The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008871	Pseudomonas aeruginosa strain W45909 chromosome, complete genome	6777566	638617	696140	6777566	tail,holin,tRNA	Pseudomonas_phage(55.56%)	58	NA	NA
WP_009875776.1|638617_639643_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	8.3e-109
WP_003085061.1|639721_640291_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|640374_640728_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003142783.1|640718_641261_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_022580735.1|641233_642466_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	1.6e-77
WP_003085071.1|642509_643016_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|643110_644664_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|644660_645932_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|646032_647955_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|648233_648566_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003113213.1|648609_649461_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003085085.1|649460_649841_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_023114717.1|649877_650684_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_023114716.1|650799_651786_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003129198.1|651782_653075_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_004352244.1|653055_655839_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_003109031.1|655971_657684_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	82.1	8.0e-282
WP_003099554.1|658956_659973_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003099549.1|659969_660644_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_004352246.1|660645_661404_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_004352248.1|661404_662466_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
WP_003459408.1|662617_665011_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|665056_665689_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_023114715.1|665817_666852_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|667085_668195_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003099539.1|668250_669297_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003113206.1|669411_670659_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003099535.1|670764_671595_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|671718_672393_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003113205.1|672392_673211_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003113204.1|673283_674762_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003113203.1|675080_675395_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_003113202.1|675494_676265_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
WP_003085132.1|676722_676923_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003113201.1|676970_677330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003117965.1|677786_678134_+|holin	holin	holin	B5TK61	Pseudomonas_phage	51.8	3.9e-26
WP_003118917.1|678149_678779_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	7.1e-87
WP_003142810.1|678775_679138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118919.1|679134_679392_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003113190.1|679707_680202_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	56.5	1.4e-45
WP_004352265.1|680213_680561_+|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_003113188.1|680590_680845_+	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	6.3e-10
WP_023114714.1|680891_682730_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	35.8	2.6e-28
WP_003113186.1|682722_683064_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
WP_003118922.1|683071_683767_+|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	50.2	1.5e-69
WP_003129219.1|683769_684540_+	C40 family peptidase	NA	A0A2D1GNP8	Pseudomonas_phage	55.6	5.5e-81
WP_016252934.1|684594_685197_+|tail	tail assembly protein	tail	A0A1V0E8A0	Vibrio_phage	57.3	4.9e-53
WP_004352268.1|685255_688870_+|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	55.3	0.0e+00
WP_004352269.1|689105_689894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003115342.1|689917_691009_+	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	36.9	1.3e-46
WP_003113180.1|691008_691344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004352270.1|691324_691555_+	hypothetical protein	NA	A0A1W6JT87	Pseudomonas_phage	64.0	1.1e-18
WP_004352271.1|691650_692703_+	hypothetical protein	NA	A0A0H5AXZ9	Pseudomonas_phage	52.5	2.7e-62
WP_023114713.1|692702_693005_+	hypothetical protein	NA	A0A0H5B141	Pseudomonas_phage	70.0	6.3e-33
WP_003118930.1|693001_693232_+	hypothetical protein	NA	C8ZKF3	Pseudomonas_phage	71.6	1.4e-24
WP_003117978.1|693650_694256_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	2.1e-75
