The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013358	Burkholderia oklahomensis C6786 chromosome 1, complete sequence	4131753	195278	202634	4131753	transposase	Burkholderia_phage(50.0%)	7	NA	NA
WP_010117455.1|195278_195821_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	59.1	7.6e-53
WP_010117454.1|196078_196531_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	53.1	3.7e-29
WP_010117452.1|196530_197607_+	DUF3396 domain-containing protein	NA	A9YX32	Burkholderia_phage	91.7	4.3e-148
WP_010117446.1|198671_199820_+	DNA cytosine methyltransferase	NA	I6NLI4	Burkholderia_phage	61.4	3.4e-135
WP_010117442.1|199819_200752_+	DUF4928 family protein	NA	NA	NA	NA	NA
WP_010117439.1|200748_201207_+	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	54.8	8.4e-37
WP_107950858.1|201434_202634_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.2	4.6e-42
>prophage 2
NZ_CP013358	Burkholderia oklahomensis C6786 chromosome 1, complete sequence	4131753	424542	448354	4131753	protease,plate,integrase,transposase	Burkholderia_phage(42.86%)	20	417057:417074	457884:457901
417057:417074	attL	CGGTCGACGTCGACGCGA	NA	NA	NA	NA
WP_010117239.1|424542_425073_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.5	1.2e-21
WP_010117237.1|425245_426274_-|integrase	tyrosine-type recombinase/integrase	integrase	E5E3T0	Burkholderia_phage	88.3	2.4e-172
WP_038802022.1|426273_426552_-	DUF4224 domain-containing protein	NA	E5E3T1	Burkholderia_phage	84.1	1.2e-33
WP_081469853.1|426656_427223_-|plate	Baseplate J family protein	plate	A0A089FGR9	Burkholderia_phage	79.3	3.8e-47
WP_085970859.1|427414_428648_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.8	6.9e-102
WP_010117664.1|430302_430740_+	SET domain-containing protein	NA	NA	NA	NA	NA
WP_010117665.1|430756_431773_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010117666.1|431789_432242_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025990088.1|432771_433617_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010117668.1|433603_434458_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010117669.1|434454_435486_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_010117671.1|436147_436456_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_082094620.1|436879_439660_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.2	8.0e-90
WP_045568122.1|439673_441914_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	27.7	8.1e-24
WP_045568296.1|442052_443579_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_010117228.1|443588_443852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107950761.1|443985_444743_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107950862.1|445163_446132_+	hemagglutinin	NA	NA	NA	NA	NA
WP_010117222.1|446225_447011_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_010106783.1|447007_448354_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
457884:457901	attR	CGGTCGACGTCGACGCGA	NA	NA	NA	NA
>prophage 3
NZ_CP013358	Burkholderia oklahomensis C6786 chromosome 1, complete sequence	4131753	795299	804689	4131753		Hokovirus(16.67%)	7	NA	NA
WP_010116963.1|795299_797249_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.3	5.0e-147
WP_010116959.1|797510_798644_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.6	1.7e-22
WP_010116957.1|798675_800676_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	32.2	2.7e-55
WP_010116954.1|801000_801816_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	31.7	3.7e-35
WP_010116953.1|801880_802564_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	4.4e-05
WP_010116951.1|802560_803088_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_010106192.1|803123_804689_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.6	3.3e-24
>prophage 4
NZ_CP013358	Burkholderia oklahomensis C6786 chromosome 1, complete sequence	4131753	2272620	2288667	4131753	integrase,transposase	Leptospira_phage(25.0%)	14	2263860:2263877	2294049:2294066
2263860:2263877	attL	CGTCGCGAGGCCGAGCGC	NA	NA	NA	NA
WP_025989824.1|2272620_2274225_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_010107948.1|2274324_2274678_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	43.0	1.3e-16
WP_010115644.1|2274677_2275172_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_010112228.1|2275521_2275722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010112230.1|2275718_2276177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085970860.1|2277147_2278358_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	64.8	4.0e-102
WP_010121075.1|2279813_2280206_-	DUF3331 domain-containing protein	NA	NA	NA	NA	NA
WP_010121077.1|2280247_2281540_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_025990429.1|2281678_2282350_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_107950808.1|2282548_2283359_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107950810.1|2283656_2284474_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.0	2.5e-07
WP_124072273.1|2285454_2286177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045568335.1|2286440_2287055_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A090C6M9	Clostridium_phage	29.0	7.1e-07
WP_010122425.1|2287635_2288667_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
2294049:2294066	attR	CGTCGCGAGGCCGAGCGC	NA	NA	NA	NA
>prophage 5
NZ_CP013358	Burkholderia oklahomensis C6786 chromosome 1, complete sequence	4131753	2471412	2557678	4131753	plate,tRNA,coat,transposase	uncultured_Caudovirales_phage(21.43%)	66	NA	NA
WP_010115792.1|2471412_2474037_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	40.0	4.5e-82
WP_010115794.1|2474699_2475920_+	CoA transferase	NA	NA	NA	NA	NA
WP_010115800.1|2477141_2478851_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	56.5	1.0e-183
WP_081469778.1|2479089_2479557_-	NUDIX domain-containing protein	NA	A0A2I6PFL2	Proteus_phage	42.8	1.2e-22
WP_010104311.1|2479584_2479971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081469777.1|2480199_2482254_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_025989856.1|2482406_2483267_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_010115807.1|2483291_2484569_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_010115809.1|2484607_2485795_+	MFS transporter	NA	NA	NA	NA	NA
WP_010115812.1|2485791_2486880_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2D2W2B8	Stenotrophomonas_phage	27.5	4.8e-14
WP_010115814.1|2486876_2487080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025989857.1|2487231_2488578_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_085967512.1|2488759_2490394_+	acid phosphatase	NA	NA	NA	NA	NA
