The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013994	Enterococcus faecium strain 6E6, complete genome	2966909	412202	482834	2966909	tRNA,transposase	Streptococcus_phage(26.67%)	58	NA	NA
WP_002289325.1|412202_414212_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	38.3	1.4e-96
WP_000195429.1|414595_415768_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_002293998.1|416022_416610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294000.1|416784_418107_+	amino acid permease	NA	NA	NA	NA	NA
WP_002294001.1|418261_419038_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_002305490.1|419030_419600_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_002294004.1|419592_420477_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_002294011.1|420927_421557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289507.1|421680_422790_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	33.0	1.2e-20
WP_002289508.1|422998_423421_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002289509.1|423743_424280_+	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_002289511.1|424319_426083_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	1.5e-44
WP_002294013.1|426085_427801_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	1.7e-50
WP_002294014.1|428579_428804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302892.1|429003_431772_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002287112.1|431852_432272_+	PTS mannose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002287114.1|432283_432754_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002287115.1|432770_433550_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002287116.1|433536_434358_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_059355907.1|434374_435424_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002287119.1|435436_436441_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002287121.1|437073_438093_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002297404.1|438258_439509_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002287122.1|439918_440800_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.3	1.3e-73
WP_002294021.1|441099_441477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287124.1|442082_442697_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002294022.1|443469_445209_+	putative basic amino acid antiporter YfcC	NA	NA	NA	NA	NA
WP_002287126.1|445365_446550_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_002287127.1|446660_446864_+	CsbD family protein	NA	NA	NA	NA	NA
WP_002287128.1|446964_447627_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	2.5e-21
WP_059355908.1|447639_449142_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287130.1|449689_451369_+	ribonuclease J	NA	NA	NA	NA	NA
WP_002287132.1|451495_451975_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_002287133.1|452193_452874_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_002287134.1|452881_454213_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002287135.1|454227_455190_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_002287137.1|455300_455639_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_002287139.1|455717_456425_+	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_002297185.1|456589_457885_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002287140.1|458049_459531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287143.1|459839_460376_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287145.1|460453_461824_+	NOL1/NOP2/sun family putative RNA methylase	NA	NA	NA	NA	NA
WP_002287147.1|461890_462226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059355909.1|462306_463164_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287154.1|463270_463786_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_002287155.1|464102_465488_+	multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_002287156.1|465524_466202_+	YutD family protein	NA	NA	NA	NA	NA
WP_002287159.1|466209_466974_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_002287161.1|466975_467635_+	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_002287163.1|467664_468174_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	56.1	1.5e-39
WP_002287165.1|468285_469284_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	54.1	2.6e-30
WP_002297404.1|469608_470859_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002287167.1|471267_471852_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	43.4	2.0e-27
WP_002296072.1|471927_473103_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002287231.1|473184_473565_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002287172.1|473638_474001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302440.1|479979_481281_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_086956687.1|481671_482834_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
>prophage 2
NZ_CP013994	Enterococcus faecium strain 6E6, complete genome	2966909	495255	535271	2966909	tRNA,terminase,head,tail,portal,plate	Enterococcus_phage(34.78%)	47	NA	NA
WP_002287955.1|495255_496467_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_002287954.1|497039_497687_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287953.1|498079_500725_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.9	4.0e-163
WP_002294071.1|501034_502348_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002287951.1|502337_502991_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_002304462.1|503045_503717_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_002303263.1|503611_504964_-	recombinase family protein	NA	D2IZV7	Enterococcus_phage	55.3	1.7e-133
WP_002303264.1|505029_506319_-	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	74.0	5.6e-46
WP_002303265.1|506405_507110_-	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	42.4	6.2e-39
WP_002303266.1|507309_507576_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JP54	Staphylococcus_phage	52.7	5.4e-12
WP_002304464.1|507743_507974_-	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	49.3	4.4e-10
WP_002299038.1|508045_508201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304466.1|508509_508749_-	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	81.1	1.8e-27
WP_002303273.1|509000_509336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303275.1|509568_510510_+	endonuclease	NA	D2IZK1	Enterococcus_phage	78.9	2.7e-146
WP_002303277.1|510511_511402_+	hypothetical protein	NA	D2IYT9	Enterococcus_phage	84.5	6.2e-137
WP_002303278.1|511444_512245_+	hypothetical protein	NA	B4XYS6	Lactobacillus_phage	54.5	8.9e-58
WP_002299339.1|512259_513111_+	AAA family ATPase	NA	A0A0P0I3L9	Lactobacillus_phage	30.2	2.3e-27
WP_002317474.1|513107_513425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305847.1|513417_513600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303279.1|513601_514072_+	hypothetical protein	NA	A0A0A7RWK2	Clostridium_phage	33.8	9.6e-12
WP_002303280.1|514068_514611_+	DUF1642 domain-containing protein	NA	Q8W5X2	Listeria_phage	40.7	3.9e-17
WP_002303281.1|514607_514991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303282.1|514987_515218_+	hypothetical protein	NA	A0A0S2MYD2	Enterococcus_phage	52.1	1.6e-12
WP_002303283.1|515224_515428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303285.1|515424_515721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303286.1|515797_516211_+	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	5.6e-56
WP_002303288.1|516223_516610_+	hypothetical protein	NA	O34053	Streptococcus_phage	53.5	1.6e-28
WP_002303289.1|517559_517820_+	hypothetical protein	NA	A0A0S2MYE7	Enterococcus_phage	51.1	7.9e-16
WP_002303291.1|518424_519258_+|terminase	small subunit of terminase	terminase	D2IYW0	Enterococcus_phage	68.8	1.5e-79
WP_002298064.1|519250_520666_+	hypothetical protein	NA	C9E2I7	Enterococcus_phage	79.7	1.0e-218
WP_002303292.1|520677_522207_+|portal	phage portal protein	portal	A0A0S2MVB2	Bacillus_phage	25.0	1.3e-28
WP_002298060.1|522298_523177_+|head	phage head morphogenesis protein	head	NA	NA	NA	NA
WP_002298058.1|523178_523496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002349163.1|523544_524246_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_002303293.1|524260_525151_+	DUF5309 domain-containing protein	NA	NA	NA	NA	NA
WP_002311614.1|525173_525389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002298050.1|525400_525742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002298048.1|525741_526113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002298046.1|526105_526501_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_002298045.1|526502_526880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303295.1|526880_527489_+|tail	tail protein	tail	NA	NA	NA	NA
WP_002303297.1|527488_527830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305859.1|528071_530861_+	tape measure protein	NA	D7RWD8	Brochothrix_phage	40.2	8.4e-71
WP_002303299.1|530850_531591_+|tail	tail protein	tail	NA	NA	NA	NA
WP_002347081.1|531587_534350_+	CHAP domain-containing protein	NA	Q9AZX5	Lactococcus_phage	39.1	6.0e-138
WP_002332773.1|534362_535271_+|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
>prophage 3
NZ_CP013994	Enterococcus faecium strain 6E6, complete genome	2966909	740205	812141	2966909	tRNA,transposase	Streptococcus_phage(25.0%)	60	NA	NA
WP_002348661.1|740205_742281_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002348662.1|742660_743440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296209.1|743485_744430_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_002348663.1|744445_745225_+	tyrosine protein kinase	NA	NA	NA	NA	NA
WP_002348664.1|745236_745935_+	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	37.1	6.0e-26
WP_002312256.1|745962_746727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002312258.1|747047_748499_+	sugar transferase	NA	NA	NA	NA	NA
WP_002312259.1|748876_750127_+	nucleotide sugar dehydrogenase	NA	M1IB49	Acanthocystis_turfacea_Chlorella_virus	50.4	8.9e-105
WP_002325817.1|750140_750602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291721.1|750618_751098_+	EpsH	NA	NA	NA	NA	NA
WP_002312264.1|751117_752185_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002312270.1|752752_753814_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	36.5	1.5e-12
WP_002348666.1|754131_754722_+	poly-gamma-glutamate biosynthesis protein	NA	NA	NA	NA	NA
WP_002312274.1|754748_756059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002312275.1|756055_756775_+	glycosyl transferase	NA	A0A2K9L639	Tupanvirus	25.0	2.6e-08
WP_002312276.1|756789_757875_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002348669.1|758010_759543_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002312280.1|759720_759942_+	transferase	NA	NA	NA	NA	NA
