The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013357	Burkholderia oklahomensis EO147 chromosome 1, complete sequence	4192894	1694	13165	4192894		Moraxella_phage(42.86%)	8	NA	NA
WP_010100649.1|1694_2798_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	33.7	3.7e-46
WP_010100646.1|2987_5459_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.1	2.7e-113
WP_010100645.1|6068_6515_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	40.4	1.1e-14
WP_010100643.1|6468_7536_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	55.0	8.4e-104
WP_010100641.1|7532_8270_-	hypothetical protein	NA	A0A0R6PKK0	Moraxella_phage	29.9	2.0e-11
WP_010100640.1|8270_9347_-	DUF262 domain-containing protein	NA	A0A0R6PJX3	Moraxella_phage	34.1	1.7e-48
WP_081463873.1|9954_10791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010100639.1|11086_13165_-	AAA family ATPase	NA	A0A1V0SIN4	Klosneuvirus	22.1	1.7e-07
>prophage 2
NZ_CP013357	Burkholderia oklahomensis EO147 chromosome 1, complete sequence	4192894	220499	246933	4192894	tail,lysis,plate,transposase,integrase,head,holin	Burkholderia_phage(35.71%)	32	215515:215561	247196:247242
215515:215561	attL	CTCCGAAGGCAGGGGTTGCTGGTTCGATCCCAGCCGGGCGCGCCAAG	NA	NA	NA	NA
WP_010107128.1|220499_221417_+	AAA family ATPase	NA	A0A077JGB2	Xanthomonas_phage	31.1	3.1e-14
WP_038802797.1|221413_222778_+	type II secretory pathway protein	NA	NA	NA	NA	NA
WP_063837205.1|222877_223564_+	hypothetical protein	NA	A0A0K2QQ53	Ralstonia_phage	50.6	1.1e-08
WP_038801760.1|224014_224794_+	hypothetical protein	NA	A0A1W5LU59	Ralstonia_phage	41.8	4.2e-36
WP_081464429.1|224874_225729_+|integrase	site-specific integrase	integrase	Q9T1P3	Pseudomonas_phage	45.2	7.0e-61
WP_081464428.1|225743_226103_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	51.9	1.1e-18
WP_010111811.1|226110_226428_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	59.2	2.1e-15
WP_081464427.1|226627_226933_+	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_038802795.1|227214_228537_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	52.3	2.2e-61
WP_081956034.1|228685_229708_-|integrase	site-specific integrase	integrase	A4PE72	Ralstonia_virus	73.4	1.2e-120
WP_038802586.1|229731_230760_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	49.0	5.6e-73
WP_038802794.1|230756_231530_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	55.7	4.7e-80
WP_107974064.1|231623_231959_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081956071.1|232082_232649_-|plate	Baseplate J family protein	plate	A0A089FGR9	Burkholderia_phage	74.8	4.4e-43
WP_038802793.1|235682_236045_-|plate	baseplate assembly protein	plate	A4JWY3	Burkholderia_virus	94.0	2.9e-56
WP_038802792.1|236041_236722_-|plate	phage baseplate assembly protein V	plate	K4NXJ5	Burkholderia_phage	90.3	2.6e-111
WP_038802927.1|236896_237676_+	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	90.3	3.1e-132
WP_107974065.1|238092_238683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081956070.1|238786_239254_-	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	92.9	1.1e-73
WP_038801843.1|239250_239667_-|tail	phage tail protein	tail	A4JWT7	Burkholderia_virus	94.9	5.8e-69
WP_038802791.1|239771_240212_-|lysis	LysB family phage lysis regulatory protein	lysis	K4NXJ2	Burkholderia_phage	84.2	2.3e-60
WP_010112629.1|240208_241021_-	DUF3380 domain-containing protein	NA	A4JWU0	Burkholderia_virus	97.0	7.2e-148
WP_010112631.1|241017_241290_-|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	98.9	1.1e-41
WP_010112633.1|241291_241636_-	membrane protein	NA	A4JWU2	Burkholderia_virus	98.2	1.4e-49
WP_010112635.1|241650_241857_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	98.5	1.5e-30
WP_038802790.1|241853_242105_-	hypothetical protein	NA	K4NXI9	Burkholderia_phage	75.9	9.6e-27
WP_038802925.1|242104_242536_-|head	head completion/stabilization protein	head	A4JWU5	Burkholderia_virus	97.2	2.1e-69
WP_038801137.1|243477_243750_+	BrnT family toxin	NA	K4NX81	Burkholderia_phage	98.9	3.8e-45
WP_038801136.1|243709_243982_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	97.8	5.3e-47
WP_081464174.1|244535_245657_-	DUF3396 domain-containing protein	NA	A4JWV3	Burkholderia_virus	87.4	1.1e-194
WP_038801134.1|245665_246403_-	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	96.3	1.5e-128
WP_038801133.1|246399_246933_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	90.4	1.9e-88
247196:247242	attR	CTCCGAAGGCAGGGGTTGCTGGTTCGATCCCAGCCGGGCGCGCCAAG	NA	NA	NA	NA
>prophage 3
NZ_CP013357	Burkholderia oklahomensis EO147 chromosome 1, complete sequence	4192894	422694	483313	4192894	protease,transposase,integrase	uncultured_Mediterranean_phage(20.0%)	57	460763:460779	470114:470130
WP_010106907.1|422694_423408_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010106906.1|423701_428405_+	glutamate synthase subunit alpha	NA	NA	NA	NA	NA
WP_010106905.1|428497_429964_+	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_038802778.1|430241_431756_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_010117273.1|431758_432313_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_010106899.1|432598_432904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010106898.1|432984_434286_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_010106897.1|434310_435573_-	MFS transporter	NA	NA	NA	NA	NA
WP_010106895.1|435970_437737_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_010117260.1|438362_439496_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010106892.1|439537_439735_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_010106891.1|439786_440602_+	thiazole synthase	NA	NA	NA	NA	NA
WP_081956068.1|440598_441702_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_010106887.1|441801_442620_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	6.8e-21
WP_010106886.1|442616_443384_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_010117253.1|443396_443930_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_081469854.1|443926_444931_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_010106880.1|445045_445678_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010106879.1|445674_445944_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_010106878.1|446173_447100_+	ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	32.9	2.6e-21
WP_010106876.1|447096_447852_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_006029348.1|447946_448186_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_010106873.1|448199_449549_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_010106872.1|449545_450202_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_010106871.1|450242_451580_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_010106870.1|451731_452802_+	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	25.9	1.2e-14
WP_010106868.1|452865_453453_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_010106867.1|453508_454129_+	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_010106865.1|454125_454767_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_010106863.1|454933_455689_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_010106861.1|455771_456545_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_010106859.1|456544_456958_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_010106857.1|456954_457323_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_010106856.1|457376_457766_+	membrane protein	NA	NA	NA	NA	NA