WP_003085203.1|694257_695307_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085205.1|695303_696140_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
>prophage 2
NZ_CP008871	Pseudomonas aeruginosa strain W45909 chromosome, complete genome	6777566	1473420	1536350	6777566	terminase,holin,protease,lysis,tRNA,portal,integrase	Pseudomonas_phage(76.19%)	77	1492843:1492865	1533349:1533371
WP_003122145.1|1473420_1474749_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	M1IB95	Acanthocystis_turfacea_Chlorella_virus	24.1	1.0e-05
WP_003092366.1|1474919_1476548_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.1	4.0e-158
WP_003092365.1|1476550_1477396_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.3	1.4e-48
WP_003092364.1|1477441_1478731_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	61.5	2.5e-139
WP_003098569.1|1478795_1479080_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_003092359.1|1479099_1479804_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003092358.1|1479864_1480113_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_003453634.1|1480078_1481305_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_003098564.1|1481380_1482289_-	glutathione-dependent formaldehyde neutralization regulator	NA	NA	NA	NA	NA
WP_003092351.1|1482420_1483533_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.1	1.3e-35
WP_003113869.1|1483586_1484438_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_003098560.1|1484508_1484982_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_023114621.1|1484978_1486046_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_003092341.1|1486033_1486783_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.0	6.8e-68
WP_003098558.1|1486815_1487451_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_003115226.1|1487496_1488390_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1488494_1489499_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|1489925_1490249_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_079279453.1|1490315_1492895_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
1492843:1492865	attL	TACTGCTGCATCATTGGCGTGTG	NA	NA	NA	NA
WP_023114620.1|1492954_1493929_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J8E5	uncultured_Caudovirales_phage	57.3	1.9e-102
WP_071538228.1|1493938_1494148_-	DUF4224 domain-containing protein	NA	A0A1B0VMB6	Pseudomonas_phage	57.8	2.9e-13
WP_023114619.1|1494361_1494652_-	hypothetical protein	NA	A0A0A1IWS9	Pseudomonas_phage	99.0	1.0e-48
WP_023114239.1|1494723_1494927_-	hypothetical protein	NA	A0A125RNQ4	Pseudomonas_phage	97.0	1.0e-31
WP_023114241.1|1495374_1495614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012613684.1|1496871_1497120_-	hypothetical protein	NA	H2BD39	Pseudomonas_phage	92.7	1.2e-37
WP_023114616.1|1497202_1497883_-	hypothetical protein	NA	H2BDG4	Pseudomonas_virus	66.7	1.4e-80
WP_023114615.1|1497912_1498449_-	DUF4406 domain-containing protein	NA	A0A1B0YZW9	Pseudomonas_phage	96.6	5.0e-97
WP_023114614.1|1498906_1499209_-	hypothetical protein	NA	A0A0U4ISH7	Pseudomonas_phage	94.0	3.5e-39
WP_023114613.1|1499208_1499523_-	hypothetical protein	NA	A0A0U4KL54	Pseudomonas_phage	83.7	9.5e-40
WP_023114612.1|1499957_1500206_-	hypothetical protein	NA	A0A0U3TGX2	Pseudomonas_phage	84.1	8.3e-31
WP_023114611.1|1500216_1500600_-	helix-turn-helix transcriptional regulator	NA	A0A0U4IIG4	Pseudomonas_phage	95.3	1.1e-61
WP_124082060.1|1500940_1501882_-	hypothetical protein	NA	A0A1B0YZX8	Pseudomonas_phage	46.9	6.5e-60
WP_023114609.1|1501847_1502546_-	hypothetical protein	NA	A0A088FRV0	Escherichia_phage	48.4	1.0e-54
WP_023114608.1|1502794_1503088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023114607.1|1503105_1503396_-	hypothetical protein	NA	A0A125RNS4	Pseudomonas_phage	92.0	7.9e-41
WP_023114606.1|1503938_1505033_-	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	42.7	3.2e-66
WP_023114605.1|1505128_1505848_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JTC8	Pseudomonas_phage	55.7	4.9e-39
WP_031637426.1|1505943_1506156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023114604.1|1506309_1507014_+	phage regulatory protein/antirepressor Ant	NA	A0A1B0YZY9	Pseudomonas_phage	97.9	1.6e-124
WP_031637423.1|1507078_1507834_+	helix-turn-helix domain-containing protein	NA	A0A1B0YZZ0	Pseudomonas_phage	80.2	8.0e-77
WP_023114602.1|1507830_1508514_+	hypothetical protein	NA	A0A1B0YZY6	Pseudomonas_phage	97.8	3.0e-123
WP_023114601.1|1508510_1508717_+	hypothetical protein	NA	A0A1B0YZY8	Pseudomonas_phage	92.6	6.9e-31
WP_021205616.1|1508713_1509295_+	recombination protein NinG	NA	A0A0U4KL68	Pseudomonas_phage	95.3	6.6e-103
WP_023114600.1|1509291_1509588_+	hypothetical protein	NA	A0A1B0YZZ2	Pseudomonas_phage	83.7	1.2e-41
WP_014602588.1|1509589_1509964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003129668.1|1510233_1510566_+|holin	phage holin, lambda family	holin	A0A1B0YZZ1	Pseudomonas_phage	100.0	5.1e-44
WP_023114599.1|1510562_1511180_+	glycoside hydrolase family 19 protein	NA	A0A1W6JTC9	Pseudomonas_phage	94.1	1.9e-108