WP_002312281.1|760523_761141_+	VanZ family protein	NA	NA	NA	NA	NA
WP_002312282.1|761137_761668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010782560.1|762533_763493_-|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
WP_002312284.1|764297_764498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002312285.1|764676_765627_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_002289551.1|766064_766340_-	acylphosphatase	NA	NA	NA	NA	NA
WP_059355914.1|766447_767212_+	RNA methyltransferase	NA	A0A2D1A6G0	Rhodococcus_phage	26.1	1.7e-05
WP_002291751.1|767334_767838_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_002289547.1|769054_770323_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.1	2.2e-42
WP_002340453.1|770349_771549_-	YdcF family protein	NA	NA	NA	NA	NA
WP_002304680.1|771667_772975_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_002288760.1|773445_774564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|775015_776311_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002323868.1|776588_776909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288762.1|777360_777561_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
WP_002304681.1|777707_780497_+	DNA polymerase III subunit epsilon	NA	A0A1X9I5C8	Streptococcus_phage	30.9	1.1e-89
WP_002348809.1|780543_781071_+	peptidase	NA	NA	NA	NA	NA
WP_002305679.1|781091_782282_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002305681.1|782321_783620_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	1.2e-59
WP_002305683.1|784414_785089_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002323072.1|785085_785427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288776.1|785456_785816_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002305684.1|786339_788424_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.7	9.9e-117
WP_002288779.1|788734_790201_+	amino acid permease	NA	NA	NA	NA	NA
WP_002349135.1|790510_790984_+	hypothetical protein	NA	A0A097BYE2	Leuconostoc_phage	28.8	1.1e-10
WP_002294855.1|791057_791498_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_002289040.1|791510_791720_+	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_002349136.1|791719_793906_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.7	1.4e-121
WP_059355943.1|794048_796205_+	copper/silver-translocating P-type ATPase CopB	NA	A0A218MNH6	uncultured_virus	32.3	2.9e-71
WP_002305688.1|796316_798488_-	transglutaminase	NA	NA	NA	NA	NA
WP_002323055.1|798477_799551_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_010721082.1|799564_800413_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_002323057.1|800766_802056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294835.1|802129_802699_+	prevent-host-death protein	NA	NA	NA	NA	NA
WP_094932120.1|803072_804235_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	2.7e-79
WP_042959742.1|804315_804891_+	hypothetical protein	NA	Q9MCC6	Lactobacillus_phage	35.9	4.8e-13
WP_086953915.1|804960_806299_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_008266934.1|806578_806992_+	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_002305694.1|807223_807481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297404.1|807766_809017_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002287105.1|809426_810401_+	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	5.4e-25
WP_000195429.1|810968_812141_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
>prophage 4
NZ_CP013994	Enterococcus faecium strain 6E6, complete genome	2966909	827068	984220	2966909	tRNA,terminase,head,transposase,integrase,tail,portal,capsid,holin,protease	Streptococcus_phage(23.53%)	161	828264:828304	928917:928932
WP_002293717.1|827068_827830_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002286913.1|827965_828313_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
828264:828304	attL	TACGTGCATTACACGGAAAAGCTGCTCGTATCAAAGAAATC	NA	NA	NA	NA
WP_012197643.1|828444_829581_-|integrase	site-specific integrase	integrase	A0A1P8BMN3	Lactococcus_phage	36.8	8.4e-54
828264:828304	attL	TACGTGCATTACACGGAAAAGCTGCTCGTATCAAAGAAATC	NA	NA	NA	NA
WP_002350679.1|829696_830263_-	hypothetical protein	NA	A0A0P0IXE0	Lactobacillus_phage	92.3	1.9e-06
WP_012197642.1|830398_831052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350678.1|831101_831530_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002315392.1|831534_831909_-	helix-turn-helix transcriptional regulator	NA	O03970	Lactobacillus_phage	38.7	3.2e-18
WP_002315391.1|832212_832398_+	helix-turn-helix transcriptional regulator	NA	Q5YAA3	Bacillus_phage	56.7	8.4e-12
WP_002325021.1|832410_832659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002332465.1|832961_833420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350675.1|833587_833905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002329420.1|833837_834317_+	siphovirus Gp157 family protein	NA	E5DV79	Deep-sea_thermophilic_phage	49.0	5.3e-34
WP_044384563.1|834766_835198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002350671.1|835194_835521_+	hypothetical protein	NA	F0PIH7	Enterococcus_phage	57.8	1.6e-26
WP_012197638.1|835639_836326_+	AAA family ATPase	NA	A0A1P8VVS4	Streptococcus_phage	52.7	1.1e-61
WP_002350669.1|836300_837650_+	DEAD/DEAH box helicase	NA	A0A0P0ID30	Lactobacillus_phage	53.4	4.1e-132
WP_002350668.1|837640_838114_+	transcriptional regulator	NA	A8ATW6	Listeria_phage	43.9	7.7e-09
WP_012197636.1|838115_838616_+	DUF669 domain-containing protein	NA	A8ATF2	Listeria_phage	52.9	1.1e-34
WP_012197635.1|838630_840943_+	phage/plasmid primase P4 family domain-containing protein	NA	R4IBW2	Listeria_phage	55.9	1.3e-250
WP_002350665.1|841189_841507_+	VRR-NUC domain-containing protein	NA	A0A1B0YA93	Lactobacillus_phage	61.5	3.6e-31
WP_002296606.1|841503_841665_+	antitoxin	NA	NA	NA	NA	NA
WP_074394665.1|841661_841967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012197627.1|841966_842281_+	hypothetical protein	NA	D2IZY1	Enterococcus_phage	72.7	4.6e-34
WP_012197625.1|842273_842804_+	DUF1642 domain-containing protein	NA	A0A059T7S4	Listeria_phage	37.2	1.8e-11
WP_020944994.1|842800_843070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012197617.1|843199_843487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304479.1|843973_844387_+	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.1e-56
WP_016922444.1|845582_846128_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016922443.1|846128_846446_+	HNH endonuclease	NA	A0A1B1P8D2	Bacillus_phage	39.8	2.0e-13
WP_002350721.1|846602_846767_-	YjzC family protein	NA	A0A0A7RTS6	Clostridium_phage	69.8	3.6e-14
WP_002290653.1|846868_847390_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	34.2	1.1e-16
WP_010729417.1|847856_848015_-	ribbon-helix-helix domain-containing protein	NA	A0A0A7RUX5	Clostridium_phage	65.9	5.3e-07
WP_080116030.1|848089_848869_+	hypothetical protein	NA	A0A220BXN1	Staphylococcus_phage	45.9	8.1e-40
WP_002350718.1|850423_851644_+|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	38.5	1.2e-61
WP_002350717.1|851678_852356_+|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	51.0	4.9e-49
WP_002350716.1|852352_853546_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	55.4	1.5e-114
WP_002350715.1|853560_853887_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_002342516.1|853890_854226_+|head	phage head closure protein	head	A0A249XUC8	Enterococcus_phage	44.1	2.2e-18
WP_002350714.1|854222_854618_+	hypothetical protein	NA	C0LZZ2	Enterococcus_phage	44.5	4.3e-21
WP_002329393.1|854614_854986_+	hypothetical protein	NA	A0A060ANH4	Enterococcus_phage	46.2	2.5e-23
WP_002332434.1|855001_855562_+|tail	phi13 family phage major tail protein	tail	V5UQL2	Enterococcus_phage	46.2	3.4e-40
WP_002329391.1|855686_855998_+	hypothetical protein	NA	A0A0S2MY76	Enterococcus_phage	44.8	4.0e-14
WP_002290636.1|856021_856213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002350712.1|856212_860061_+	tape measure protein	NA	A0A0M5M3L4	Enterococcus_phage	76.0	0.0e+00
WP_002350711.1|860061_860934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002332431.1|860930_861980_+	hypothetical protein	NA	Q5K5I4	Oenococcus_phage	27.9	1.9e-31
WP_002290629.1|861983_862808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729422.1|862825_864886_+	DUF2479 domain-containing protein	NA	A0A249XZH9	Enterococcus_phage	44.9	1.7e-65
WP_002332429.1|865048_865495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002332428.1|865496_865634_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002332427.1|865668_865911_+|holin	holin	holin	D2J075	Enterococcus_phage	63.3	1.2e-21
WP_002302122.1|865926_866124_+|holin	holin	holin	A0A0S2MYF6	Enterococcus_phage	85.9	7.8e-24
WP_020944989.1|866134_867151_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.7	9.8e-62
WP_002302755.1|867265_868474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002318491.1|869468_869768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002353637.1|869773_870004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286921.1|870620_871283_+	hypothetical protein	NA	NA	NA	NA	NA
870199:870239	attR	TACGTGCATTACACGGAAAAGCTGCTCGTATCAAAGAAATC	NA	NA	NA	NA
WP_059355915.1|871361_874589_+	fibrinogen-binding MSCRAMM adhesin Fss3	NA	NA	NA	NA	NA
870199:870239	attR	TACGTGCATTACACGGAAAAGCTGCTCGTATCAAAGAAATC	NA	NA	NA	NA
WP_002297366.1|874701_875016_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.0e-25
WP_002297365.1|875028_875403_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	66.1	2.4e-34
WP_002311649.1|875403_875748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059355916.1|875830_877183_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	64.4	3.8e-162
WP_002286932.1|877242_878385_+	DNA cytosine methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	62.1	1.7e-126
WP_002286933.1|878409_878664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286934.1|878919_880104_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	60.8	1.9e-141
WP_002305703.1|880100_880238_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002298822.1|880242_880464_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	87.7	4.5e-28
WP_002288934.1|880476_880977_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.6	7.0e-53
WP_002288935.1|881073_882921_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_002305705.1|882923_883820_+	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	29.7	1.1e-16
WP_002288938.1|883869_884259_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	65.9	1.4e-40
WP_002298631.1|886492_888319_+	group II intron reverse transcriptase/maturase	NA	H7BVW2	unidentified_phage	26.8	3.7e-11
WP_002296840.1|889363_890551_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002305708.1|890851_892981_+	FUSC family protein	NA	A0A1S5SF30	Streptococcus_phage	60.3	1.8e-182