WP_010106855.1|457794_458160_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_010106854.1|458247_458484_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_010117244.1|458506_459034_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_010106852.1|459072_459855_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	29.7	1.9e-25
WP_010106851.1|460171_461380_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.9	6.5e-12
460763:460779	attL	CGTGACCGTCTGGCCGA	NA	NA	NA	NA
WP_010106850.1|461401_462148_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_025990024.1|462368_462989_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_010106848.1|462989_464372_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_010106847.1|464393_465152_+	cytochrome c1	NA	NA	NA	NA	NA
WP_010106845.1|465245_465857_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_010106844.1|465920_466451_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.5	1.2e-21
WP_010106843.1|466626_466923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063837204.1|466931_468119_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_010112843.1|468440_468827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081956026.1|468871_470593_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	29.4	5.9e-59
470114:470130	attR	CGTGACCGTCTGGCCGA	NA	NA	NA	NA
WP_159086819.1|470644_470974_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	1.7e-07
WP_081464416.1|470991_471432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144444684.1|471895_476884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010112835.1|476816_477419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158332690.1|477482_477620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010112661.1|479263_480787_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_038801846.1|480801_481572_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	5.4e-36
WP_107950792.1|482079_483313_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.8	6.9e-102
>prophage 4
NZ_CP013357	Burkholderia oklahomensis EO147 chromosome 1, complete sequence	4192894	1985576	2029276	4192894	protease,transposase,tRNA	Leptospira_phage(25.0%)	39	NA	NA
WP_010103237.1|1985576_1986917_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010103238.1|1986968_1987598_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_010103239.1|1987641_1988787_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_038800601.1|1988783_1989044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010103241.1|1989061_1990399_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_004192796.1|1990532_1990772_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_010103247.1|1990828_1992007_+	GTPase HflX	NA	NA	NA	NA	NA
WP_052111497.1|1992088_1993414_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_010103259.1|1993429_1994329_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_010103262.1|1994353_1994545_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_010103264.1|1994655_1995804_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_107974084.1|1995782_1995911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010103266.1|1995928_1997275_+	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	37.0	2.4e-71
WP_081463989.1|1997311_1997875_+	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_010103269.1|1997995_1998190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010103270.1|1998154_2000047_+	potassium transporter Kup	NA	A7J6G4	Paramecium_bursaria_Chlorella_virus	33.0	2.0e-79
WP_010103273.1|2001191_2003516_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_010103274.1|2003656_2004415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010103275.1|2004524_2004740_+	YdcH family protein	NA	NA	NA	NA	NA
WP_010103276.1|2004799_2007055_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	29.8	7.5e-78
WP_010103277.1|2007211_2008036_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_010103279.1|2008089_2009277_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_010103280.1|2009283_2010141_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_081463991.1|2010558_2012442_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_010103284.1|2012538_2013720_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_010103285.1|2013846_2014587_+	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_010103286.1|2014724_2015294_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_010112045.1|2015616_2016039_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_038773301.1|2016642_2016915_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_019254717.1|2016940_2017279_+	toxin A	NA	NA	NA	NA	NA
WP_081956041.1|2017503_2017830_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038802638.1|2017826_2019425_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	37.2	3.8e-76
WP_038801846.1|2020672_2021443_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	5.4e-36
WP_010112661.1|2021457_2022981_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_038802636.1|2023242_2024016_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.1	9.4e-81
WP_010112058.1|2024117_2024471_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.5	1.1e-17
WP_010112057.1|2024451_2024937_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_038802499.1|2026381_2027704_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	52.3	2.2e-61
WP_038801731.1|2028226_2029276_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP013357	Burkholderia oklahomensis EO147 chromosome 1, complete sequence	4192894	2336144	2398216	4192894	tail,protease,transposase,integrase,capsid,terminase,portal,head,holin	Burkholderia_virus(53.85%)	68	2359556:2359569	2362976:2362989
WP_010112063.1|2336144_2337740_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.5	4.1e-131
WP_010112228.1|2339120_2339321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010112230.1|2339317_2339776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038801818.1|2340575_2341439_-|transposase	transposase	transposase	A0A0R6PHP9	Moraxella_phage	45.8	8.4e-54
WP_010112234.1|2342071_2342464_-	DUF3331 domain-containing protein	NA	NA	NA	NA	NA
WP_010112236.1|2342505_2343798_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_025990429.1|2343936_2344608_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159086828.1|2344769_2345174_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081956026.1|2345554_2347276_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	29.4	5.9e-59
WP_159086819.1|2347327_2347657_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	1.7e-07
WP_081464416.1|2347674_2348115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802590.1|2348232_2349075_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.0	6.6e-96
WP_010111169.1|2349861_2350524_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	86.8	4.0e-112
WP_010111171.1|2350523_2351705_-	hypothetical protein	NA	A9YX12	Burkholderia_phage	93.4	8.4e-198
WP_010111173.1|2351701_2352055_-	hypothetical protein	NA	A9YX11	Burkholderia_phage	90.6	2.4e-52
WP_010111175.1|2352116_2352395_+	excinuclease ABC subunit A	NA	NA	NA	NA	NA
WP_010111178.1|2352412_2352712_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	56.0	2.8e-17
