The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008860	Pseudomonas aeruginosa strain H27930 chromosome, complete genome	6568228	653377	709002	6568228	plate,tRNA,tail	Pseudomonas_phage(26.92%)	56	NA	NA
WP_009875776.1|653377_654403_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	8.3e-109
WP_003085061.1|654481_655051_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|655134_655488_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003099585.1|655478_656021_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003113214.1|655993_657226_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	3.5e-77
WP_023088786.1|657269_657776_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|657869_659423_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|659419_660691_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|660791_662714_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|662992_663325_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003099572.1|663368_664220_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2R4ALP3	Aeromonas_phage	44.2	2.4e-08
WP_003085085.1|664219_664600_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003099569.1|664636_665443_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003099567.1|665558_666545_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|666541_667834_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003099560.1|667814_670586_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_043091292.1|670718_672431_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	82.0	2.7e-282
WP_003099554.1|673702_674719_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003099549.1|674715_675390_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003099547.1|675391_676150_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_003099546.1|676150_677212_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
WP_003099544.1|677363_679757_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003085103.1|679802_680435_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|680563_681598_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|681831_682941_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003099539.1|682996_684043_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003109044.1|684157_685405_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003099535.1|685510_686341_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|686464_687139_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003099532.1|687138_687957_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_016852412.1|688029_689508_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003121843.1|689694_690009_-	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
WP_003113202.1|690108_690879_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
WP_003085132.1|691336_691537_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003459419.1|691584_691944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118908.1|692306_692756_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003101620.1|692777_693293_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	1.8e-32
WP_003085141.1|693289_693847_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	71.1	4.6e-45
WP_003085143.1|693999_694326_+	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_003085151.1|694322_695210_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
WP_003137385.1|695202_695736_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	5.2e-62
WP_003101626.1|695737_697846_+|tail	phage tail protein	tail	Q9ZXK6	Pseudomonas_virus	52.1	2.5e-224
WP_003085172.1|697854_698295_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_003109051.1|698337_699498_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	2.7e-188
WP_003085175.1|699510_700014_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085178.1|700028_700373_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_003101633.1|700542_702780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003085182.1|702789_703662_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.9e-75
WP_003101635.1|703636_703843_+|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_003101637.1|703900_704890_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	2.2e-106