WP_002289057.1|892977_893985_+	lipoprotein	NA	A0A1S5SEZ8	Streptococcus_phage	63.9	4.8e-117
WP_002289055.1|894001_894913_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	42.2	1.1e-59
WP_002289053.1|895040_895769_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	37.1	5.1e-36
WP_002321361.1|895765_897175_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_002305709.1|897502_898624_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_077828749.1|899043_899280_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002302055.1|899232_900186_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002305710.1|900524_901034_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086956705.1|901126_902288_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.5	1.6e-79
WP_002296809.1|902568_903549_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296810.1|903670_905089_+	beta-fructofuranosidase	NA	NA	NA	NA	NA
WP_002289221.1|905159_906629_+	PTS glucose transporter subunit IIABC	NA	NA	NA	NA	NA
WP_002289220.1|906638_907106_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002289219.1|907141_908014_+	ROK family protein	NA	NA	NA	NA	NA
WP_002289218.1|908095_910630_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002289217.1|910785_911559_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289216.1|911551_912343_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002289215.1|912352_912844_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002289214.1|912861_913272_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002296814.1|913275_914676_+	beta-fructofuranosidase	NA	NA	NA	NA	NA
WP_002289210.1|914698_915073_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_086956687.1|915637_916799_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002285758.1|916930_917125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|917114_917468_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002299190.1|917569_919117_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002288962.1|919268_919697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288964.1|919683_919926_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288966.1|920225_920441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300928.1|920547_920862_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288969.1|920965_922144_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	31.1	1.4e-30
WP_002288970.1|922546_922840_+	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002305732.1|923682_926010_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002288982.1|929122_930295_+	class C sortase	NA	NA	NA	NA	NA
WP_002288983.1|930456_930951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321037.1|930947_931142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288984.1|931536_931959_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002288985.1|932124_933318_-	MFS transporter	NA	NA	NA	NA	NA
WP_002288986.1|933541_933919_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002321036.1|933906_934245_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288989.1|934378_934822_+	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002303949.1|935083_935899_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002300930.1|935908_936571_+	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002289620.1|936775_938440_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_002289619.1|938452_939163_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002289618.1|939292_939790_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002289617.1|939974_940235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321266.1|940596_940836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|941172_942351_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002323892.1|942467_942782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302293.1|943925_944228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|944546_945842_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002288592.1|946506_947280_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002288595.1|947423_947774_+	SdpI family protein	NA	NA	NA	NA	NA
WP_002288590.1|947754_948471_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288588.1|948470_949919_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002288586.1|949988_950498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296838.1|950487_951213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|951545_952841_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002303943.1|952957_955078_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.0	8.2e-220
WP_002288581.1|955307_956486_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	3.9e-102
WP_002305727.1|956501_957260_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	1.9e-25
WP_002288577.1|957282_957768_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002288576.1|957838_959092_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002288575.1|959208_960558_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288574.1|960669_962016_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002288573.1|962323_962710_-	YxeA family protein	NA	NA	NA	NA	NA
WP_002326704.1|962758_963667_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002311774.1|963879_964839_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002297633.1|965702_965915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287775.1|966192_967992_-	glycerophosphoryl diester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002287776.1|968115_968712_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002301399.1|968901_969861_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002296337.1|970126_970471_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002296335.1|970982_971333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296334.1|971298_972630_-	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
WP_002296332.1|972885_973452_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002303934.1|974017_974992_+	choloylglycine hydrolase family protein	NA	M1H001	Paramecium_bursaria_Chlorella_virus	29.7	3.0e-23
WP_002305724.1|975316_977212_+	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
WP_059355917.1|977406_977853_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_002296119.1|978080_978230_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002296121.1|978317_978836_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
WP_002293906.1|978912_979869_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002293905.1|980034_980841_+	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-13
WP_002293904.1|980837_981827_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002301321.1|981823_982828_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002289886.1|982959_983502_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002289885.1|983521_984220_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP013994	Enterococcus faecium strain 6E6, complete genome	2966909	1044814	1053974	2966909		Streptococcus_phage(83.33%)	13	NA	NA
WP_002289374.1|1044814_1045981_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.7	1.9e-24
WP_002296524.1|1046062_1046692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025481129.1|1047104_1047311_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_022278534.1|1047336_1047756_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_013670292.1|1047983_1048055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001227347.1|1048259_1048613_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
WP_011058338.1|1048672_1048858_-	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	67.9	3.9e-17
WP_000691736.1|1048958_1050878_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	99.5	0.0e+00
WP_012386611.1|1050893_1050980_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_008788621.1|1051485_1052121_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_153274509.1|1052263_1052416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729705.1|1052632_1053775_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	35.4	1.5e-63
WP_002341493.1|1053767_1053974_+	excisionase	NA	A0A1S5SF07	Streptococcus_phage	87.3	1.1e-25
>prophage 6
NZ_CP013994	Enterococcus faecium strain 6E6, complete genome	2966909	1198641	1228107	2966909	transposase,integrase	Streptococcus_phage(28.57%)	29	1207977:1207992	1221061:1221076
WP_000202380.1|1198641_1199961_-|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
WP_010729336.1|1200084_1200255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080398688.1|1200973_1201645_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010729338.1|1201948_1203580_+	mannitol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010729339.1|1203582_1204662_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_010729340.1|1204735_1206163_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_010729341.1|1206246_1206894_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_059355920.1|1207013_1208390_+	MFS transporter	NA	NA	NA	NA	NA
1207977:1207992	attL	TTTTTGATAAAAGCTA	NA	NA	NA	NA
WP_010729343.1|1208399_1209194_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_010729344.1|1209206_1210973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729345.1|1210995_1212804_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	48.4	2.3e-154
WP_010729346.1|1212990_1213392_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_002353648.1|1213385_1213631_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010729347.1|1213984_1214170_+	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_010729348.1|1214174_1215317_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	32.4	4.5e-39
WP_002288357.1|1215534_1216662_-|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	55.5	1.8e-109
WP_000222572.1|1216718_1217672_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_000997695.1|1217827_1219006_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002321532.1|1219251_1219542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002322258.1|1219659_1219920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289415.1|1220056_1220470_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	31.5	2.1e-07
WP_002303864.1|1220925_1221411_-	hypothetical protein	NA	NA	NA	NA	NA
1221061:1221076	attR	TTTTTGATAAAAGCTA	NA	NA	NA	NA
WP_002289418.1|1221549_1221765_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_002289420.1|1221988_1222789_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.2	2.6e-09
WP_002289421.1|1222807_1224676_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002289422.1|1224668_1225160_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289423.1|1225147_1225702_+	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002296760.1|1225719_1226715_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_002287107.1|1226856_1228107_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
