1|4797139_4797478_+	RAQPRD family integrative conjugative element protein	NA	NA	NA	NA	NA
WP_023443559.1|4797474_4797714_+	TIGR03758 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_003117077.1|4797731_4798088_+	TIGR03745 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_003117078.1|4798098_4798485_+	TIGR03750 family conjugal transfer protein	NA	NA	NA	NA	NA
WP_003117079.1|4798481_4799141_+	TIGR03746 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_003117080.1|4799137_4800022_+	TIGR03749 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_019416328.1|4800005_4801511_+	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_003121022.1|4801488_4801932_+	TIGR03751 family conjugal transfer lipoprotein	NA	NA	NA	NA	NA
WP_010792229.1|4801931_4804874_+	conjugative transfer ATPase	NA	NA	NA	NA	NA
WP_003099860.1|4804870_4805155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003109405.1|4805151_4805811_+	DsbA family protein	NA	NA	NA	NA	NA
WP_003109406.1|4805807_4806026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034023821.1|4806452_4807481_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP008865	Pseudomonas aeruginosa strain S86968 chromosome, complete genome	6934277	5180264	5208105	6934277	integrase,transposase,protease	Pseudomonas_phage(60.0%)	28	5171805:5171819	5205217:5205231
5171805:5171819	attL	GCCGCTGTAGAGGAA	NA	NA	NA	NA
WP_020306394.1|5180264_5180816_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_023093169.1|5180749_5181127_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_031642515.1|5181411_5181693_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_008906266.1|5181728_5182298_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_023093170.1|5182391_5185241_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.1	3.1e-129
WP_023093171.1|5185258_5186689_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_023093172.1|5186716_5188600_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	40.9	5.1e-104
WP_023093173.1|5188596_5189037_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	36.8	6.4e-10
WP_031656219.1|5189191_5191999_+	GGDEF and EAL domain-containing protein	NA	G3MA91	Bacillus_virus	38.7	2.3e-28
WP_023093176.1|5192182_5192683_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_023093177.1|5192660_5193626_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_023093178.1|5193650_5194802_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_006217728.1|5194998_5195394_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003121550.1|5195390_5195723_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_010791743.1|5197358_5197778_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_077446928.1|5197833_5198934_+	cation transporter	NA	NA	NA	NA	NA
WP_003141085.1|5199096_5200005_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003123043.1|5200314_5200662_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_003114155.1|5200671_5200923_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_016852062.1|5201136_5202120_-|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	52.3	6.8e-92
WP_003115206.1|5202119_5203412_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	94.2	2.8e-247
WP_023093179.1|5203670_5204933_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	55.2	1.3e-116
WP_003159569.1|5204934_5205285_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	41.1	5.5e-20
5205217:5205231	attR	GCCGCTGTAGAGGAA	NA	NA	NA	NA
WP_014603242.1|5205294_5205900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003163345.1|5206555_5206774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003124954.1|5206787_5207039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003125073.1|5207159_5207594_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	86.8	3.0e-60
WP_186291201.1|5207940_5208105_-	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	98.1	7.4e-20
>prophage 10
NZ_CP008865	Pseudomonas aeruginosa strain S86968 chromosome, complete genome	6934277	5727505	5853398	6934277	tRNA,transposase,coat,integrase	Pseudomonas_phage(26.09%)	103	5840525:5840584	5854686:5854767
WP_034023821.1|5727505_5728534_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_034023821.1|5728639_5729668_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_034023821.1|5730167_5731196_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_034023821.1|5731301_5732330_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_023093188.1|5732904_5737152_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.4	6.9e-16
WP_003094846.1|5737274_5738528_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.1	9.2e-102
WP_003121337.1|5738605_5738986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016852130.1|5739008_5740013_-	GTPase	NA	NA	NA	NA	NA
WP_003094856.1|5740072_5740276_-	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_003094859.1|5740324_5742391_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_003094862.1|5742728_5743235_-	DUF3015 domain-containing protein	NA	NA	NA	NA	NA
WP_003094864.1|5743437_5743815_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_003094867.1|5743821_5745183_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003112796.1|5745292_5745727_+	CopD family protein	NA	NA	NA	NA	NA
WP_003104887.1|5745788_5746043_-	YdcH family protein	NA	NA	NA	NA	NA
WP_016852131.1|5746117_5746669_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_003094881.1|5746722_5748264_-	catalase	NA	A0A2K9L0T1	Tupanvirus	46.9	2.3e-94
WP_176740600.1|5748260_5748707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034023821.1|5748811_5749840_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_016852133.1|5749907_5750321_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_003110878.1|5750425_5751202_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_003121339.1|5751308_5752307_-	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_003112793.1|5752634_5753759_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016852134.1|5753759_5754335_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_016852135.1|5754334_5755306_-	XdhC family protein	NA	NA	NA	NA	NA
WP_003116295.1|5755309_5756557_-	cytochrome c	NA	NA	NA	NA	NA
WP_003094903.1|5756559_5757099_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_016852136.1|5757091_5759923_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_016852137.1|5760233_5761445_+	MFS transporter	NA	NA	NA	NA	NA