WP_010111182.1|2353519_2353897_+	hypothetical protein	NA	A9YX05	Burkholderia_phage	90.4	5.8e-60
WP_010111184.1|2353893_2354862_-	hypothetical protein	NA	A9YX04	Burkholderia_phage	89.0	3.0e-145
WP_010111186.1|2354905_2355316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144444658.1|2355302_2355647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144444657.1|2355646_2356066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010111189.1|2356128_2356443_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	35.4	3.8e-12
WP_010111191.1|2356442_2357018_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	38.0	1.4e-20
WP_010111197.1|2359170_2359731_-	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	36.6	4.8e-18
2359556:2359569	attL	GTGCGCGCCTGCTC	NA	NA	NA	NA
WP_010111200.1|2359733_2360174_-	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	58.2	3.2e-41
WP_010111202.1|2360189_2361665_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	47.3	4.8e-110
WP_081464403.1|2362272_2362737_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_081464402.1|2363621_2364128_-	hypothetical protein	NA	NA	NA	NA	NA
2362976:2362989	attR	GAGCAGGCGCGCAC	NA	NA	NA	NA
WP_038802587.1|2364594_2366199_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_010107948.1|2366298_2366652_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	43.0	1.3e-16
WP_010107949.1|2366651_2367146_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_038802499.1|2367370_2368693_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	52.3	2.2e-61
WP_107974109.1|2368851_2369880_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	48.6	2.8e-72
WP_038802636.1|2369876_2370650_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.1	9.4e-81
WP_029227221.1|2370786_2371428_+	hypothetical protein	NA	Q8W6R9	Burkholderia_virus	90.1	2.0e-108
WP_010109967.1|2371557_2372652_-	DUF3396 domain-containing protein	NA	Q8W6S0	Burkholderia_virus	94.7	2.2e-200
WP_010109969.1|2372679_2373414_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	96.3	7.0e-134
WP_010109970.1|2373410_2373971_-	hypothetical protein	NA	A4JX23	Burkholderia_virus	93.5	3.0e-97
WP_038801576.1|2374171_2375008_-	hypothetical protein	NA	C7BGE2	Burkholderia_phage	42.9	3.2e-50
WP_038801577.1|2375069_2375615_-	lysozyme	NA	Q8W6S5	Burkholderia_virus	75.6	3.6e-63
WP_038801578.1|2375614_2376112_-	lysozyme	NA	Q6JIK8	Burkholderia_virus	86.2	4.9e-75
WP_038801579.1|2376104_2376317_-|holin	holin	holin	Q3HQU8	Burkholderia_phage	58.6	3.0e-13
WP_010109975.1|2376357_2377092_-	hypothetical protein	NA	Q8W6S8	Burkholderia_virus	80.8	2.9e-116
WP_081464325.1|2377091_2377358_-	hypothetical protein	NA	Q8W6S9	Burkholderia_virus	87.5	2.5e-41
WP_010109978.1|2377402_2380711_-	DUF1983 domain-containing protein	NA	Q8W6T0	Burkholderia_virus	95.5	0.0e+00
WP_038801580.1|2380707_2381292_-|tail	tail assembly protein	tail	Q8W6T1	Burkholderia_virus	92.8	4.3e-94
WP_010109982.1|2381288_2382041_-	C40 family peptidase	NA	Q6JIL4	Burkholderia_virus	89.2	4.2e-134
WP_010109984.1|2382090_2382774_-|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	94.7	1.8e-128
WP_010109986.1|2382770_2384156_-|tail	tail fiber domain-containing protein	tail	Q8W6T4	Burkholderia_virus	84.0	9.2e-228
WP_038801581.1|2384164_2384503_-|tail	phage tail protein	tail	Q8W6T5	Burkholderia_virus	93.8	9.2e-57
WP_010109989.1|2384499_2388564_-|tail	phage tail tape measure protein	tail	Q6JIL8	Burkholderia_virus	84.0	0.0e+00
WP_010109990.1|2388577_2388862_-	DUF4035 domain-containing protein	NA	Q6JIL9	Burkholderia_virus	93.6	3.5e-41
WP_038801594.1|2388861_2389326_-|tail	tail assembly protein	tail	A4JX08	Burkholderia_virus	77.3	7.6e-62
WP_010109992.1|2389352_2389808_-	hypothetical protein	NA	Q8W6T9	Burkholderia_virus	96.0	5.0e-74
WP_009901138.1|2389870_2390218_-	DUF3168 domain-containing protein	NA	Q6JIM2	Burkholderia_virus	92.2	6.8e-55
WP_009901139.1|2390214_2390637_-	HK97 gp10 family phage protein	NA	Q6JIM3	Burkholderia_virus	96.4	5.5e-67
WP_038801582.1|2390629_2390959_-|head	phage head closure protein	head	Q6JIM4	Burkholderia_virus	79.8	4.6e-45
WP_010109995.1|2390961_2391324_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	79.2	7.8e-46
WP_081464326.1|2391327_2391552_-	hypothetical protein	NA	Q6JIM6	Burkholderia_virus	76.7	9.5e-26
WP_038801583.1|2391614_2392871_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	94.2	5.2e-214
WP_038801584.1|2392873_2393560_-|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	94.7	1.1e-120
WP_009901146.1|2393540_2394854_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	81.2	1.0e-204
WP_038801585.1|2394850_2396524_-|terminase	terminase large subunit	terminase	Q3HQS7	Burkholderia_phage	80.6	1.0e-265
WP_029227272.1|2396523_2397003_-|terminase	terminase small subunit	terminase	Q3HQS6	Burkholderia_phage	82.1	9.0e-58
WP_010110005.1|2397123_2397333_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_059601806.1|2397575_2397833_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q8W6N1	Burkholderia_virus	98.8	7.0e-41
WP_004548635.1|2397829_2398216_+	helix-turn-helix transcriptional regulator	NA	Q8W6N2	Burkholderia_virus	99.2	1.4e-64
>prophage 6
NZ_CP013357	Burkholderia oklahomensis EO147 chromosome 1, complete sequence	4192894	2402306	2425219	4192894	tRNA	Burkholderia_virus(72.0%)	33	NA	NA
WP_010110008.1|2402306_2402954_-	hypothetical protein	NA	Q8W6N4	Burkholderia_virus	92.1	6.6e-104
WP_009901164.1|2402962_2403223_-	hypothetical protein	NA	Q8W6N5	Burkholderia_virus	95.3	9.9e-43
WP_009901165.1|2403198_2403480_-	hypothetical protein	NA	Q3HR03	Burkholderia_phage	77.9	1.1e-31
WP_038801587.1|2403533_2403956_-	DUF1364 family protein	NA	Q6JIF7	Burkholderia_virus	72.5	1.6e-53
WP_025990453.1|2403952_2404327_-	hypothetical protein	NA	A4JX57	Burkholderia_virus	84.7	6.8e-53
WP_050807566.1|2404323_2404827_-	DUF1064 domain-containing protein	NA	A4JX56	Burkholderia_virus	89.2	4.1e-77
WP_038801588.1|2404871_2405864_-	hypothetical protein	NA	A4JX55	Burkholderia_virus	97.9	1.1e-174
WP_010110014.1|2406017_2406278_-	helix-turn-helix domain-containing protein	NA	Q6JIG2	Burkholderia_virus	87.2	1.3e-34
WP_010110016.1|2406274_2407096_-	hypothetical protein	NA	Q8W6P2	Burkholderia_virus	97.4	2.0e-142
WP_038801589.1|2407106_2408723_-	DNA cytosine methyltransferase	NA	Q6JIG4	Burkholderia_virus	82.2	7.9e-215
WP_010110021.1|2408951_2409392_-	hypothetical protein	NA	Q8W6P5	Burkholderia_virus	89.0	1.0e-68
WP_009901179.1|2409575_2409812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063837201.1|2409973_2410303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038801590.1|2410309_2410624_-	transcriptional regulator	NA	Q6JIG9	Burkholderia_virus	82.2	2.3e-41
WP_010110024.1|2410687_2411089_+	hypothetical protein	NA	Q6JIH0	Burkholderia_virus	89.5	8.9e-59
WP_010110026.1|2411434_2412724_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	91.1	8.3e-215
WP_038801596.1|2412878_2413772_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	91.9	2.9e-158
WP_085967537.1|2414119_2414386_+	hypothetical protein	NA	Q8W6Q1	Burkholderia_virus	88.2	1.8e-36
WP_010110029.1|2414396_2414528_+	hypothetical protein	NA	Q8W6Q2	Burkholderia_virus	78.6	1.2e-09
WP_010110031.1|2415101_2415809_+	hypothetical protein	NA	Q6JII4	Burkholderia_virus	84.3	1.8e-110
WP_010110032.1|2415823_2416162_+	hypothetical protein	NA	A0A1B0VM42	Pseudomonas_phage	33.0	1.1e-06