WP_023875728.1|1511176_1511419_+	hypothetical protein	NA	A0A0H5AWC3	Pseudomonas_phage	51.9	3.2e-19
WP_031637422.1|1511415_1511886_+|lysis	lysis protein	lysis	A0A1B0Z001	Pseudomonas_phage	91.0	3.1e-71
WP_023114596.1|1511882_1512626_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	99.2	1.1e-134
WP_023114595.1|1512745_1513291_+|terminase	terminase small subunit	terminase	A0A1W6JT69	Pseudomonas_phage	100.0	3.1e-94
WP_003159069.1|1515231_1515447_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	100.0	6.5e-32
WP_019486499.1|1515446_1517093_+|portal	phage portal protein	portal	A0A1W6JTB6	Pseudomonas_phage	99.8	0.0e+00
WP_113774872.1|1517052_1519146_+|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	97.8	0.0e+00
WP_023110592.1|1519212_1519530_+	DUF2190 family protein	NA	A0A1B0YZT7	Pseudomonas_phage	100.0	1.6e-50
WP_023114592.1|1519526_1519856_+	hypothetical protein	NA	A0A1W6JT71	Pseudomonas_phage	97.2	1.5e-56
WP_023114591.1|1519852_1520323_+	hypothetical protein	NA	A0A1W6JT75	Pseudomonas_phage	98.7	9.1e-87
WP_023114590.1|1520326_1520521_+	hypothetical protein	NA	A0A1W6JT79	Pseudomonas_phage	96.9	5.7e-27
WP_015980909.1|1520522_1521275_+	hypothetical protein	NA	A0A1B0YZT8	Pseudomonas_phage	99.6	2.4e-137
WP_023114589.1|1521356_1521998_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	A0A1W6JT76	Pseudomonas_phage	93.9	6.8e-109
WP_019396608.1|1522059_1522362_+	hypothetical protein	NA	A0A1W6JT80	Pseudomonas_phage	100.0	4.1e-48
WP_023114588.1|1522464_1524948_+	tape measure protein	NA	A0A1B0YZV6	Pseudomonas_phage	98.5	0.0e+00
WP_023114587.1|1524987_1525509_+	hypothetical protein	NA	A0A1W6JT98	Pseudomonas_phage	99.4	4.4e-98
WP_023114586.1|1525508_1527218_+	hypothetical protein	NA	A0A1W6JTA3	Pseudomonas_phage	88.9	8.5e-300
WP_023114585.1|1527220_1527631_+	hypothetical protein	NA	A0A1W6JT78	Pseudomonas_phage	93.2	1.2e-53
WP_021205046.1|1527630_1528176_+	hypothetical protein	NA	A0A1B0YZV4	Pseudomonas_phage	92.3	1.2e-90
WP_021205047.1|1528186_1528591_+	hypothetical protein	NA	A0A0U4B0P9	Pseudomonas_phage	99.3	1.2e-66
WP_023114584.1|1528587_1530246_+	hypothetical protein	NA	A0A0U4IJ51	Pseudomonas_phage	98.5	0.0e+00
WP_023114583.1|1530275_1530863_+	hypothetical protein	NA	A0A0U4B0K9	Pseudomonas_phage	94.9	3.3e-102
WP_003159082.1|1530855_1531047_+	hypothetical protein	NA	A0A1B0Z2L3	Pseudomonas_phage	98.4	3.5e-29
WP_023114582.1|1531051_1531612_+	hypothetical protein	NA	A0A1B0YZW5	Pseudomonas_phage	98.4	5.5e-99
WP_023086976.1|1531611_1531893_+	hypothetical protein	NA	A0A1W6JTD4	Pseudomonas_phage	100.0	3.6e-46
WP_023114581.1|1532472_1532787_+	hypothetical protein	NA	A0A0U4K5I1	Pseudomonas_phage	88.5	5.0e-49
WP_014602611.1|1532874_1533147_+	hypothetical protein	NA	A0A0U4JEI3	Pseudomonas_phage	98.9	2.6e-46
WP_003092265.1|1533514_1534522_-	TolB family protein	NA	NA	NA	NA	NA
1533349:1533371	attR	TACTGCTGCATCATTGGCGTGTG	NA	NA	NA	NA
WP_003092262.1|1534669_1535176_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003092260.1|1535309_1536350_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 3
NZ_CP008871	Pseudomonas aeruginosa strain W45909 chromosome, complete genome	6777566	2602257	2609150	6777566	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_003160440.1|2602257_2603538_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	4.8e-98
WP_003113366.1|2603539_2604937_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_023114465.1|2604941_2605916_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003108776.1|2606003_2606987_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.3	9.3e-142
WP_003090393.1|2606983_2607319_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
WP_003090391.1|2607315_2607621_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2607620_2607980_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090387.1|2607976_2608372_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090386.1|2608481_2609150_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
>prophage 4
NZ_CP008871	Pseudomonas aeruginosa strain W45909 chromosome, complete genome	6777566	3031801	3071162	6777566	tail,plate	Planktothrix_phage(33.33%)	33	NA	NA
WP_016253414.1|3031801_3033085_-|tail	pyoverdine-tailoring periplasmic protein PvdN	tail	NA	NA	NA	NA
WP_016253415.1|3033107_3034454_-|tail	pyoverdine-tailoring dipeptidase-like protein PvdM	tail	NA	NA	NA	NA
WP_003139293.1|3034669_3036304_+	pyoverdine maturation tyrosinase PvdP	NA	NA	NA	NA	NA
WP_003120134.1|3036352_3037777_-	pyoverdine export/recycling transporter outer membrane subunit OmpQ	NA	NA	NA	NA	NA
WP_003131508.1|3037782_3039774_-	pyoverdine export/recycling transporter ATP-binding/permease subunit PvdT	NA	G9BWD6	Planktothrix_phage	39.3	6.9e-35
WP_003089547.1|3039773_3040949_-	pyoverdine export/recycling transporter periplasmic adaptor subunit PvdR	NA	NA	NA	NA	NA
WP_012614142.1|3041049_3042045_-	FecR family protein	NA	NA	NA	NA	NA