WP_003106768.1|5761604_5761994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049967638.1|5764065_5771013_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_023093191.1|5771333_5772305_+	2-hydroxyacid dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	32.1	6.2e-21
WP_003135073.1|5772414_5773413_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003094922.1|5773507_5774971_+	amino acid permease	NA	NA	NA	NA	NA
WP_003094926.1|5775323_5775902_+	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_003099368.1|5776018_5776462_+	ester cyclase	NA	NA	NA	NA	NA
WP_003121034.1|5776471_5777497_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_003099360.1|5777640_5778462_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_003099358.1|5778624_5780763_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.1	2.3e-20
WP_003114707.1|5780765_5781380_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	26.4	7.1e-07
WP_003094941.1|5781804_5782509_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	42.5	9.0e-14
WP_003094943.1|5782521_5782785_-	DUF2007 domain-containing protein	NA	NA	NA	NA	NA
WP_003094945.1|5782784_5782967_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_003099351.1|5783064_5784225_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003114705.1|5784345_5784624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003094953.1|5785171_5785759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003141615.1|5786600_5788124_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_003094957.1|5788173_5788587_-	VOC family protein	NA	NA	NA	NA	NA
WP_003099343.1|5788855_5789146_-	PA4642 family protein	NA	NA	NA	NA	NA
WP_003094962.1|5789228_5789714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003094965.1|5789781_5790255_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_003099341.1|5790256_5790814_-	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A2K9L2A2	Tupanvirus	29.1	1.7e-07
WP_059319177.1|5790982_5791621_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003094970.1|5791623_5792907_+	uracil-xanthine permease	NA	Q9KX94	Enterobacteria_phage	39.1	1.1e-60
WP_003099340.1|5793240_5793789_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003135089.1|5793819_5794353_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_016852143.1|5794352_5794895_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003121045.1|5794913_5795702_+	molecular chaperone	NA	NA	NA	NA	NA
WP_016852144.1|5795718_5798091_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_003099330.1|5798087_5799035_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003099328.1|5799036_5800410_-	MFS transporter	NA	NA	NA	NA	NA
WP_003099324.1|5800689_5801712_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016852145.1|5801708_5802626_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_003099318.1|5803039_5804023_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003099314.1|5804175_5805132_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_003094990.1|5805141_5806041_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	39.1	8.5e-17
WP_003121048.1|5806037_5807483_+	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	27.8	1.8e-45
WP_003099307.1|5807608_5808130_-	acyloxyacyl hydrolase	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	69.8	1.4e-59
WP_003099300.1|5808263_5809061_-	glutamate racemase	NA	NA	NA	NA	NA
WP_003099296.1|5809050_5809809_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_003099293.1|5809802_5810633_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003099290.1|5810634_5811717_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	48.3	5.6e-07
WP_003095001.1|5811734_5813003_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016852147.1|5813146_5814919_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_016852148.1|5814923_5815541_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_003099284.1|5815542_5816391_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003099281.1|5816557_5817499_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	4.1e-46
WP_003099279.1|5817615_5818230_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_003099278.1|5818271_5818856_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_003099270.1|5818896_5819997_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_003161389.1|5820202_5821414_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	1.1e-56
WP_003161388.1|5821675_5822776_+	Fic family protein	NA	NA	NA	NA	NA
WP_003161387.1|5822785_5828059_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.9	8.7e-61
WP_003161386.1|5828065_5830849_+	DEAD/DEAH box helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	26.7	2.2e-39
WP_003161385.1|5830873_5835346_+	N-6 DNA methylase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	23.7	5.7e-37
WP_016852149.1|5835635_5837279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003161383.1|5837328_5838096_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_016852151.1|5838263_5839127_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
5840525:5840584	attL	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGG	NA	NA	NA	NA
WP_123789187.1|5840709_5841120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016852152.1|5841100_5842102_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	46.5	2.9e-74
WP_019416334.1|5842098_5843391_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	92.0	8.8e-241
WP_003159569.1|5844912_5845263_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	41.1	5.5e-20
WP_031634255.1|5845272_5845875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023082694.1|5846530_5846749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003124954.1|5846762_5847014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003151275.1|5847134_5847569_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	95.8	4.3e-59
WP_023083237.1|5848084_5848375_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	97.9	4.3e-55
WP_003115921.1|5848586_5848859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016852153.1|5848968_5849235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023082695.1|5849408_5850203_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145954746.1|5850177_5851224_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_034023821.1|5851235_5852264_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_034023821.1|5852369_5853398_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