>prophage 7
NZ_CP013994	Enterococcus faecium strain 6E6, complete genome	2966909	1545270	1554331	2966909		Synechococcus_phage(16.67%)	9	NA	NA
WP_002288010.1|1545270_1545849_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
WP_002321731.1|1545845_1546889_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288013.1|1546920_1548360_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002288015.1|1548344_1550567_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288017.1|1550567_1551239_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002295474.1|1551240_1551495_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288021.1|1551494_1552223_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002297115.1|1552478_1552856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288023.1|1553035_1554331_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	4.5e-19
>prophage 8
NZ_CP013994	Enterococcus faecium strain 6E6, complete genome	2966909	1792822	1906434	2966909	terminase,head,transposase,integrase,tail,portal,capsid,holin,protease,plate	Streptococcus_phage(12.24%)	123	1841733:1841751	1877701:1877719
WP_002287598.1|1792822_1795057_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.1	5.1e-127
WP_010729657.1|1795204_1795525_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_002302440.1|1795638_1796940_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002287661.1|1797230_1797455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002295394.1|1797652_1799233_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	28.4	5.1e-33
WP_002295395.1|1799633_1801010_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002290821.1|1801137_1802256_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002290819.1|1802397_1802832_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002290817.1|1802909_1803443_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_002296955.1|1803536_1804715_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002295398.1|1804707_1805505_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_002295399.1|1805611_1806994_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	37.4	3.5e-86
WP_002292856.1|1807167_1807746_-	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	34.4	9.7e-14
WP_002296956.1|1808067_1808538_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_002295400.1|1808645_1809872_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002292860.1|1810625_1810826_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	67.7	7.6e-19
WP_002295401.1|1810959_1811568_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	60.1	7.7e-70
WP_002292862.1|1811652_1812123_-	GtrA family protein	NA	NA	NA	NA	NA
WP_002317368.1|1812170_1813085_-	cation transporter	NA	A0A1V0SED0	Indivirus	31.5	2.1e-10
WP_002289147.1|1813230_1814034_+	DUF1189 domain-containing protein	NA	NA	NA	NA	NA
WP_002289148.1|1814211_1815159_+	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_002302440.1|1815242_1816544_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002303172.1|1816727_1817021_-	iron-sulfur cluster biosynthesis protein	NA	NA	NA	NA	NA
WP_002289151.1|1817048_1817714_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_002289153.1|1817853_1818486_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002289154.1|1818492_1819560_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002292871.1|1819556_1820288_-	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_002289156.1|1820456_1820936_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_002289159.1|1821071_1822247_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_002289161.1|1822450_1823620_+	serine hydrolase	NA	A0A2R4AS58	Mycobacterium_phage	26.3	1.6e-10
WP_002303174.1|1823886_1825509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296840.1|1825678_1826866_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_000997695.1|1827224_1828403_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002286097.1|1829475_1830429_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002296623.1|1830917_1832213_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002289372.1|1832386_1833334_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	37.7	2.8e-50
WP_002289370.1|1833338_1834091_-	acylneuraminate cytidylyltransferase family protein	NA	NA	NA	NA	NA
WP_002289368.1|1834091_1835000_-	dehydrogenase	NA	NA	NA	NA	NA
WP_002289366.1|1834999_1835977_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002326811.1|1835989_1837132_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	27.9	2.4e-24
WP_002289363.1|1837121_1837799_-	acetyltransferase	NA	NA	NA	NA	NA
WP_002289362.1|1837771_1838920_-	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_002292874.1|1838916_1839921_-	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
WP_002289359.1|1839932_1840940_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.9	1.2e-40
WP_002292875.1|1840952_1842374_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
1841733:1841751	attL	CCACTGTTTTTTATCAAAA	NA	NA	NA	NA
WP_002302730.1|1842360_1843431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347167.1|1843427_1844861_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_002289068.1|1844853_1845816_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_002289069.1|1845848_1846934_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_002289071.1|1846952_1847993_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	35.3	2.4e-07
WP_002302725.1|1848008_1849400_-	sugar transferase	NA	NA	NA	NA	NA
WP_002289074.1|1849777_1850761_+	serine hydrolase	NA	NA	NA	NA	NA
WP_002289076.1|1851128_1853267_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002289078.1|1853305_1854892_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002289079.1|1854881_1856102_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.1e-11
WP_002289081.1|1856113_1856920_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002302719.1|1858452_1860486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286428.1|1860519_1861371_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.7e-38
WP_002294532.1|1861468_1862497_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	6.4e-69
WP_002286442.1|1862518_1863091_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002286449.1|1863104_1863971_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002321540.1|1864070_1864805_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286453.1|1864782_1865610_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286455.1|1865609_1866410_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286457.1|1866402_1867542_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_002286461.1|1867617_1868541_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002294533.1|1868572_1869337_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002286465.1|1869494_1869935_+	flavodoxin	NA	NA	NA	NA	NA
WP_002286467.1|1870112_1870682_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002286469.1|1870936_1872169_+	aminopeptidase	NA	NA	NA	NA	NA
WP_002296840.1|1872443_1873631_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002286470.1|1873947_1874148_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_002302745.1|1874397_1874628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302747.1|1874633_1874933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303477.1|1875709_1876729_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.4e-60
WP_002286683.1|1876725_1876950_-|holin	holin	holin	NA	NA	NA	NA
WP_002303476.1|1876946_1877240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303475.1|1877276_1877414_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002347165.1|1877415_1877847_-	hypothetical protein	NA	NA	NA	NA	NA
1877701:1877719	attR	CCACTGTTTTTTATCAAAA	NA	NA	NA	NA
WP_002305897.1|1877860_1878355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301867.1|1878354_1878804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303523.1|1878807_1879425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002332773.1|1879424_1880333_-|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
WP_002347164.1|1880345_1883105_-	CHAP domain-containing protein	NA	D7RWE0	Brochothrix_phage	55.7	1.6e-50
WP_002349218.1|1883101_1883806_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002303051.1|1883817_1886127_-|tail	phage tail tape measure protein	tail	Q8W5Z7	Listeria_phage	50.1	5.5e-84
WP_002303049.1|1886321_1886786_-	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	38.9	1.4e-15
WP_002303047.1|1886785_1887412_-|tail	tail protein	tail	A0A2H4JGN2	uncultured_Caudovirales_phage	34.5	5.7e-28
WP_002303045.1|1887418_1887784_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_002303043.1|1887773_1888112_-	hypothetical protein	NA	A0A1B1P7P2	Bacillus_phage	45.9	9.6e-22
WP_002303041.1|1888101_1888428_-|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	53.4	2.9e-23
WP_002303039.1|1888405_1888687_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	62.7	4.7e-22
WP_002303037.1|1888688_1890053_-|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	69.1	2.2e-125
WP_002349220.1|1890065_1890641_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	71.7	3.6e-69
WP_002303034.1|1890606_1891836_-|portal	phage portal protein	portal	A0A2H4J9C7	uncultured_Caudovirales_phage	65.0	1.7e-145
WP_002303033.1|1891857_1893585_-|terminase	terminase large subunit	terminase	A0A2H4JDG5	uncultured_Caudovirales_phage	73.3	6.9e-265
WP_002303032.1|1893581_1894034_-	hypothetical protein	NA	A0A2H4JFK0	uncultured_Caudovirales_phage	66.2	6.8e-47
WP_002304435.1|1894145_1894526_-	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	64.0	4.7e-41
WP_002303030.1|1894522_1894909_-	hypothetical protein	NA	A0A1B1P7N8	Bacillus_phage	36.7	1.9e-10
WP_002303029.1|1894910_1895189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002349221.1|1895236_1895965_+	DUF4145 domain-containing protein	NA	A0A1X9I5M7	Streptococcus_phage	52.4	1.2e-58
WP_002303026.1|1896110_1896587_-	DUF1492 domain-containing protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	50.8	2.2e-27
WP_002303025.1|1896880_1897066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303024.1|1897066_1897339_-	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	61.6	5.5e-20
WP_002303023.1|1897335_1897539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303022.1|1897663_1897876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347162.1|1897908_1898103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303020.1|1898110_1898299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303018.1|1898925_1899291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303017.1|1899330_1899633_-	hypothetical protein	NA	D2IZY1	Enterococcus_phage	70.7	2.8e-33