WP_003103620.1|3042208_3042688_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003114509.1|3042820_3044152_+	L-ornithine N(5)-monooxygenase	NA	NA	NA	NA	NA
WP_023114408.1|3044274_3046563_+	acylase	NA	NA	NA	NA	NA
WP_003089535.1|3046743_3047067_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003124571.1|3047108_3048029_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023114407.1|3048125_3049277_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003089526.1|3049353_3049596_-	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_003104944.1|3049890_3050127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003089521.1|3050391_3050862_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_003160318.1|3050858_3053174_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_003115787.1|3053590_3054796_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003110901.1|3054996_3055638_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003089513.1|3055914_3056310_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_003114514.1|3056332_3056869_-	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_023114406.1|3056879_3058883_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.8	6.9e-43
WP_023114405.1|3058889_3059675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003116944.1|3059744_3060620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019681913.1|3060710_3063260_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.4	1.2e-76
WP_003104928.1|3063261_3064278_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_023114404.1|3064241_3066035_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_023114403.1|3066018_3066444_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003089495.1|3066456_3066954_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003089494.1|3067027_3068512_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003089493.1|3068534_3069080_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_059301361.1|3069288_3069771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003122697.1|3069830_3071162_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 5
NZ_CP008871	Pseudomonas aeruginosa strain W45909 chromosome, complete genome	6777566	5005881	5095901	6777566	terminase,integrase,head,holin,protease,tail,portal,capsid,plate,tRNA	Pseudomonas_virus(70.21%)	102	5029381:5029397	5094281:5094297
WP_003085581.1|5005881_5006286_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_003145751.1|5006384_5007137_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003085577.1|5007268_5007841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003123029.1|5007945_5008686_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1B0XTP2	Freshwater_phage	26.4	6.4e-10
WP_003085573.1|5008682_5009651_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_003101974.1|5009741_5010488_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_003101972.1|5010480_5011182_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003085566.1|5011242_5012160_-	GTPase Era	NA	NA	NA	NA	NA
WP_003085565.1|5012152_5012842_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.4	7.2e-24
WP_023086589.1|5012838_5013216_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_003101969.1|5013384_5014239_-	signal peptidase I	NA	NA	NA	NA	NA
WP_023102293.1|5014244_5016044_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	38.5	3.3e-20
WP_003101964.1|5016193_5017618_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	32.0	3.4e-28
WP_003110245.1|5017657_5018113_-	SoxR reducing system RseC family protein	NA	NA	NA	NA	NA
WP_003101960.1|5018109_5019060_-	sigma factor AlgU regulatory protein MucB	NA	NA	NA	NA	NA
WP_003101958.1|5019068_5019653_-	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_003085543.1|5019684_5020266_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_003114182.1|5020674_5022291_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_003114181.1|5022259_5022712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085532.1|5022695_5022950_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_003101947.1|5023222_5024167_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003085528.1|5024267_5025104_+	HDOD domain-containing protein	NA	A0A1C3NFB0	Phage_NCTB	36.6	2.5e-26
WP_010793854.1|5025112_5026495_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003085524.1|5026487_5027159_-	response regulator	NA	NA	NA	NA	NA
WP_059301322.1|5027369_5028653_+	OprD family porin	NA	NA	NA	NA	NA
WP_003085519.1|5028682_5029666_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
5029381:5029397	attL	GCCGGAGGCGGCGATGG	NA	NA	NA	NA
WP_023114050.1|5029714_5030185_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_003120784.1|5030195_5031713_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_003114172.1|5031705_5032743_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_003106436.1|5032869_5033565_-	uracil-DNA glycosylase	NA	A0A0A7D9F8	Equid_alphaherpesvirus	45.2	1.0e-49