5854686:5854767	attR	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGGTTAGCGCAAGCTAACCCCTTTT	NA	NA	NA	NA
>prophage 11
NZ_CP008865	Pseudomonas aeruginosa strain S86968 chromosome, complete genome	6934277	6670165	6735342	6934277	transposase,holin,protease	Escherichia_phage(31.25%)	69	NA	NA
WP_001067855.1|6670165_6670870_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_059319183.1|6670928_6672263_+	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	64.0	1.9e-28
WP_023100537.1|6672273_6672600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023100538.1|6672614_6673067_+	chromate resistance protein	NA	NA	NA	NA	NA
WP_049875192.1|6673203_6673479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124014491.1|6673411_6674461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023100541.1|6674540_6674738_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023100542.1|6674962_6676522_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	39.9	3.6e-95
WP_023100543.1|6676515_6677250_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.8	2.8e-26
WP_074247666.1|6677312_6677567_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_023082866.1|6679397_6680762_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_023082865.1|6680874_6682305_-	coniferyl aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_031633990.1|6682539_6683916_-	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	24.1	4.6e-14
WP_023100546.1|6684120_6685113_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_126543471.1|6685791_6687291_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_003117254.1|6687283_6688087_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.4	9.9e-33
WP_023082852.1|6688296_6689298_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023082851.1|6689492_6690950_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023082850.1|6690946_6691318_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_023082849.1|6691320_6691716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003150544.1|6691882_6692812_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	46.9	1.9e-40
WP_003089107.1|6693013_6693253_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_059319184.1|6693252_6693669_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_001067855.1|6693715_6694420_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_003090800.1|6694731_6695106_+	DUF5064 family protein	NA	NA	NA	NA	NA
WP_003090802.1|6695216_6695546_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_003090804.1|6695611_6695809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003090806.1|6695987_6696218_+	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_003090808.1|6696565_6697036_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_016852712.1|6697088_6697475_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_016852711.1|6697661_6698105_-	PACE efflux transporter	NA	NA	NA	NA	NA
WP_003099119.1|6698207_6699095_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003143770.1|6699305_6699620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003099122.1|6699984_6701262_+	OprD family porin	NA	NA	NA	NA	NA
WP_003138828.1|6701373_6701790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090818.1|6701832_6702177_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003090820.1|6702288_6702498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003090821.1|6702767_6702956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090822.1|6702970_6703180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003119904.1|6703510_6704206_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003119903.1|6704253_6705153_-	Dyp-type peroxidase	NA	A0A0M5KAH8	Mollivirus	28.9	4.5e-18
WP_016852710.1|6705494_6706076_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003114421.1|6706163_6707132_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003114422.1|6707137_6707620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016852709.1|6707770_6708181_-	NUDIX domain-containing protein	NA	A0A1L7N0J3	Ralstonia_phage	42.5	1.8e-22
WP_016852708.1|6708202_6708982_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_003099145.1|6709083_6709323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|6709558_6710263_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840280.1|6710613_6711168_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|6711376_6712081_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_003104851.1|6713857_6715174_-	MFS transporter	NA	NA	NA	NA	NA
WP_003096677.1|6715461_6715866_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_015649841.1|6715911_6717597_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	6.0e-56
WP_003121323.1|6717732_6719205_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003096684.1|6719265_6719859_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_003104844.1|6720191_6721742_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.0	3.4e-21
WP_003096690.1|6721959_6723138_-|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	35.1	1.9e-24
WP_003096692.1|6723141_6723981_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_003104841.1|6724022_6724961_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_003111339.1|6725424_6726801_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_003096699.1|6727220_6728324_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003096701.1|6728370_6728619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003104838.1|6728887_6729781_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003457999.1|6729888_6730956_+	YeiH family protein	NA	NA	NA	NA	NA
WP_004364692.1|6730929_6731895_-	alpha/beta hydrolase	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	33.3	8.8e-20
WP_003458005.1|6731900_6732380_-	thioesterase family protein	NA	NA	NA	NA	NA
WP_003096713.1|6732430_6733396_-	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_003096716.1|6733446_6734331_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_003096718.1|6734403_6735342_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