WP_002303016.1|1899632_1899932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304429.1|1900094_1900364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286552.1|1900375_1901125_-	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_002286553.1|1901127_1901814_-	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.1	3.2e-88
WP_002286557.1|1901819_1902491_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286559.1|1902483_1902825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|1903002_1903701_-	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286568.1|1903787_1904258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296610.1|1904300_1904480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286573.1|1904466_1904805_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002296611.1|1904820_1905024_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002290310.1|1905038_1905815_-	phage antirepressor protein	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
WP_002296612.1|1906113_1906434_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
>prophage 9
NZ_CP013994	Enterococcus faecium strain 6E6, complete genome	2966909	1924191	2000237	2966909	tRNA,terminase,head,transposase,integrase,tail,portal,capsid,holin,protease	Enterococcus_phage(32.26%)	91	1960264:1960299	1999586:1999621
WP_002286621.1|1924191_1926990_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	1.6e-74
WP_002286622.1|1927251_1927959_-	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_002286624.1|1927979_1928762_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_073120020.1|1928810_1929098_-	YggT family protein	NA	NA	NA	NA	NA
WP_002286627.1|1929112_1929712_-	cell division protein SepF	NA	NA	NA	NA	NA
WP_002286628.1|1929725_1930403_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_002286629.1|1930419_1931661_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_002286631.1|1931683_1933009_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_002286633.1|1933164_1934385_-	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_002286637.1|1934399_1935488_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_002286638.1|1935513_1936875_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_059355930.1|1936888_1937851_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_002303009.1|1937876_1940069_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_002294542.1|1940069_1940471_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_002286642.1|1940475_1941435_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_002286645.1|1941455_1941887_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_002286647.1|1942056_1942425_-	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
WP_002286649.1|1942595_1943552_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002291876.1|1943624_1943741_+	DUF4044 domain-containing protein	NA	NA	NA	NA	NA
WP_002286651.1|1943795_1945478_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002286653.1|1945495_1945945_-	arginine repressor	NA	NA	NA	NA	NA
WP_002286655.1|1946051_1946870_-	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_002286656.1|1946878_1947769_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_002286657.1|1947770_1947995_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_002286658.1|1947999_1949337_-	exodeoxyribonuclease VII large subunit	NA	L7RDW5	Acanthamoeba_polyphaga_moumouvirus	29.5	6.7e-26
WP_002286660.1|1949337_1950192_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	38.7	6.8e-40
WP_002286662.1|1950288_1950738_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_002286664.1|1950730_1951156_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002286665.1|1951401_1952466_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_002286666.1|1952637_1952883_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002286668.1|1953021_1953396_-	DUF956 family protein	NA	NA	NA	NA	NA
WP_010729404.1|1953478_1954393_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_002294546.1|1954413_1955217_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289456.1|1955249_1956239_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_002289455.1|1956341_1956833_-	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_002289453.1|1957023_1959858_-	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
1960264:1960299	attL	ATTAAGCTTCTTGAGCTACTGGATAAACAGACACTT	NA	NA	NA	NA
WP_002305361.1|1960476_1961271_+	DUF4428 domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	32.9	4.3e-12
WP_002305364.1|1961366_1961669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|1961704_1962076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296902.1|1962077_1962479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286474.1|1962492_1962900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286484.1|1965923_1966949_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.1e-64
WP_002286683.1|1966945_1967170_-|holin	holin	holin	NA	NA	NA	NA
WP_002286686.1|1967166_1967460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|1967497_1967635_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002286491.1|1967636_1968083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305370.1|1968245_1970336_-	hypothetical protein	NA	A0A249XZH9	Enterococcus_phage	49.6	9.6e-88
WP_002305372.1|1970359_1972651_-	hypothetical protein	NA	A0A1D3SNL1	Enterococcus_phage	30.2	1.7e-90
WP_002305373.1|1972660_1973398_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002305374.1|1973448_1976868_-|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	41.5	8.7e-78
WP_002305377.1|1976884_1977067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286510.1|1977069_1977432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305379.1|1977451_1978057_-	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.6	1.1e-33
WP_002297404.1|1978465_1979716_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002286516.1|1979851_1980256_-	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002296598.1|1980248_1980650_-	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286522.1|1980639_1980993_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_002286523.1|1980982_1981294_-	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286524.1|1981290_1982166_-	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.2	5.6e-130
WP_002286525.1|1982175_1983336_-|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_002286527.1|1983335_1984022_-|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286530.1|1983984_1985163_-|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286533.1|1985182_1986877_-|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
WP_002286538.1|1986854_1987169_-|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002296599.1|1987271_1987553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305386.1|1987557_1987902_-	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	58.1	1.0e-26
WP_002305387.1|1988161_1988809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020944850.1|1989030_1989210_+	YegP family protein	NA	NA	NA	NA	NA
WP_002305389.1|1989202_1989544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002349267.1|1989567_1989804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305391.1|1990078_1990546_-	ArpU family transcriptional regulator	NA	D7RWH7	Brochothrix_phage	28.5	2.4e-07
WP_002296604.1|1990730_1990976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286550.1|1990935_1991292_-	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	3.1e-10
WP_002305393.1|1991291_1991597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290675.1|1991593_1991755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305394.1|1991769_1992129_-	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	48.3	3.1e-18
WP_002305396.1|1992125_1992977_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	28.7	6.2e-25
WP_002305397.1|1992993_1993824_-	replication protein	NA	C9E2N2	Enterococcus_phage	43.9	1.5e-52
WP_002305398.1|1993826_1994513_-	hypothetical protein	NA	C9E2N1	Enterococcus_phage	71.4	2.6e-90
WP_002305399.1|1994518_1994758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305400.1|1995083_1995272_-	hypothetical protein	NA	D2IZW5	Enterococcus_phage	60.3	7.4e-08
WP_002349273.1|1995292_1995577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305401.1|1995578_1995773_-	helix-turn-helix transcriptional regulator	NA	D2IZW2	Enterococcus_phage	50.9	1.2e-08
WP_002305403.1|1995769_1996546_-	hypothetical protein	NA	B2ZYU5	Staphylococcus_phage	54.8	2.8e-72
WP_002349274.1|1996672_1996894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305405.1|1997194_1997539_+	helix-turn-helix transcriptional regulator	NA	A0A126GGL0	Streptococcus_phage	52.6	1.2e-24
WP_002321996.1|1997574_1997970_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002305409.1|1998022_1998334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002301539.1|1998345_1999494_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	40.1	3.0e-67
WP_002289452.1|1999586_1999880_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
1999586:1999621	attR	ATTAAGCTTCTTGAGCTACTGGATAAACAGACACTT	NA	NA	NA	NA
WP_002289451.1|1999892_2000237_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
>prophage 10
NZ_CP013994	Enterococcus faecium strain 6E6, complete genome	2966909	2019322	2027794	2966909		Streptococcus_phage(66.67%)	9	NA	NA
WP_002288083.1|2019322_2021512_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
WP_002288081.1|2021826_2022429_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002294035.1|2022482_2023604_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288078.1|2023712_2024585_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002288076.1|2024653_2025001_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288073.1|2024993_2025818_-	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288071.1|2025853_2026792_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002292340.1|2026805_2027135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294039.1|2027149_2027794_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
>prophage 11
NZ_CP013994	Enterococcus faecium strain 6E6, complete genome	2966909	2461277	2530287	2966909	tRNA,transposase	Streptococcus_phage(27.27%)	56	NA	NA
WP_002297218.1|2461277_2462573_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002287579.1|2463719_2464037_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002287582.1|2464062_2464383_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002287583.1|2464846_2466262_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_002287584.1|2466278_2467595_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002287585.1|2467744_2468443_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287587.1|2468731_2469721_-	glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_002302661.1|2469800_2470634_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002287590.1|2470808_2472443_-	membrane protein	NA	NA	NA	NA	NA