WP_144444656.1|2417411_2417699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010110035.1|2418048_2419014_+	phage Gp37/Gp68 family protein	NA	Q8W6R4	Burkholderia_virus	66.2	8.6e-124
WP_038801599.1|2419016_2419283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038801591.1|2419318_2420023_+	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	42.5	2.6e-37
WP_010110037.1|2420006_2420216_-	hypothetical protein	NA	A9YWV5	Burkholderia_phage	76.8	1.7e-24
WP_010110038.1|2420252_2420462_+	excisionase	NA	Q774Z6	Bordetella_phage	76.8	1.8e-23
WP_038801592.1|2420437_2421616_+	DUF3596 domain-containing protein	NA	Q774Z5	Bordetella_phage	64.5	3.5e-143
WP_010110040.1|2421788_2422808_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_010110041.1|2423256_2423511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010110042.1|2423589_2423787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006026606.1|2423917_2424133_-	transporter	NA	NA	NA	NA	NA
WP_038802585.1|2424214_2425219_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	37.5	1.1e-28
>prophage 7
NZ_CP013357	Burkholderia oklahomensis EO147 chromosome 1, complete sequence	4192894	2604833	2732223	4192894	plate,coat,tRNA,transposase	uncultured_Caudovirales_phage(16.67%)	100	NA	NA
WP_010104307.1|2604833_2607458_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	40.0	4.5e-82
WP_010112894.1|2608153_2609374_+	CoA transferase	NA	NA	NA	NA	NA
WP_010112893.1|2609698_2610505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010104309.1|2611467_2613177_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	56.3	2.9e-183
WP_081464040.1|2613417_2613885_-	NUDIX domain-containing protein	NA	A0A2I6PFL2	Proteus_phage	42.8	1.2e-22
WP_010104311.1|2613912_2614299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081464038.1|2614527_2616582_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_038800841.1|2616734_2617595_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_010104314.1|2617619_2618897_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_010104315.1|2618935_2620123_+	MFS transporter	NA	NA	NA	NA	NA
WP_010104316.1|2620119_2621208_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2D2W2B8	Stenotrophomonas_phage	27.5	4.8e-14
WP_038800845.1|2621559_2622906_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_085967512.1|2623087_2624722_+	acid phosphatase	NA	NA	NA	NA	NA
WP_010104320.1|2625078_2626272_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_010104321.1|2626341_2626599_-	trans-aconitate methyltransferase	NA	NA	NA	NA	NA
WP_038802563.1|2626606_2627239_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_038802562.1|2627239_2629315_-	response regulator	NA	A0A1V0SGR3	Hokovirus	25.9	5.9e-13
WP_010104327.1|2629728_2630694_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_081956085.1|2630709_2633055_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_038800850.1|2633162_2634002_-	molecular chaperone	NA	NA	NA	NA	NA
WP_038800852.1|2634019_2634544_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_010104331.1|2634626_2635187_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_038800855.1|2635239_2635785_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_010104334.1|2636047_2636248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157135620.1|2636388_2636538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010104335.1|2636614_2637508_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081464044.1|2637927_2639190_+	MFS transporter	NA	NA	NA	NA	NA
WP_010104337.1|2639235_2640162_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025989861.1|2640634_2640916_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_081464045.1|2641366_2641669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010104348.1|2643251_2644202_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	37.3	3.2e-06
WP_038800859.1|2644346_2645195_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010104354.1|2645219_2646380_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_010104355.1|2646392_2647571_+	CoA transferase	NA	NA	NA	NA	NA
WP_010104356.1|2647652_2649035_+	MFS transporter	NA	NA	NA	NA	NA
WP_038800861.1|2649415_2650255_-	CoA ester lyase	NA	NA	NA	NA	NA
WP_010104359.1|2651237_2652551_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_082728769.1|2653280_2654147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144444654.1|2654378_2654693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081464418.1|2655753_2656473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159086829.1|2656734_2657832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159086830.1|2657828_2657978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010111647.1|2658068_2658416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045568267.1|2658537_2659440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081464047.1|2659553_2662379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010104371.1|2662399_2663275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038800867.1|2663276_2666117_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_010104373.1|2666128_2666683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124072276.1|2666719_2666947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010104375.1|2667033_2667528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010104377.1|2667505_2670838_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.5	2.6e-10
WP_038800869.1|2670946_2673355_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_010104384.1|2673351_2673951_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_010104386.1|2673947_2674526_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_010104389.1|2674638_2675475_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_010104391.1|2675477_2678276_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.8	1.1e-25
WP_010104392.1|2678792_2679059_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_010104393.1|2679055_2680489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010104394.1|2680530_2682381_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_107950775.1|2684391_2685203_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107950775.1|2686909_2687721_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_010112340.1|2688068_2689691_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	31.8	4.9e-55
WP_010112338.1|2689790_2690144_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.8	1.4e-15
WP_010112335.1|2690143_2690617_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_010112332.1|2691150_2692068_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	43.3	6.1e-71
WP_010112330.1|2692263_2693616_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	48.6	1.0e-98
WP_010112328.1|2693606_2694851_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_010112326.1|2695270_2696230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010112325.1|2696293_2696845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010112324.1|2696860_2697988_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_010112322.1|2698001_2698601_+	DUF664 domain-containing protein	NA	NA	NA	NA	NA
WP_010112320.1|2698597_2699542_+	hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_010112318.1|2699552_2700296_+	aldolase	NA	NA	NA	NA	NA
WP_010112313.1|2700292_2701216_+	DMT family transporter	NA	NA	NA	NA	NA