WP_003106439.1|5033664_5034486_-	VanW family protein	NA	NA	NA	NA	NA
WP_003106441.1|5034542_5035424_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023114048.1|5035556_5037065_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_023114047.1|5037076_5038240_+	isobutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003085498.1|5038305_5039124_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_019372102.1|5039182_5040286_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_023114046.1|5040397_5041294_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003085490.1|5041350_5041995_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_003110820.1|5042110_5042752_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023112778.1|5042786_5044763_-	alkyl/aryl-sulfatase	NA	M1I0S7	Paramecium_bursaria_Chlorella_virus	44.9	8.1e-161
WP_003116515.1|5044865_5045780_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003098351.1|5045783_5045972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085479.1|5046094_5046340_-	DUF1145 domain-containing protein	NA	NA	NA	NA	NA
WP_003114164.1|5046456_5046912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003098355.1|5047007_5047187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003114162.1|5047419_5048496_+	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_003098357.1|5048492_5049308_+	DUF4824 family protein	NA	NA	NA	NA	NA
WP_003120794.1|5049328_5049601_+	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_003114159.1|5049600_5050293_+	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
WP_003098363.1|5050428_5051472_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003114158.1|5051551_5052289_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_016263849.1|5052740_5053643_+	(R)-3-hydroxydecanoyl-ACP:CoA transacylase	NA	NA	NA	NA	NA
WP_023114045.1|5054655_5055711_-|portal	phage portal protein	portal	Q9ZXM6	Pseudomonas_virus	97.1	1.7e-197
WP_031275675.1|5055707_5057471_-|terminase	terminase ATPase subunit family protein	terminase	Q9ZXM5	Pseudomonas_virus	100.0	0.0e+00
WP_023089196.1|5057626_5058448_+|capsid	GPO family capsid scaffolding protein	capsid	Q9ZXM4	Pseudomonas_virus	99.6	3.4e-129
WP_023091259.1|5058483_5059500_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	99.4	1.7e-191
WP_023114941.1|5059505_5060207_+|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	98.7	1.1e-123
WP_023083460.1|5060310_5060772_+|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	98.0	3.1e-79
WP_003098378.1|5060771_5060984_+|tail	tail protein X	tail	Q9ZXL9	Pseudomonas_virus	94.1	4.9e-32
WP_003098379.1|5061008_5061362_+	hypothetical protein	NA	Q9ZXL8	Pseudomonas_virus	100.0	6.0e-59
WP_003098380.1|5061363_5061636_+|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	97.8	2.6e-38
WP_023115051.1|5061632_5062439_+	N-acetylmuramidase family protein	NA	Q9ZXL6	Pseudomonas_virus	96.2	1.0e-141
WP_016852029.1|5062435_5062678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016852030.1|5062674_5063136_+	peptidase	NA	Q9ZXL5	Pseudomonas_virus	87.6	5.3e-63
WP_016852031.1|5063213_5063750_+|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	98.9	7.9e-95
WP_016852032.1|5063742_5064201_+	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	89.5	7.0e-68
WP_016852033.1|5064270_5064843_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	98.9	3.6e-93
WP_016852034.1|5064839_5065184_+	GPW/gp25 family protein	NA	Q9ZXK9	Pseudomonas_virus	97.4	7.9e-56
WP_023115050.1|5065180_5066095_+|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	94.1	4.4e-154
WP_015967199.1|5066094_5066631_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	100.0	1.4e-99
WP_059301320.1|5066632_5069023_+|tail	phage tail protein	tail	Q9ZXK6	Pseudomonas_virus	89.3	0.0e+00
WP_023115048.1|5069074_5069536_+	hypothetical protein	NA	Q9ZXK5	Pseudomonas_virus	53.9	8.5e-37
WP_023115047.1|5069626_5070802_+|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	98.5	2.3e-219
WP_057427955.1|5070858_5071374_+|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	94.2	7.4e-90
WP_016852041.1|5071428_5071758_+|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	95.4	1.5e-48
WP_003098394.1|5071766_5071886_+|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	100.0	1.8e-15
WP_023115045.1|5071875_5074635_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	92.3	0.0e+00
WP_003098399.1|5074640_5075081_+|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	99.3	1.8e-76
WP_023115044.1|5075077_5076361_+	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	97.4	1.4e-235
WP_023114951.1|5076421_5077225_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	37.3	1.5e-44
WP_023114952.1|5077221_5078418_-	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_124119585.1|5078414_5078912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049262809.1|5079119_5079572_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020750421.1|5079616_5079847_+	phage-associated protein, BcepMu gp16 family	NA	NA	NA	NA	NA