WP_002321840.1|2472429_2474277_-	membrane protein	NA	NA	NA	NA	NA
WP_002305330.1|2474263_2475901_+	membrane protein	NA	NA	NA	NA	NA
WP_002294728.1|2476045_2476786_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002294730.1|2476976_2477612_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002294732.1|2477758_2479000_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_002302657.1|2479197_2480196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059355936.1|2480208_2482227_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_002294735.1|2482286_2483003_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_002294738.1|2483229_2483772_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_002294740.1|2483776_2484004_-	copper chaperone	NA	NA	NA	NA	NA
WP_002302653.1|2484082_2485963_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.0	2.2e-99
WP_002302651.1|2486151_2486766_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002302649.1|2486907_2487468_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002294754.1|2490530_2491094_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_002292292.1|2491108_2492152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292291.1|2492284_2492689_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_002312642.1|2492921_2493557_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002291912.1|2493822_2494875_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002291914.1|2494887_2495826_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_002312640.1|2496276_2496927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296569.1|2497026_2497536_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	34.8	2.8e-17
WP_002312639.1|2497736_2498606_-	ROK family protein	NA	NA	NA	NA	NA
WP_002317128.1|2498625_2499747_-	DUF2961 domain-containing protein	NA	NA	NA	NA	NA
WP_002312636.1|2499748_2500144_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002312634.1|2500162_2500960_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002312633.1|2500961_2501750_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002312631.1|2501763_2502240_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_033644393.1|2502311_2504969_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_002317125.1|2504987_2505392_-	restriction endonuclease subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	41.4	4.7e-15
WP_002313258.1|2505623_2505881_-	GTP pyrophosphokinase	NA	NA	NA	NA	NA
WP_002324517.1|2506005_2506338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087043335.1|2506870_2508033_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.2e-79
WP_010706118.1|2508101_2508308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312625.1|2508470_2510105_-	resolvase	NA	A0A2P1JU08	Anoxybacillus_phage	28.3	1.8e-41
WP_002312624.1|2510108_2511482_-	recombinase family protein	NA	A0A2P1JU08	Anoxybacillus_phage	23.4	1.1e-12
WP_002312623.1|2511497_2511737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002322125.1|2514743_2516207_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.0	2.0e-124
WP_002296840.1|2517648_2518836_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002296332.1|2520713_2521280_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296334.1|2521535_2522867_+	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
WP_002296335.1|2522832_2523183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296336.1|2523274_2523694_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002296337.1|2523694_2524039_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002325884.1|2524310_2525264_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002287776.1|2525455_2526052_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002297633.1|2528251_2528464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311774.1|2529327_2530287_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
>prophage 12
NZ_CP013994	Enterococcus faecium strain 6E6, complete genome	2966909	2835152	2852048	2966909		Streptococcus_phage(92.86%)	18	NA	NA
WP_059355940.1|2835152_2835467_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.3e-25
WP_002297365.1|2835479_2835854_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	66.1	2.4e-34
WP_002311649.1|2835854_2836199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729284.1|2836281_2837622_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	65.2	1.5e-163
WP_002297358.1|2837699_2838374_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002321810.1|2838606_2839041_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SDW2	Streptococcus_phage	77.1	6.5e-63
WP_002297356.1|2839041_2839749_+	DNA methylase	NA	A0A1S5SEK0	Streptococcus_phage	50.4	5.8e-53
WP_002297354.1|2839738_2840029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297353.1|2840287_2841472_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
WP_002317225.1|2841468_2841606_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286940.1|2842351_2844262_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_033658092.1|2844365_2844590_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
WP_002297350.1|2844602_2845106_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
WP_002297349.1|2845165_2845555_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
WP_010729283.1|2845541_2847989_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	75.9	0.0e+00
WP_002297347.1|2847993_2850117_+	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	59.7	1.2e-181
WP_002297346.1|2850113_2851118_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	63.5	5.6e-118
WP_002297345.1|2851136_2852048_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	44.0	2.2e-65
>prophage 1
NZ_CP013995	Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence	381524	2318	54386	381524	holin,transposase	Streptococcus_phage(40.0%)	53	NA	NA
WP_059355947.1|2318_3941_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.3	1.4e-121
WP_002302275.1|4592_5564_+	radical SAM protein	NA	NA	NA	NA	NA
WP_002322470.1|5641_5878_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_077828694.1|5846_5978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002330694.1|6053_6437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302270.1|6469_7255_-	histidinol phosphate phosphatase	NA	NA	NA	NA	NA
WP_002302268.1|7432_8533_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002302267.1|8522_9347_+	type I phosphodiesterase/nucleotide pyrophosphatase	NA	NA	NA	NA	NA
WP_002302265.1|9352_10159_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002313180.1|10155_10986_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002302261.1|10992_12024_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.8e-26
WP_016922460.1|13630_13816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348630.1|13939_14656_+	aminotransferase class V-fold PLP-dependent enzyme	NA	Q2XUY6	environmental_halophage	50.0	4.5e-45
WP_002285815.1|15365_16019_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	4.0e-24
WP_002300494.1|16015_17335_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_001015311.1|17419_18100_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_086968564.1|18210_19351_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.7	3.8e-78
WP_000751236.1|19586_20039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000718009.1|20052_20742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000344083.1|20866_23218_+	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_002304891.1|23297_23693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224538.1|24017_24635_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	5.1e-13
WP_000366408.1|24675_24975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000824191.1|25008_25176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729776.1|25220_25691_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	33.6	1.5e-09
WP_002319817.1|25696_26377_-|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_000195429.1|27332_28505_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_002354485.1|29776_30463_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002300493.1|30802_31972_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_002354485.1|32525_33212_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002305788.1|33991_34261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296377.1|34492_34789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729773.1|34790_35213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296379.1|35231_36824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086968564.1|37325_38467_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.7	3.8e-78
WP_002322479.1|38714_38909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002330536.1|39044_40295_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	3.0e-113
WP_002313122.1|41264_43076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002313123.1|43136_44606_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_002303486.1|44616_46626_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	52.6	1.6e-111
WP_002299811.1|46971_47568_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_002301800.1|47580_48480_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002301801.1|48482_48614_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	83.3	1.3e-11
WP_002305808.1|48635_48968_+	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	53.2	6.1e-21
WP_002295625.1|48989_49247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295624.1|49405_49528_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_074399798.1|49717_49942_+	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	56.9	3.6e-09
WP_002324499.1|50389_50596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287517.1|50595_50847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305049.1|50862_51300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305050.1|51292_51988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305052.1|52827_53259_+	antitoxin HicB	NA	F0PIL2	Enterococcus_phage	64.9	4.3e-43
WP_002325884.1|53432_54386_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	1.3e-34
>prophage 2
NZ_CP013995	Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence	381524	60876	112511	381524	transposase,integrase	Bacillus_phage(20.0%)	49	85490:85505	97245:97260
WP_010729769.1|60876_62103_-|integrase	site-specific integrase	integrase	A0A097BYJ7	Leuconostoc_phage	24.2	3.2e-14