WP_003085188.1|704922_705552_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.5	3.2e-87
WP_003101639.1|705548_705911_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	1.9e-15
WP_003118919.1|705907_706165_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003101640.1|706512_707118_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	65.8	6.0e-75
WP_003085203.1|707119_708169_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085205.1|708165_709002_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
>prophage 2
NZ_CP008860	Pseudomonas aeruginosa strain H27930 chromosome, complete genome	6568228	1491735	1500764	6568228		Bacillus_phage(33.33%)	8	NA	NA
WP_003098558.1|1491735_1492371_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_003115226.1|1492416_1493310_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1493414_1494419_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|1494845_1495169_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003113873.1|1495235_1497803_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
WP_003098486.1|1497928_1498936_-	TolB family protein	NA	NA	NA	NA	NA
WP_003092262.1|1499083_1499590_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003092260.1|1499723_1500764_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 3
NZ_CP008860	Pseudomonas aeruginosa strain H27930 chromosome, complete genome	6568228	2600899	2607793	6568228	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_003097631.1|2600899_2602180_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_003097630.1|2602181_2603579_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097628.1|2603583_2604558_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003097625.1|2604645_2605629_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	3.5e-141
WP_003119979.1|2605625_2605961_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	1.5e-38
WP_003090391.1|2605957_2606263_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2606262_2606622_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003097619.1|2606618_2607014_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	71.3	4.5e-47
WP_003090386.1|2607124_2607793_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
>prophage 4
NZ_CP008860	Pseudomonas aeruginosa strain H27930 chromosome, complete genome	6568228	2934691	2973155	6568228	plate,tail	Planktothrix_phage(33.33%)	33	NA	NA
WP_003103608.1|2934691_2935975_-|tail	pyoverdine-tailoring periplasmic protein PvdN	tail	NA	NA	NA	NA
WP_003103610.1|2935997_2937344_-|tail	pyoverdine-tailoring dipeptidase-like protein PvdM	tail	NA	NA	NA	NA
WP_020750571.1|2937559_2939194_+	pyoverdine maturation tyrosinase PvdP	NA	NA	NA	NA	NA
WP_020989355.1|2939242_2940667_-	pyoverdine export/recycling transporter outer membrane subunit OmpQ	NA	NA	NA	NA	NA
WP_059309506.1|2940672_2942637_-	pyoverdine export/recycling transporter ATP-binding/permease subunit PvdT	NA	G9BWD6	Planktothrix_phage	41.9	8.9e-35
WP_003089547.1|2942664_2943840_-	pyoverdine export/recycling transporter periplasmic adaptor subunit PvdR	NA	NA	NA	NA	NA
WP_003158770.1|2943940_2944936_-	FecR family protein	NA	NA	NA	NA	NA
WP_003103620.1|2945099_2945579_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003103622.1|2945711_2947043_+	L-ornithine N(5)-monooxygenase	NA	NA	NA	NA	NA
WP_003103624.1|2947165_2949454_+	acylase	NA	NA	NA	NA	NA
WP_003089535.1|2949634_2949958_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003124571.1|2949999_2950920_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003104946.1|2951016_2952168_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003089526.1|2952234_2952477_-	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_003104944.1|2952771_2953008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003089521.1|2953273_2953744_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_003104941.1|2953740_2956056_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_003104937.1|2956472_2957678_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003104935.1|2957878_2958520_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003089513.1|2958796_2959192_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_003104933.1|2959214_2959751_-	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_003104932.1|2959761_2961768_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.3	1.7e-41