WP_031637512.1|5079876_5080350_+	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	69.5	3.3e-52
WP_023114954.1|5080357_5080576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023089222.1|5080574_5080766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098408.1|5080768_5081062_+	ogr/Delta-like zinc finger family protein	NA	Q9ZXJ1	Pseudomonas_virus	99.0	1.1e-50
WP_003098409.1|5081058_5081409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023115041.1|5081480_5081714_+	hypothetical protein	NA	Q9ZXI9	Pseudomonas_virus	98.7	2.9e-38
WP_023115040.1|5081710_5084431_+	toprim domain-containing protein	NA	Q9ZXI8	Pseudomonas_virus	99.0	0.0e+00
WP_023089226.1|5084475_5084829_+	hypothetical protein	NA	Q9ZXI7	Pseudomonas_virus	97.4	2.4e-60
WP_003098417.1|5084840_5085047_+	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	100.0	7.3e-33
WP_023115039.1|5085350_5087261_+	DNA cytosine methyltransferase	NA	A0A0U1T6D1	Pseudomonas_phage	94.3	6.6e-285
WP_023115038.1|5087257_5088490_+	phosphoadenosine phosphosulfate reductase family protein	NA	R9TRT5	Rhizobium_phage	72.1	7.2e-176
WP_016852058.1|5088500_5088677_+	hypothetical protein	NA	Q38017	Pseudomonas_virus	70.6	5.5e-05
WP_016852059.1|5088673_5089042_+	ASCH domain-containing protein	NA	A0A291AUQ6	Sinorhizobium_phage	50.4	2.7e-30
WP_003098423.1|5089234_5089438_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_023115037.1|5089444_5090647_-|integrase	integrase family protein	integrase	A0A248SL35	Klebsiella_phage	30.9	2.2e-36
WP_023093099.1|5091084_5092938_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U1UNT3	Pseudomonas_phage	51.0	6.5e-104
WP_013721909.1|5092973_5093417_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_013721908.1|5093498_5095901_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	41.3	2.5e-140
5094281:5094297	attR	GCCGGAGGCGGCGATGG	NA	NA	NA	NA
>prophage 6
NZ_CP008871	Pseudomonas aeruginosa strain W45909 chromosome, complete genome	6777566	5165726	5207385	6777566	protease,transposase	Cyanophage(12.5%)	40	NA	NA
WP_023115023.1|5165726_5166821_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_023101524.1|5167205_5168285_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016446188.1|5168929_5169307_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012761384.1|5169591_5169873_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_059301278.1|5169908_5170478_+	Hsp20/alpha crystallin family protein	NA	A0A1D7SX46	Cyanophage	27.1	6.2e-05
WP_059301272.1|5170571_5173421_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	40.9	1.5e-128
WP_059301270.1|5173437_5174868_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_023093172.1|5174895_5176779_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	40.9	5.1e-104
WP_059301268.1|5176775_5177216_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	37.9	5.8e-11
WP_059301266.1|5177370_5180178_+	GGDEF and EAL domain-containing protein	NA	G3MA91	Bacillus_virus	38.7	2.3e-28
WP_023093176.1|5180361_5180862_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_059301264.1|5180839_5181805_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_059301262.1|5181829_5182981_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_059301260.1|5183214_5184123_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031637502.1|5184445_5184922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003120795.1|5185153_5185447_-	DUF2845 domain-containing protein	NA	NA	NA	NA	NA
WP_003085431.1|5185786_5186044_+	YjhX family toxin	NA	NA	NA	NA	NA
WP_016253819.1|5186103_5186610_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_016253820.1|5186653_5187049_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_003085421.1|5187093_5187390_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_016253821.1|5187505_5188360_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016253822.1|5188645_5189425_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003120801.1|5189517_5190156_+	type B chloramphenicol O-acetyltransferase	NA	M1HS53	Paramecium_bursaria_Chlorella_virus	32.4	3.1e-13
WP_003098436.1|5190410_5191313_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	40.8	1.1e-11
WP_003116522.1|5191346_5191967_+	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	39.6	2.2e-27
WP_003098438.1|5192093_5193488_+	amidase	NA	NA	NA	NA	NA
WP_003123056.1|5193558_5194875_+	MFS transporter	NA	NA	NA	NA	NA
WP_003085391.1|5194953_5195859_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_003116524.1|5195841_5196507_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003098443.1|5196578_5197565_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003110838.1|5197574_5198000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003116526.1|5197999_5198944_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_003085375.1|5198948_5199428_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_003116527.1|5199456_5200119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003455035.1|5200153_5201860_-	putative porin	NA	NA	NA	NA	NA