WP_071870188.1|62176_62344_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002328876.1|62890_63799_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_002328877.1|63854_64352_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002328878.1|64388_65084_-	HisJ family histidinol phosphate phosphatase	NA	NA	NA	NA	NA
WP_000997695.1|65383_66562_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_074400136.1|66670_67273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002328880.1|67269_67893_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	32.5	1.1e-15
WP_002328881.1|68210_68549_+	recombinase family protein	NA	NA	NA	NA	NA
WP_002333400.1|70614_71373_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_002290556.1|71377_72145_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002290555.1|72632_73058_+	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
WP_002290554.1|73074_73590_+	galactose-6-phosphate isomerase subunit LacB	NA	A0A222YX14	Synechococcus_phage	36.0	3.3e-05
WP_002340477.1|73600_74533_+	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
WP_059355950.1|74535_75516_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002290550.1|75543_75861_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002340476.1|75860_77567_+	PTS lactose EIICB component	NA	NA	NA	NA	NA
WP_002290548.1|77708_79115_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	29.0	3.6e-46
WP_002305107.1|79137_79410_+	DUF3884 family protein	NA	NA	NA	NA	NA
WP_002303235.1|79430_80330_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_143344080.1|80801_81964_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.5	3.9e-78
WP_000997695.1|82660_83839_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002295743.1|83963_84872_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002300833.1|85274_87221_+	PRD domain-containing protein	NA	NA	NA	NA	NA
85490:85505	attL	TTTGATTTCATCGGTA	NA	NA	NA	NA
WP_002300835.1|87223_87679_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002300836.1|87692_89021_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002300838.1|89054_89339_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002300840.1|89340_89856_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_002300841.1|89871_90534_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002300842.1|90540_91113_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002300843.1|91299_92820_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.6	1.1e-48
WP_002305884.1|93062_93248_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_002300846.1|93231_93414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301839.1|94367_94967_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	36.1	1.3e-29
WP_002322465.1|95030_95630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002292418.1|96645_97518_-	ROK family protein	NA	NA	NA	NA	NA
97245:97260	attR	TACCGATGAAATCAAA	NA	NA	NA	NA
WP_002293868.1|97781_99728_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002302078.1|99912_101352_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002302077.1|101353_102316_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_002297218.1|102536_103832_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
WP_086953894.1|104007_105434_-|transposase	IS3-like element ISEfa10 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.3e-48
WP_002301718.1|105676_106132_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
WP_002289255.1|106717_106948_-	resolvase	NA	NA	NA	NA	NA
WP_002289254.1|107177_107996_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289253.1|108156_108846_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002289252.1|108859_110362_+	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002300328.1|110374_110851_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_106913781.1|110947_111148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108676098.1|111348_112511_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
>prophage 3
NZ_CP013995	Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence	381524	136738	195231	381524	transposase,integrase	Streptococcus_phage(16.67%)	48	127020:127036	196868:196884
127020:127036	attL	ATTTAATGCGTTAATCA	NA	NA	NA	NA
WP_002290382.1|136738_137212_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A097PAS9	Streptococcus_pyogenes_phage	44.2	2.3e-13
WP_002290383.1|137384_137939_-|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	46.1	8.6e-36
WP_002300314.1|138411_139581_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_002319325.1|140600_141218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311006.1|142281_142503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008271463.1|142600_142846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002344895.1|144069_145071_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_002344896.1|145229_145496_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002344897.1|145485_145842_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_094868189.1|145970_146657_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.9e-127
WP_044383143.1|146868_150018_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.1	1.1e-21
WP_016922464.1|150031_151249_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	33.7	9.2e-14
WP_044383147.1|151238_152834_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	51.1	1.8e-126
WP_002326540.1|152958_153744_+	SinI family restriction endonuclease	NA	NA	NA	NA	NA
WP_010731484.1|155106_156240_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_002350430.1|156230_156899_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.4	8.8e-27
WP_002350432.1|157354_158341_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002350433.1|158353_159280_-	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
WP_010731482.1|159292_159808_-	galactose-6-phosphate isomerase subunit LacB	NA	A0A222YX14	Synechococcus_phage	29.0	9.5e-05
WP_010731481.1|159826_160255_-	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
WP_010731480.1|160274_161048_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.1	1.3e-18
WP_002350438.1|161212_161692_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002350439.1|161748_162051_+	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_002350440.1|162072_163530_+	PTS glucitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_002350442.1|164122_164875_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.9e-17
WP_016922316.1|166499_168182_-	PTS lactose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002350447.1|168192_168516_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_016922317.1|168538_169945_-	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	30.2	3.4e-44
WP_002350449.1|170411_171419_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_044383156.1|172183_172864_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.6	3.2e-109
WP_002292681.1|173493_174042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292680.1|174042_174900_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
WP_002300557.1|175183_175471_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002292678.1|175460_175790_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_010729757.1|179052_179925_-	ROK family protein	NA	NA	NA	NA	NA
WP_002322556.1|179941_181414_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_002313079.1|181427_182276_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002322555.1|182272_183139_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002322554.1|183181_184540_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010729506.1|184634_185606_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	22.4	1.2e-05
WP_002313084.1|186640_187246_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	32.6	3.6e-19
WP_002348862.1|188364_188574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002336308.1|188634_189594_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	6.5e-31
WP_010729754.1|190143_191052_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_010729753.1|191110_192913_-	exonuclease DNA polymerase III epsilon subunit	NA	A0A0A7RWA3	Clostridium_phage	30.4	7.6e-33
WP_002342384.1|192975_193818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002331328.1|193833_194055_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085910366.1|194544_195231_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.9e-127
196868:196884	attR	ATTTAATGCGTTAATCA	NA	NA	NA	NA
>prophage 4
NZ_CP013995	Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence	381524	202396	257050	381524	holin,transposase	Streptococcus_phage(42.11%)	57	NA	NA
WP_002296840.1|202396_203584_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002288620.1|203641_204883_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_010729750.1|204918_205629_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288615.1|205696_206512_-	fructoselysine 6-kinase	NA	NA	NA	NA	NA
WP_002336724.1|206522_207491_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_010729749.1|208253_209546_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002285758.1|209624_209819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|209808_210162_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002296127.1|210263_211811_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_002302440.1|212039_213341_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002389879.1|213519_213789_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5SCV8	Streptococcus_phage	48.8	8.7e-18
WP_086322080.1|213778_214117_-	antitoxin	NA	NA	NA	NA	NA
WP_077974475.1|214113_214341_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_010729807.1|214545_215178_-	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	27.9	3.0e-08
WP_010729806.1|215190_217914_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002322451.1|218050_219016_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002298371.1|219069_219882_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_010729805.1|219895_220669_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298375.1|220682_221153_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002298377.1|221149_221566_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002311511.1|221890_222733_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010729802.1|224191_225100_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002299197.1|225315_225927_+	VanZ family protein	NA	NA	NA	NA	NA
WP_002299198.1|225999_226929_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	23.3	1.1e-06
WP_074394709.1|227086_227824_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_010729801.1|227871_229050_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	27.1	2.7e-23
WP_080114943.1|229276_229678_+	hypothetical protein	NA	A0A0N9S006	Staphylococcus_phage	49.2	2.5e-24