WP_010112311.1|2701272_2702826_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010112309.1|2702839_2703847_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_045568015.1|2703857_2704709_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_038802557.1|2704705_2706325_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.1e-11
WP_010110924.1|2706321_2707350_+	histone deacetylase family protein	NA	A0A2K9L0J7	Tupanvirus	34.8	2.5e-28
WP_052111489.1|2707660_2709238_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_025990554.1|2709327_2709939_+	LysE family translocator	NA	NA	NA	NA	NA
WP_010111062.1|2710032_2711346_-	nucleotide sugar dehydrogenase	NA	M1I178	Paramecium_bursaria_Chlorella_virus	30.2	2.3e-34
WP_010111063.1|2711362_2712175_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010111064.1|2712189_2714202_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_157759780.1|2714211_2715546_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_010111067.1|2716553_2717039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010111068.1|2717059_2718220_-	serine/threonine protein kinase	NA	D5GV78	Campylobacter_virus	25.6	4.3e-21
WP_144444653.1|2720414_2721164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158332683.1|2721281_2721887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010111073.1|2722308_2722887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144444652.1|2722898_2723135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107974092.1|2723685_2724496_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041281907.1|2724566_2725700_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_010112123.1|2727328_2727772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081464416.1|2727951_2728392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159086819.1|2728409_2728739_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	1.7e-07
WP_081956026.1|2728790_2730512_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	29.4	5.9e-59
WP_010112843.1|2730556_2730943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038802556.1|2731090_2731405_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_144444651.1|2731371_2732223_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP013357	Burkholderia oklahomensis EO147 chromosome 1, complete sequence	4192894	3224706	3290561	4192894	transposase,integrase	Stx2-converting_phage(23.08%)	55	3218695:3218714	3293718:3293737
3218695:3218714	attL	GCGCGAGATGCAGCACGACG	NA	NA	NA	NA
WP_038800530.1|3224706_3225921_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	49.7	1.4e-107
WP_010102136.1|3226582_3226828_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038801731.1|3228212_3229262_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_124072298.1|3231620_3233414_+	alpha-galactosidase	NA	A0A2P0VP48	Tetraselmis_virus	30.3	4.6e-46
WP_010112903.1|3234008_3234362_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.8	9.7e-17
WP_038802501.1|3235795_3237343_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	51.2	2.2e-137
WP_081464460.1|3237485_3238850_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.5	5.2e-34
WP_038802500.1|3239296_3239629_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	71.6	4.7e-37
WP_038802864.1|3239625_3240033_-	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	44.1	2.0e-13
WP_081464433.1|3240933_3243363_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_099976094.1|3244330_3246139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124072299.1|3246447_3248562_-	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_010121049.1|3248601_3249447_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_010111971.1|3249443_3250334_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_038801780.1|3250420_3251644_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025990425.1|3251951_3252719_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010111968.1|3252771_3253848_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.2	1.1e-23
WP_010111967.1|3253866_3254769_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010111965.1|3256069_3256369_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_010111964.1|3256628_3256874_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081464432.1|3256936_3259813_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.6	6.6e-71
WP_010111962.1|3259922_3260249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010111961.1|3260259_3260607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006765346.1|3260599_3260812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025989700.1|3260804_3261107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038801779.1|3261099_3261276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038801778.1|3261603_3262128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010111958.1|3262124_3262316_-	AlpA family phage regulatory protein	NA	A0A2L0V109	Agrobacterium_phage	49.1	4.9e-07
WP_010111957.1|3262887_3263133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124072300.1|3263248_3263731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124072301.1|3263714_3264254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124072302.1|3264246_3264768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124072303.1|3265165_3265816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010111955.1|3265872_3266700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010111954.1|3267022_3267598_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	41.5	2.7e-24
WP_144440952.1|3268105_3270472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038801776.1|3270477_3271818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010111953.1|3271814_3272981_-	Fic family protein	NA	NA	NA	NA	NA
WP_010111951.1|3274586_3275153_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010111950.1|3275279_3276062_+	aldolase	NA	NA	NA	NA	NA
WP_010111948.1|3276122_3277019_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_038801775.1|3277033_3277723_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_010111944.1|3277788_3278679_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010111942.1|3278794_3279688_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010111941.1|3279901_3280864_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010111940.1|3280981_3281398_-|transposase	IS5 family transposase	transposase	K4I1H9	Acidithiobacillus_phage	54.0	1.6e-31
WP_038802499.1|3281450_3282773_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	52.3	2.2e-61
WP_010111794.1|3283655_3284882_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_010111792.1|3284889_3285318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010111790.1|3285591_3286404_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_038801758.1|3286472_3287672_-	MFS transporter	NA	NA	NA	NA	NA
WP_010111786.1|3287671_3288862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025989701.1|3288962_3289196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144427322.1|3289383_3289617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107950941.1|3289749_3290561_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
3293718:3293737	attR	GCGCGAGATGCAGCACGACG	NA	NA	NA	NA
>prophage 9
NZ_CP013357	Burkholderia oklahomensis EO147 chromosome 1, complete sequence	4192894	3324368	3335227	4192894	protease	Agrobacterium_phage(16.67%)	9	NA	NA