WP_003098450.1|5201927_5202674_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_003085366.1|5202682_5203102_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_003110841.1|5203112_5204960_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_003110842.1|5204983_5206618_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_003085362.1|5206782_5207385_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP008871	Pseudomonas aeruginosa strain W45909 chromosome, complete genome	6777566	6227561	6318050	6777566	terminase,head,holin,protease,tRNA,tail,transposase,portal,capsid,plate,integrase	Pseudomonas_virus(76.09%)	99	6277736:6277751	6322037:6322052
WP_003104666.1|6227561_6228023_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_003096050.1|6228081_6228573_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_023114929.1|6228609_6228864_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	43.4	4.7e-13
WP_003096058.1|6228865_6229285_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_003114478.1|6229609_6231157_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_014603391.1|6231470_6232289_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_031637483.1|6232438_6233725_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	39.8	2.9e-10
WP_003123646.1|6233753_6235064_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.0	5.0e-26
WP_003096069.1|6235063_6235837_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_010793678.1|6235905_6237387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003096075.1|6237423_6238179_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003106330.1|6238328_6239081_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003106332.1|6239171_6239918_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003106334.1|6240089_6240860_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_003106336.1|6240870_6241608_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_003112624.1|6241656_6241917_-	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_003096087.1|6241920_6242559_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_003096088.1|6242558_6243152_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_003112623.1|6243312_6243711_+	acetyl-CoA sensor PanZ family protein	NA	NA	NA	NA	NA
WP_003112622.1|6243747_6243984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003112621.1|6243980_6245087_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003105535.1|6245180_6247433_+	AsmA family protein	NA	NA	NA	NA	NA
WP_004352428.1|6247429_6248497_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_003096100.1|6248540_6248813_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_003112619.1|6248840_6249923_+	oxidoreductase	NA	NA	NA	NA	NA
WP_023114931.1|6250207_6251323_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	38.4	4.0e-48
WP_023114932.1|6251634_6253713_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_023114933.1|6254064_6254457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023114934.1|6254599_6255262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023114935.1|6255280_6256483_+	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	30.1	1.5e-40
WP_023114936.1|6257034_6258081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124033778.1|6258348_6258684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023114937.1|6258684_6260940_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_124033779.1|6260936_6261251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124033780.1|6261238_6261487_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_124074571.1|6262112_6262334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031637489.1|6262389_6262842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086009326.1|6263390_6264528_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.7	7.7e-47
WP_023114938.1|6264555_6265902_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_003096148.1|6266409_6267147_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023114939.1|6267305_6267995_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_003096153.1|6268243_6269017_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.1	9.3e-20
WP_003096156.1|6269031_6269784_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016562461.1|6269845_6270541_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003096163.1|6270537_6271230_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010793675.1|6271298_6272519_+	methyltransferase	NA	NA	NA	NA	NA
WP_003110596.1|6272917_6273388_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003112617.1|6273391_6274870_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_003105511.1|6274884_6276069_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003096173.1|6276079_6277609_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