WP_002301682.1|231640_232450_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002301683.1|232449_233196_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002301684.1|233213_233681_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002301685.1|233680_234091_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002301686.1|234101_235115_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_010729798.1|235331_236066_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010729797.1|236049_236760_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086322086.1|236807_237494_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	2.9e-126
WP_002299575.1|237682_238267_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	5.9e-43
WP_002299573.1|238477_238681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303116.1|238690_239113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261742.1|239350_239965_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.9	3.8e-16
WP_001809248.1|240129_240954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000588503.1|241590_241848_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_000388479.1|241840_242110_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_001120991.1|242240_242420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303117.1|242800_243508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300851.1|243500_243938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296238.1|243952_244204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347218.1|244203_244410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|245010_246306_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.8	5.3e-44
WP_059355952.1|246365_246629_-	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	51.4	1.2e-11
WP_002316074.1|246703_246907_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002303313.1|247047_247533_-	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	59.3	5.8e-44
WP_002303312.1|247535_248435_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002303311.1|248447_249041_-	abortive infection protein	NA	NA	NA	NA	NA
WP_002305772.1|249281_251486_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	50.7	6.1e-117
WP_002347152.1|251496_252957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305801.1|253017_255390_-	hypothetical protein	NA	B5SP25	Lactococcus_phage	29.7	3.4e-12
WP_002297404.1|255799_257050_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
>prophage 5
NZ_CP013995	Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence	381524	279556	305854	381524	protease,transposase	Streptococcus_phage(57.14%)	30	NA	NA
WP_002300034.1|279556_281614_+|protease	serine protease	protease	NA	NA	NA	NA
WP_002305780.1|281649_283740_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002302867.1|283736_283997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302869.1|284009_284771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302871.1|284786_285539_-	class C sortase	NA	NA	NA	NA	NA
WP_002302873.1|285551_287528_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002302875.1|287580_288252_-	class A sortase	NA	NA	NA	NA	NA
WP_002299888.1|288333_289500_-	EpaQ family protein	NA	NA	NA	NA	NA
WP_002299887.1|289505_290195_-	sortase	NA	NA	NA	NA	NA
WP_002299886.1|290321_290561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002299885.1|290627_290867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305777.1|290980_291322_-	DUF5406 domain-containing protein	NA	F0PIH7	Enterococcus_phage	63.4	4.0e-36
WP_002296227.1|291308_291638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002310954.1|292228_292561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302440.1|292819_294121_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002302900.1|294898_295939_-	replication initiator protein A	NA	NA	NA	NA	NA
WP_002299230.1|296287_296614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302898.1|296600_297389_-	ParA family protein	NA	H7BUL8	unidentified_phage	35.7	6.1e-27
WP_059355959.1|297719_298898_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_000026576.1|299102_299393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002354485.1|299764_300451_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002347149.1|300528_301344_+	replication initiation protein	NA	NA	NA	NA	NA
WP_002347150.1|301457_301826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303412.1|301999_302308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002349053.1|302570_302891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303414.1|303021_303231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303415.1|303220_303493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347151.1|303540_303759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094932144.1|303806_304499_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.5	1.6e-124
WP_002297218.1|304558_305854_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
>prophage 6
NZ_CP013995	Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence	381524	344282	376661	381524	protease,transposase	Streptococcus_phage(50.0%)	28	NA	NA
WP_002350400.1|344282_346340_+|protease	serine protease	protease	NA	NA	NA	NA
WP_025481135.1|346377_348489_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002350398.1|348777_349602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729785.1|349598_350354_-	class C sortase	NA	NA	NA	NA	NA
WP_010729784.1|350366_352343_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002336710.1|352395_353067_-	class A sortase	NA	NA	NA	NA	NA
WP_002295672.1|353126_353336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002295673.1|353402_353642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297404.1|354051_355302_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002295674.1|355538_355880_-	DUF5406 domain-containing protein	NA	F0PIH7	Enterococcus_phage	62.5	1.5e-35
WP_002323647.1|356498_356831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002326172.1|357654_358695_-	replication protein RepA	NA	NA	NA	NA	NA
WP_002348857.1|360046_360241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002323589.1|360947_362096_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
WP_002287522.1|362112_362517_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002323399.1|362875_363130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002290394.1|363130_363448_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002323400.1|364006_364942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287522.1|366248_366653_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002287525.1|366669_367818_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002314387.1|368867_371117_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_002336205.1|371119_372295_+	MFS transporter	NA	NA	NA	NA	NA
WP_002297422.1|373439_373703_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002314366.1|373702_373975_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_002292678.1|374051_374381_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002292680.1|374942_375800_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
WP_154591461.1|375800_375941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014125696.1|375974_376661_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	7.7e-127
>prophage 1
NZ_CP013996	Enterococcus faecium strain 6E6 plasmid unnamed2, complete sequence	49420	12380	46599	49420	transposase	Streptococcus_phage(51.85%)	38	NA	NA
WP_002305144.1|12380_14003_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	48.5	1.7e-119
WP_002305145.1|13983_14532_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_002305147.1|14594_15248_+	restriction endonuclease subunit M	NA	NA	NA	NA	NA
WP_002311516.1|15269_17813_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.1	7.0e-16
WP_002354485.1|17860_18547_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_154591462.1|18580_19006_-	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	42.2	1.1e-22
WP_000599739.1|19021_19627_-	cell filamentation protein	NA	NA	NA	NA	NA
WP_013330747.1|19824_20511_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.3e-126
WP_000195429.1|20804_21977_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_002305817.1|23007_23619_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	39.2	3.4e-17
WP_002305134.1|23658_24441_-	helix-turn-helix domain-containing protein	NA	A0A1X9I5A1	Streptococcus_phage	35.2	5.0e-05
WP_002305133.1|24454_25837_-	helix-turn-helix domain-containing protein	NA	I3VYY8	Thermoanaerobacterium_phage	32.2	5.9e-09
WP_002305840.1|25885_26782_-	helix-turn-helix transcriptional regulator	NA	Q9AZH9	Lactococcus_phage	40.7	9.1e-11
WP_002305131.1|26976_27519_-	helix-turn-helix transcriptional regulator	NA	Q9AZH9	Lactococcus_phage	45.0	3.8e-12
WP_002305130.1|27689_27878_+	type II toxin-antitoxin system HicA family toxin	NA	A0A1X9I5T5	Streptococcus_phage	66.1	1.7e-15
WP_002305129.1|27923_28301_+	antitoxin HicB	NA	A0A1X9I5X0	Streptococcus_phage	52.1	6.9e-29
WP_002354485.1|28467_29154_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_077828739.1|30013_30397_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	45.5	1.6e-12
WP_000199136.1|30378_30633_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.6	2.1e-13
WP_001196543.1|30825_31101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429439.1|31072_32026_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	26.1	7.7e-16
WP_000947691.1|32637_34131_+	replication protein RepR	NA	NA	NA	NA	NA
WP_000053907.1|34265_34562_+	replication control protein PrgN	NA	NA	NA	NA	NA
WP_002287225.1|34585_35545_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	3.4e-32
WP_002287227.1|35727_36579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002324171.1|36599_36812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014748745.1|37238_37925_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	7.7e-127
WP_001835296.1|38213_38429_+	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	97.1	4.2e-31
WP_000301765.1|38445_38718_+	antitoxin	NA	A0A1X9I6E5	Streptococcus_phage	100.0	5.0e-05
WP_001284311.1|38719_39583_+	toxin zeta	NA	NA	NA	NA	NA
WP_023843711.1|39760_39901_-	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	93.0	8.0e-15
WP_001038796.1|39845_40583_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	2.4e-134
WP_031929417.1|40707_40791_-	23S rRNA methyltransferase attenuator leader peptide ErmL	NA	NA	NA	NA	NA
WP_001096887.1|41332_42127_-	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_059355968.1|42715_43999_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	28.7	6.4e-42
WP_002354485.1|44028_44715_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002349227.1|44917_45130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059355959.1|45420_46599_-|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