WP_010102080.1|3324368_3326669_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.3	5.1e-167
WP_009892611.1|3326665_3326980_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	2.6e-13
WP_004196460.1|3327509_3327713_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_038802496.1|3327837_3329424_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_010102073.1|3329591_3330851_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	1.5e-11
WP_010102068.1|3331110_3331689_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_081463944.1|3331952_3332168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025989693.1|3332355_3332865_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.5e-14
WP_010102066.1|3333112_3335227_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.8	4.4e-56
>prophage 10
NZ_CP013357	Burkholderia oklahomensis EO147 chromosome 1, complete sequence	4192894	4078085	4155352	4192894	tail,tRNA,lysis,plate,capsid,terminase,portal,protease,head,holin	Burkholderia_phage(50.0%)	85	NA	NA
WP_010100882.1|4078085_4078622_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_010100881.1|4078632_4079976_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.9	9.4e-44
WP_010100880.1|4080201_4080744_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_010100879.1|4080763_4082044_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_010100875.1|4082637_4083537_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_081956078.1|4083533_4084337_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_010100869.1|4084303_4084996_+	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_010100868.1|4085890_4087036_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_010100867.1|4087032_4087647_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_010100866.1|4087656_4088970_+	AmpG family muropeptide MFS transporter	NA	NA	NA	NA	NA
WP_010100864.1|4088959_4090024_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_010100862.1|4090208_4091153_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010100860.1|4091379_4092444_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.8	1.5e-81
WP_010100857.1|4092681_4093452_-	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	32.7	1.4e-28
WP_010100856.1|4093483_4094323_-	polyphosphate kinase	NA	NA	NA	NA	NA
WP_010100855.1|4094450_4095938_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_038802820.1|4095934_4097431_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_010100848.1|4097557_4097857_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_004189550.1|4098221_4099265_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_038802819.1|4099384_4100452_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_010100842.1|4100448_4100961_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_038802818.1|4101091_4103464_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_010100830.1|4103475_4104624_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_038802817.1|4104933_4105710_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_010100822.1|4105706_4106492_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_010100819.1|4107115_4107568_-	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	31.4	2.6e-14
WP_010100818.1|4107587_4108220_-	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	34.2	5.1e-08
WP_010100817.1|4108314_4109049_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	42.5	2.4e-49
WP_010100816.1|4110078_4110993_+	DNA-processing protein DprA	NA	S6BFL3	Thermus_phage	41.9	4.4e-37
WP_010100815.1|4110973_4111645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038802816.1|4112393_4113449_-|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	95.7	5.2e-199
WP_010110946.1|4113445_4115215_-|terminase	terminase ATPase subunit family protein	terminase	A4JWQ1	Burkholderia_virus	96.8	0.0e+00
WP_010110945.1|4115359_4116169_+|capsid	GPO family capsid scaffolding protein	capsid	K4PAW2	Burkholderia_phage	95.2	2.5e-140
WP_010110944.1|4116202_4117216_+|capsid	phage major capsid protein, P2 family	capsid	A4JWP9	Burkholderia_virus	92.3	2.0e-176
WP_010110943.1|4117212_4117902_+|terminase	terminase endonuclease subunit	terminase	K4NX86	Burkholderia_phage	96.1	8.3e-113
WP_038802815.1|4118001_4118481_+|head	head completion/stabilization protein	head	A4JWU5	Burkholderia_virus	97.5	5.4e-79
WP_038802814.1|4118480_4118732_+	hypothetical protein	NA	K4NXI9	Burkholderia_phage	86.7	1.2e-32
WP_010112635.1|4118728_4118935_+|tail	tail protein	tail	K4PAW7	Burkholderia_phage	98.5	1.5e-30
WP_010112633.1|4118949_4119294_+	membrane protein	NA	A4JWU2	Burkholderia_virus	98.2	1.4e-49
WP_010112631.1|4119295_4119568_+|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	98.9	1.1e-41
WP_010112629.1|4119564_4120377_+	DUF3380 domain-containing protein	NA	A4JWU0	Burkholderia_virus	97.0	7.2e-148
WP_038802791.1|4120373_4120814_+|lysis	LysB family phage lysis regulatory protein	lysis	K4NXJ2	Burkholderia_phage	84.2	2.3e-60
WP_038801843.1|4120918_4121335_+|tail	phage tail protein	tail	A4JWT7	Burkholderia_virus	94.9	5.8e-69
WP_038802813.1|4121331_4121799_+	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	92.8	2.8e-72
WP_144444690.1|4122074_4122674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038801482.1|4122971_4123475_+	hypothetical protein	NA	K4NX96	Burkholderia_phage	65.9	3.1e-56
WP_038802930.1|4123568_4124345_-	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	89.1	4.8e-133
WP_038802812.1|4124519_4125200_+|plate	phage baseplate assembly protein V	plate	K4NXJ5	Burkholderia_phage	89.4	6.5e-110
WP_038802793.1|4125196_4125559_+|plate	baseplate assembly protein	plate	A4JWY3	Burkholderia_virus	94.0	2.9e-56
WP_038802811.1|4125555_4126461_+|plate	baseplate assembly protein	plate	K4NZR5	Burkholderia_phage	94.7	9.7e-154
WP_038800167.1|4126453_4127008_+|tail	phage tail protein I	tail	A4JWT0	Burkholderia_virus	96.2	2.8e-95
WP_010100795.1|4127009_4129382_+	hypothetical protein	NA	A4JWY0	Burkholderia_virus	85.2	0.0e+00
WP_010100793.1|4129398_4130070_+|tail	tail assembly chaperone	tail	A4JWS8	Burkholderia_virus	84.8	1.8e-104
WP_010100791.1|4130127_4131300_+|tail	phage tail sheath protein	tail	A4JWS7	Burkholderia_virus	94.9	4.4e-215
WP_038800165.1|4131315_4131825_+|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	95.9	3.3e-90
WP_010100789.1|4131882_4132227_+|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	94.7	5.9e-51
WP_010100788.1|4132235_4132349_+|tail	GpE family phage tail protein	tail	E5E3U7	Burkholderia_phage	91.9	1.6e-13
WP_081956075.1|4132345_4135312_+	hypothetical protein	NA	A4JWX4	Burkholderia_virus	83.3	0.0e+00
WP_010100785.1|4135329_4135755_+|tail	phage tail protein	tail	A4JWS2	Burkholderia_virus	97.2	4.1e-70
WP_010100783.1|4135754_4136855_+	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	93.7	3.8e-192
WP_010100780.1|4136932_4137178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038800163.1|4137324_4137660_-	hypothetical protein	NA	R4JGF4	Burkholderia_phage	53.8	1.2e-24
WP_010100779.1|4137759_4138473_+	DUF159 family protein	NA	Q8W6R8	Burkholderia_virus	50.4	1.6e-63
WP_107974106.1|4138499_4138997_-	helix-turn-helix domain-containing protein	NA	E5E3U2	Burkholderia_phage	57.6	4.2e-42
WP_010100777.1|4139086_4139302_+	hypothetical protein	NA	E5E3U1	Burkholderia_phage	84.6	1.8e-21
WP_010100775.1|4139316_4139514_+	hypothetical protein	NA	E5E3U0	Burkholderia_phage	87.7	4.1e-25