6277736:6277751	attL	TTCGACTCCTGGTGCC	NA	NA	NA	NA
WP_071534457.1|6278671_6279199_+	SocA family protein	NA	NA	NA	NA	NA
WP_124033784.1|6279629_6280049_+	hypothetical protein	NA	L7TJK7	Pseudomonas_virus	38.8	2.2e-23
WP_023114940.1|6280045_6281101_-|portal	phage portal protein	portal	Q9ZXM6	Pseudomonas_virus	96.5	6.0e-195
WP_031643136.1|6281100_6282861_-|terminase	terminase ATPase subunit family protein	terminase	Q9ZXM5	Pseudomonas_virus	99.8	0.0e+00
WP_023121181.1|6283016_6283838_+|capsid	GPO family capsid scaffolding protein	capsid	Q9ZXM4	Pseudomonas_virus	98.9	2.2e-128
WP_016852024.1|6283873_6284890_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	99.1	6.6e-191
WP_023083461.1|6284895_6285597_+|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	98.7	6.2e-124
WP_023116818.1|6285700_6286162_+|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	97.4	6.8e-79
WP_003098378.1|6286161_6286374_+|tail	tail protein X	tail	Q9ZXL9	Pseudomonas_virus	94.1	4.9e-32
WP_003098379.1|6286398_6286752_+	hypothetical protein	NA	Q9ZXL8	Pseudomonas_virus	100.0	6.0e-59
WP_003098380.1|6286753_6287026_+|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	97.8	2.6e-38
WP_023114944.1|6287022_6287829_+	N-acetylmuramidase family protein	NA	Q9ZXL6	Pseudomonas_virus	96.9	9.0e-143
WP_016852029.1|6287825_6288068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016852030.1|6288064_6288526_+	peptidase	NA	Q9ZXL5	Pseudomonas_virus	87.6	5.3e-63
WP_016852031.1|6288603_6289140_+|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	98.9	7.9e-95
WP_023089204.1|6289132_6289591_+	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	91.3	9.8e-70
WP_023089205.1|6289600_6290029_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023089206.1|6290206_6290779_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	96.8	9.7e-91
WP_023089207.1|6290775_6291120_+	GPW/gp25 family protein	NA	Q9ZXK9	Pseudomonas_virus	97.4	4.6e-56
WP_023114945.1|6291116_6292031_+|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	96.7	7.0e-160
WP_023091255.1|6292030_6292567_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	99.4	3.1e-99
WP_023114946.1|6294922_6295387_+	hypothetical protein	NA	Q9ZXK5	Pseudomonas_virus	60.7	2.3e-42
WP_023114947.1|6295477_6296653_+|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	98.5	2.3e-219
WP_023114948.1|6296709_6297225_+|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	94.2	2.1e-89
WP_023083449.1|6297279_6297609_+|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	96.3	5.3e-49
WP_003098394.1|6297617_6297737_+|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	100.0	1.8e-15
WP_023114949.1|6297726_6300474_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	94.1	0.0e+00
WP_003098399.1|6300479_6300920_+|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	99.3	1.8e-76
WP_023121182.1|6300916_6302203_+	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	96.2	3.1e-230
WP_071534455.1|6302424_6302964_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_031633861.1|6303086_6303620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023096284.1|6303673_6304024_-	hypothetical protein	NA	Q9ZXJ5	Pseudomonas_virus	89.6	2.9e-53
WP_031643138.1|6304341_6304698_-	helix-turn-helix transcriptional regulator	NA	E5E3P4	Burkholderia_phage	42.1	2.0e-06
WP_031643139.1|6304782_6304995_+	hypothetical protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	46.8	1.9e-07
WP_031293865.1|6305024_6305495_+	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	93.6	2.5e-76
WP_003098408.1|6305491_6305785_+	ogr/Delta-like zinc finger family protein	NA	Q9ZXJ1	Pseudomonas_virus	99.0	1.1e-50
WP_023096288.1|6305781_6306132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098410.1|6306202_6306436_+	hypothetical protein	NA	Q9ZXI9	Pseudomonas_virus	100.0	7.8e-39
WP_023121183.1|6306432_6309153_+	toprim domain-containing protein	NA	Q9ZXI8	Pseudomonas_virus	96.6	0.0e+00
WP_023114956.1|6309197_6309551_+	hypothetical protein	NA	Q9ZXI7	Pseudomonas_virus	97.4	2.4e-60
WP_003098417.1|6309562_6309769_+	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	100.0	7.3e-33
WP_023114957.1|6310072_6311758_+	hypothetical protein	NA	L7TH64	Pseudomonas_virus	90.8	4.8e-287
WP_023114958.1|6311768_6311957_+	hypothetical protein	NA	Q38017	Pseudomonas_virus	76.5	7.0e-06
WP_023114959.1|6311953_6312166_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_023114960.1|6312162_6313311_+	hypothetical protein	NA	V9IQN0	Stenotrophomonas_phage	40.5	1.8e-72
WP_023114961.1|6313603_6313774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023114962.1|6313777_6314284_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_023114963.1|6314819_6316139_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	34.2	1.2e-64
WP_023114964.1|6317069_6318050_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
6322037:6322052	attR	TTCGACTCCTGGTGCC	NA	NA	NA	NA