WP_003104930.1|2961767_2961956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003122693.1|2962115_2962688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003104929.1|2962709_2965259_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.4	1.2e-76
WP_003104928.1|2965260_2966277_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_003160312.1|2966240_2968034_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_031632859.1|2968017_2968443_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003089495.1|2968455_2968953_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003089494.1|2969026_2970511_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003089493.1|2970533_2971079_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_003124582.1|2971287_2971764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023088798.1|2971823_2973155_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 5
NZ_CP008860	Pseudomonas aeruginosa strain H27930 chromosome, complete genome	6568228	3668078	3670986	6568228	holin	Pseudomonas_virus(50.0%)	6	NA	NA
WP_009314099.1|3668078_3668345_-	hypothetical protein	NA	L7TP56	Pseudomonas_virus	98.9	1.4e-44
WP_079760327.1|3668382_3669012_-	DUF4124 domain-containing protein	NA	A0A2K8IBL8	Pseudomonas_phage	61.2	6.1e-54
WP_059309552.1|3669088_3669682_-	DUF1737 domain-containing protein	NA	A0A0U1VYP2	Pseudomonas_phage	98.0	2.9e-74
WP_059309553.1|3669692_3670214_-	hypothetical protein	NA	L7THB0	Pseudomonas_virus	84.4	4.3e-61
WP_059309554.1|3670217_3670745_-	glycoside hydrolase family protein	NA	L7TJR2	Pseudomonas_virus	95.4	6.0e-95
WP_015975423.1|3670728_3670986_-|holin	holin	holin	A0A0U1UNM6	Pseudomonas_phage	100.0	2.1e-37
>prophage 6
NZ_CP008860	Pseudomonas aeruginosa strain H27930 chromosome, complete genome	6568228	3684720	3727357	6568228	terminase	Pseudomonas_phage(85.71%)	50	NA	NA
WP_071557749.1|3684720_3685971_-	DnaJ domain-containing protein	NA	A0A1E1EVQ1	Acanthamoeba_castellanii_mimivirus	42.6	4.2e-06
WP_042931354.1|3686082_3687975_-	hypothetical protein	NA	A0A0U1SZM6	Pseudomonas_phage	99.7	9.4e-183
WP_186278396.1|3687975_3688401_-	hypothetical protein	NA	Q5QF56	Pseudomonas_virus	99.3	7.2e-75
WP_186278397.1|3688408_3689140_-	hypothetical protein	NA	A0A0U1VZM6	Pseudomonas_phage	100.0	1.2e-05
WP_059309558.1|3689132_3691730_-	hypothetical protein	NA	A0A0U1W0G7	Pseudomonas_phage	99.5	0.0e+00
WP_004349221.1|3691734_3692325_-	hypothetical protein	NA	A0A0U1VYN6	Pseudomonas_phage	100.0	1.3e-101
WP_033937567.1|3692392_3693583_-	hypothetical protein	NA	A0A2K8HL79	Pseudomonas_phage	99.7	1.6e-225
WP_059309559.1|3693582_3696546_-	hypothetical protein	NA	A0A2K8HKA1	Pseudomonas_phage	97.2	0.0e+00
WP_004354920.1|3696548_3697406_-	hypothetical protein	NA	A0A0U1VYN7	Pseudomonas_phage	100.0	4.0e-157
WP_177289652.1|3697405_3697738_-	hypothetical protein	NA	A0A2K8HN63	Pseudomonas_phage	99.1	2.5e-62
WP_004349209.1|3697854_3698262_-	hypothetical protein	NA	A0A0U1UNR7	Pseudomonas_phage	100.0	8.7e-70
WP_004349207.1|3698242_3698449_-	hypothetical protein	NA	A0A0U1SXT5	Pseudomonas_phage	100.0	1.3e-29
WP_034085194.1|3698445_3699123_-	hypothetical protein	NA	A0A0U1UNR8	Pseudomonas_phage	98.2	2.4e-128
WP_059309560.1|3699119_3699992_-	hypothetical protein	NA	A0A0U1UNM5	Pseudomonas_phage	99.7	1.8e-165
WP_015975422.1|3700056_3700536_-	hypothetical protein	NA	A0A0U1W0G3	Pseudomonas_phage	100.0	2.9e-80
WP_023082376.1|3700594_3701887_-	DUF4043 family protein	NA	A0A0U1VYN1	Pseudomonas_phage	100.0	2.2e-252
WP_070147884.1|3701899_3703030_-	hypothetical protein	NA	A0A0U1T6E0	Pseudomonas_phage	100.0	5.1e-176
WP_023082375.1|3703176_3705495_-	hypothetical protein	NA	A0A2K8HKC3	Pseudomonas_phage	99.7	0.0e+00
WP_171885176.1|3705504_3706698_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2K8HZU7	Pseudomonas_phage	99.5	8.1e-241
WP_128448280.1|3706784_3707210_-	hypothetical protein	NA	A0A2K8HN72	Pseudomonas_phage	99.3	1.2e-74
WP_023980885.1|3707503_3707728_+	hypothetical protein	NA	A0A0U1UNS7	Pseudomonas_phage	98.6	2.7e-33
WP_004349189.1|3707730_3708225_-	hypothetical protein	NA	A0A0U1VYN2	Pseudomonas_phage	99.4	3.2e-82