WP_010100773.1|4139553_4139757_+	hypothetical protein	NA	E5E3T9	Burkholderia_phage	85.1	2.1e-24
WP_038800161.1|4139744_4139993_+	ogr/Delta-like zinc finger family protein	NA	K4PAZ0	Burkholderia_phage	96.3	8.3e-39
WP_010100769.1|4140078_4140297_+	hypothetical protein	NA	A4JWR5	Burkholderia_virus	88.9	2.1e-30
WP_010100768.1|4140302_4140500_+	hypothetical protein	NA	K4NZY3	Burkholderia_phage	87.7	2.7e-24
WP_080495621.1|4140528_4140738_+	hypothetical protein	NA	K4NXL1	Burkholderia_phage	98.6	4.5e-30
WP_004531069.1|4140741_4140981_+	hypothetical protein	NA	K4PAZ5	Burkholderia_phage	100.0	1.4e-35
WP_010100757.1|4141149_4141356_+	hypothetical protein	NA	K4NZT3	Burkholderia_phage	67.6	4.2e-20
WP_010100755.1|4141349_4141718_+	hypothetical protein	NA	A4JWR0	Burkholderia_virus	95.1	4.8e-59
WP_010100753.1|4141714_4141969_+	hypothetical protein	NA	A4JWQ9	Burkholderia_virus	91.7	1.1e-35
WP_038802809.1|4141980_4144773_+	hypothetical protein	NA	K4NXL6	Burkholderia_phage	94.7	0.0e+00
WP_076836148.1|4145473_4145815_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010113220.1|4146841_4147528_-	response regulator	NA	NA	NA	NA	NA
WP_010100736.1|4147528_4149937_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_010100735.1|4149938_4150529_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_010100734.1|4150525_4151938_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_010100733.1|4152303_4152471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010100732.1|4152646_4153504_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_010100731.1|4153612_4154248_-	LysE family translocator	NA	NA	NA	NA	NA
WP_010100729.1|4154368_4155352_-|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	31.1	2.3e-07
>prophage 1
NZ_CP013356	Burkholderia oklahomensis EO147 chromosome 2, complete sequence	3126684	644880	681897	3126684	tRNA,transposase	Leptospira_phage(36.36%)	26	NA	NA
WP_010110103.1|644880_645921_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.4	1.5e-94
WP_010110101.1|646051_647275_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004190342.1|647351_647564_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_010110060.1|647731_648178_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	50.7	4.7e-24
WP_010110055.1|648274_650152_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	37.0	2.9e-67
WP_099976072.1|650236_652645_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.0	4.9e-35
WP_052111537.1|653437_654592_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_010112843.1|655211_655598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081956026.1|655642_657364_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	29.4	5.9e-59
WP_159086819.1|657415_657745_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	1.7e-07
WP_081464416.1|657762_658203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010112661.1|660061_661585_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_038801846.1|661599_662370_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	5.4e-36
WP_157759799.1|662921_663329_-	VOC family protein	NA	NA	NA	NA	NA
WP_144444742.1|664568_664850_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	40.8	1.5e-12
WP_010110960.1|665457_667233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010110959.1|667540_668701_-	acyltransferase	NA	NA	NA	NA	NA
WP_052111544.1|668985_669207_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_041282304.1|669296_670118_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_010112057.1|670491_670977_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_010112058.1|670957_671311_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.5	1.1e-17
WP_052111534.1|671404_673003_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	37.4	1.7e-76
WP_038802499.1|673433_674756_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	52.3	2.2e-61
WP_038801680.1|676263_677478_-	acyltransferase	NA	NA	NA	NA	NA
WP_010110940.1|677487_678468_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010112661.1|680373_681897_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP013356	Burkholderia oklahomensis EO147 chromosome 2, complete sequence	3126684	1112453	1177668	3126684	holin,tRNA,transposase	Stx2-converting_phage(38.46%)	44	NA	NA
WP_010109390.1|1112453_1113293_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_157759761.1|1114141_1115470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107950941.1|1115523_1116335_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_081464421.1|1117690_1118848_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.6	4.2e-24
WP_050807587.1|1118895_1120728_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_038801745.1|1120912_1122226_+	PLP-dependent aminotransferase	NA	A0A2P1ELT3	Moumouvirus	28.6	3.1e-31
WP_038801747.1|1122356_1123490_+	sedoheptulose 7-phosphate cyclase	NA	A9YVT7	Ostreococcus_tauri_virus	29.8	8.0e-20
WP_010111686.1|1123455_1124256_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_038801744.1|1124302_1125085_+	radical SAM protein	NA	NA	NA	NA	NA
WP_107974039.1|1125103_1127863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081956129.1|1127859_1129722_+	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_081464419.1|1129718_1130477_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010111675.1|1130713_1130962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010111673.1|1131148_1132690_+	acyl-CoA ligase (AMP-forming), exosortase A system-associated	NA	A0A2K9KZV5	Tupanvirus	23.3	3.1e-19
WP_041282512.1|1133359_1133701_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	43.4	3.3e-14
WP_010111578.1|1134169_1134517_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	71.3	2.3e-39
WP_041282179.1|1134556_1136149_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.9	4.2e-144
WP_010111430.1|1136375_1136720_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	71.3	6.5e-42
WP_038801724.1|1136750_1138301_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.1	1.8e-147
WP_144444734.1|1138873_1139215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010111426.1|1139594_1140596_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	26.6	9.5e-17
WP_041282176.1|1140821_1143365_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	29.8	2.8e-12
WP_081956128.1|1143361_1144666_+	hexose kinase	NA	NA	NA	NA	NA
WP_041282174.1|1144687_1146628_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_081464295.1|1147028_1147790_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010109386.1|1148025_1149444_+	MFS transporter	NA	NA	NA	NA	NA
WP_010109384.1|1149966_1150980_-	DUF2891 domain-containing protein	NA	NA	NA	NA	NA
WP_010109382.1|1151107_1151761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010109377.1|1152805_1153570_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010109376.1|1153774_1154971_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010109374.1|1154993_1156601_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	54.4	2.3e-20
WP_010109373.1|1156709_1157495_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010109372.1|1157608_1159609_+	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_010109371.1|1159750_1160896_+	DUF2827 domain-containing protein	NA	NA	NA	NA	NA
WP_010109368.1|1161440_1162589_-	DUF2827 domain-containing protein	NA	NA	NA	NA	NA