WP_023082373.1|3708303_3708918_-	recombination protein NinG	NA	A0A0U1VZM0	Pseudomonas_phage	98.5	9.0e-111
WP_059309561.1|3708973_3709537_-	hypothetical protein	NA	A0A2K8I9A9	Pseudomonas_phage	94.1	4.1e-94
WP_021264627.1|3709529_3710387_-	hypothetical protein	NA	A0A2K8HNW6	Pseudomonas_phage	99.6	8.4e-147
WP_004354958.1|3711379_3711619_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	54.1	3.2e-11
WP_004349171.1|3712712_3712886_+	hypothetical protein	NA	A0A0U1W076	Pseudomonas_phage	100.0	1.1e-24
WP_033991554.1|3713165_3713429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017001707.1|3713463_3713748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079389642.1|3713810_3714023_+	hypothetical protein	NA	A0A0U1VYM8	Pseudomonas_phage	98.6	3.4e-33
WP_034051764.1|3714057_3714429_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	78.9	4.1e-50
WP_034058628.1|3714485_3715055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023091957.1|3715196_3715340_+	hypothetical protein	NA	J7HXJ0	Pseudomonas_phage	100.0	2.4e-11
WP_023091958.1|3715323_3715545_+	hypothetical protein	NA	A0A0U1SZL8	Pseudomonas_phage	95.9	7.1e-34
WP_004354971.1|3715541_3715913_+	hypothetical protein	NA	A0A2K8HNX4	Pseudomonas_phage	99.2	3.4e-60
WP_004354975.1|3716025_3716163_+	hypothetical protein	NA	A0A2K8HLA8	Pseudomonas_phage	67.4	6.0e-07
WP_023091960.1|3716183_3716882_+	ERF family protein	NA	A0A1Y0T023	Pseudomonas_phage	54.3	1.2e-31
WP_023091961.1|3716878_3718516_+	YqaJ viral recombinase family protein	NA	A0A2H4J6F0	uncultured_Caudovirales_phage	63.1	5.5e-139
WP_034010291.1|3718637_3719243_+	3'-5' exonuclease	NA	A0A0U1W072	Pseudomonas_phage	99.5	4.7e-112
WP_034010289.1|3719246_3719744_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	100.0	9.9e-92
WP_079760328.1|3719770_3720991_+	recombination-associated protein RdgC	NA	L7TP07	Pseudomonas_virus	97.4	2.2e-161
WP_004355019.1|3721096_3721411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079760346.1|3721638_3722163_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_059309564.1|3722454_3724368_+	DNA cytosine methyltransferase	NA	A0A0U1T6D1	Pseudomonas_phage	90.5	1.1e-276
WP_124117576.1|3724724_3725579_-	DUF3825 domain-containing protein	NA	NA	NA	NA	NA
WP_124117578.1|3725707_3726073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046688615.1|3726069_3726537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153603913.1|3726588_3726753_+	hypothetical protein	NA	A0A2K8HK84	Pseudomonas_phage	95.0	1.9e-12
WP_059309565.1|3726701_3727172_+	hypothetical protein	NA	H2BD36	Pseudomonas_phage	98.7	2.8e-80
WP_016046701.1|3727123_3727357_+	AlpA family phage regulatory protein	NA	H2BDA4	Pseudomonas_phage	100.0	4.9e-41
>prophage 7
NZ_CP008860	Pseudomonas aeruginosa strain H27930 chromosome, complete genome	6568228	4896454	4904870	6568228	capsid,integrase	Pseudomonas_phage(90.0%)	12	4896098:4896129	4906604:4906635
4896098:4896129	attL	GAGGGTTCGATTCCCTTCGCCCGCTCCAGATC	NA	NA	NA	NA
WP_003454974.1|4896454_4897450_-|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	52.6	3.6e-93
WP_003454977.1|4897449_4898742_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	94.2	2.8e-247
WP_025297678.1|4898971_4900246_-	zonular occludens toxin family protein	NA	Q56VN9	Pseudomonas_phage	87.1	2.8e-199
WP_003114150.1|4900249_4900606_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
WP_074202155.1|4900610_4901891_-	attachment protein	NA	Q56VP1	Pseudomonas_phage	56.0	7.3e-46
WP_034008539.1|4902038_4902287_-|capsid	major capsid protein	capsid	Q56VP2	Pseudomonas_phage	90.2	5.7e-32
WP_003115979.1|4902299_4902551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059309614.1|4902672_4903107_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	97.9	9.3e-62
WP_059309616.1|4903622_4903913_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	97.9	5.6e-55
WP_031636588.1|4903916_4904129_-	hypothetical protein	NA	Q56VP8	Pseudomonas_phage	92.9	1.9e-31
WP_003159564.1|4904130_4904346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078463557.1|4904447_4904870_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	37.5	1.1e-06
4906604:4906635	attR	GAGGGTTCGATTCCCTTCGCCCGCTCCAGATC	NA	NA	NA	NA