WP_081464293.1|1162611_1163769_-	DUF2827 domain-containing protein	NA	NA	NA	NA	NA
WP_107974060.1|1163762_1170833_-	hemagglutinin	NA	NA	NA	NA	NA
WP_038801529.1|1171960_1172860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010109357.1|1172999_1173215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081464292.1|1173592_1174261_-	FMN reductase	NA	NA	NA	NA	NA
WP_144444733.1|1174780_1175044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144444732.1|1175119_1175518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099976066.1|1175564_1176773_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	2.7e-26
WP_010109350.1|1176765_1177668_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
>prophage 3
NZ_CP013356	Burkholderia oklahomensis EO147 chromosome 2, complete sequence	3126684	2487957	2533807	3126684	integrase,transposase	Pseudomonas_phage(12.5%)	47	2477894:2477912	2548942:2548960
2477894:2477912	attL	CGAGCGCGGCGCGCGCGTG	NA	NA	NA	NA
WP_038802587.1|2487957_2489562_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_144444715.1|2490037_2490244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010111524.1|2490605_2490797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010111521.1|2490934_2491276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038801731.1|2491427_2492477_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_107974045.1|2493752_2494004_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_010112582.1|2494115_2494499_+	HNH endonuclease	NA	D4FUN2	Pseudomonas_phage	42.6	5.4e-05
WP_010112584.1|2494772_2495255_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_124072382.1|2495689_2496130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802795.1|2496849_2498172_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	52.3	2.2e-61
WP_010107941.1|2498532_2500548_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_050807541.1|2500541_2500913_-	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_010107938.1|2501011_2502994_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	44.1	1.2e-79
WP_010107936.1|2503284_2504184_+	DMT family transporter	NA	NA	NA	NA	NA
WP_010107934.1|2504353_2504962_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.5	1.4e-23
WP_010107932.1|2505001_2506525_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_010107930.1|2506679_2507156_+	bacterioferritin	NA	NA	NA	NA	NA
WP_010107928.1|2507211_2508084_+	glutamate racemase	NA	NA	NA	NA	NA
WP_010107927.1|2508218_2508458_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_010107925.1|2508721_2509411_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_010107924.1|2509448_2510180_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_025990136.1|2510193_2510628_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_010107921.1|2511000_2511972_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010107919.1|2512094_2512967_+	pirin family protein	NA	NA	NA	NA	NA
WP_010107917.1|2513087_2513573_+	DUF1857 family protein	NA	NA	NA	NA	NA
WP_010107913.1|2513716_2513983_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_038801279.1|2514266_2514677_-	heme-binding protein	NA	NA	NA	NA	NA
WP_010107909.1|2514736_2516137_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_010107907.1|2516133_2516976_-	iron permease FTR1	NA	NA	NA	NA	NA
WP_010107905.1|2517031_2517361_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_025990134.1|2517420_2517972_-	membrane protein	NA	NA	NA	NA	NA
WP_010107901.1|2518194_2520285_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_010107899.1|2520575_2521775_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_041281912.1|2521963_2522752_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_010111116.1|2522939_2523911_+	NADP-dependent aryl-alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_010111114.1|2524048_2524894_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_010111111.1|2524909_2525218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009893974.1|2525373_2525520_-	DUF3563 family protein	NA	NA	NA	NA	NA
WP_010111105.1|2525739_2526144_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_081464416.1|2526921_2527362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159086819.1|2527379_2527709_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	1.7e-07
WP_081956048.1|2527760_2529320_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.0	3.1e-38
WP_081956049.1|2529259_2529472_+	hypothetical protein	NA	A0A0P0ZBS5	Stx2-converting_phage	48.8	1.3e-05
WP_010112843.1|2529516_2529903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107974046.1|2531115_2531889_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	57.2	1.2e-80
WP_041282424.1|2531932_2532505_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_041281907.1|2532673_2533807_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
2548942:2548960	attR	CACGCGCGCGCCGCGCTCG	NA	NA	NA	NA
>prophage 4
NZ_CP013356	Burkholderia oklahomensis EO147 chromosome 2, complete sequence	3126684	2590119	2598767	3126684	terminase,integrase	Shigella_phage(16.67%)	11	2584893:2584911	2608184:2608202
2584893:2584911	attL	CCGCTCACGCGCGACACGA	NA	NA	NA	NA
WP_010107885.1|2590119_2591298_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9ZXG4	Shigella_phage	28.8	1.8e-11
WP_144444714.1|2591297_2591624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107974049.1|2591547_2591919_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010107879.1|2592228_2592921_+	putative transcriptional regulator	NA	A5X9F5	Aeromonas_virus	37.4	8.8e-30
WP_010107878.1|2593045_2593495_-	hypothetical protein	NA	D6RRP3	Pseudomonas_phage	38.7	2.3e-15
WP_010107873.1|2593989_2594397_-	hypothetical protein	NA	A0A0N7E4J9	Mycobacterium_phage	51.1	2.6e-29
WP_038801264.1|2594511_2594733_-	hypothetical protein	NA	Q6IWT4	Burkholderia_phage	80.0	4.1e-05
WP_010107871.1|2594822_2594960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010107869.1|2595266_2595491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144444713.1|2596420_2596624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010107867.1|2596961_2598767_-|terminase	phage terminase large subunit	terminase	A0A076YJ70	Mesorhizobium_phage	41.4	6.8e-106
2608184:2608202	attR	TCGTGTCGCGCGTGAGCGG	NA	NA	NA	NA
>prophage 5
NZ_CP013356	Burkholderia oklahomensis EO147 chromosome 2, complete sequence	3126684	2613681	2622851	3126684		Synechococcus_phage(28.57%)	10	NA	NA
WP_144444710.1|2613681_2615922_-	hypothetical protein	NA	I3ULX0	Synechococcus_phage	24.0	4.4e-30
WP_010107838.1|2616012_2616591_-	hypothetical protein	NA	A0A076YQK3	Mesorhizobium_phage	34.7	4.2e-17
WP_144444709.1|2616651_2617650_-	hypothetical protein	NA	A0A2D0Z820	Vibrio_phage	32.5	1.1e-25
WP_107974052.1|2617804_2618593_-	hypothetical protein	NA	M4NJX6	Synechococcus_phage	41.2	2.1e-11
WP_107974053.1|2618589_2620116_-	hypothetical protein	NA	M1IPM1	Pelagibacter_phage	32.4	1.1e-51
WP_144444708.1|2620115_2620301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157759735.1|2620293_2620434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010107828.1|2620934_2621525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010107827.1|2621524_2622079_-	hypothetical protein	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	39.4	2.3e-33
WP_010107826.1|2622056_2622851_-	putative phage exonuclease	NA	L7TLU4	Rhizobium_phage	36.3	5.2e-26