WP_010115818.1|2490751_2491945_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_010115820.1|2492014_2492272_-	trans-aconitate methyltransferase	NA	NA	NA	NA	NA
WP_038802563.1|2492279_2492912_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_025989858.1|2492912_2494988_-	response regulator	NA	A0A1V0SGR3	Hokovirus	26.3	5.9e-13
WP_010115833.1|2495401_2496367_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_081469782.1|2496382_2498728_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_025989859.1|2498835_2499675_-	molecular chaperone	NA	NA	NA	NA	NA
WP_038800852.1|2499692_2500217_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_010104331.1|2500299_2500860_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_025989860.1|2500912_2501458_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_157135620.1|2502061_2502211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010104335.1|2502287_2503181_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081469781.1|2503600_2504863_+	MFS transporter	NA	NA	NA	NA	NA
WP_010115846.1|2504908_2505835_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025989861.1|2506307_2506589_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_081464045.1|2507039_2507342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025989862.1|2507952_2508606_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010115854.1|2508924_2509875_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	37.3	3.2e-06
WP_010115856.1|2510019_2510868_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010115858.1|2510892_2512053_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_010115860.1|2512065_2513244_+	CoA transferase	NA	NA	NA	NA	NA
WP_010104356.1|2513325_2514708_+	MFS transporter	NA	NA	NA	NA	NA
WP_025989863.1|2515088_2515928_-	CoA ester lyase	NA	NA	NA	NA	NA
WP_010122797.1|2517071_2518385_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_045568013.1|2519114_2520077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124072275.1|2520212_2520527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081470019.1|2521621_2522308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157135687.1|2522569_2523679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010111647.1|2523903_2524251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045568267.1|2524372_2525275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081464047.1|2525388_2528214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010115868.1|2528234_2529110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025989864.1|2529111_2531952_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_010104373.1|2531963_2532518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124072276.1|2532554_2532782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010104375.1|2532868_2533363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045568014.1|2533340_2536676_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.5	2.6e-10
WP_038801968.1|2536784_2539193_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_010104384.1|2539189_2539789_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_025989866.1|2539785_2540364_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_010115877.1|2540476_2541313_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_010115878.1|2541315_2544114_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.6	8.2e-26
WP_010115879.1|2544630_2544897_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_082094579.1|2544893_2546327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010122528.1|2546406_2548257_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_085970897.1|2548542_2549677_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.9	4.5e-15
WP_081470033.1|2550053_2550773_+	type III secretion system effector phosphothreonine lyase	NA	NA	NA	NA	NA
WP_107950886.1|2551006_2551993_-	helix-turn-helix domain-containing protein	NA	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	66.0	4.8e-98
WP_010122519.1|2552130_2553753_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	31.8	1.9e-54
WP_010122518.1|2553852_2554206_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.8	6.3e-16
WP_010122516.1|2554205_2554679_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_010112332.1|2555212_2556130_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	43.3	6.1e-71
WP_010112330.1|2556325_2557678_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	48.6	1.0e-98
>prophage 6
NZ_CP013358	Burkholderia oklahomensis C6786 chromosome 1, complete sequence	4131753	2586234	2671526	4131753	transposase,capsid,integrase,head,terminase,holin,tail,portal	Burkholderia_virus(90.77%)	96	2611683:2611728	2668087:2668132
WP_038802199.1|2586234_2587635_+|integrase	integrase family protein	integrase	NA	NA	NA	NA
WP_144411686.1|2587908_2588808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081470040.1|2589618_2590275_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_081470039.1|2590602_2591307_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_124072278.1|2591296_2591647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107950866.1|2591739_2592939_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.7	1.2e-42
WP_025990584.1|2593747_2594062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124072279.1|2594075_2594417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124072280.1|2595028_2596267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010122736.1|2596862_2598023_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_010122737.1|2598024_2599431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802202.1|2599427_2599973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124072281.1|2600374_2601709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010122741.1|2601816_2603268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124072282.1|2603298_2605068_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_085970860.1|2605126_2606337_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	64.8	4.0e-102
WP_082094580.1|2606415_2607021_-	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_010121254.1|2607274_2607613_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_082094581.1|2608898_2610500_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_010121256.1|2610659_2611430_-	hypothetical protein	NA	NA	NA	NA	NA
2611683:2611728	attL	CTGGCCCGCCCTACACGATTCGAACGTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_124072283.1|2611744_2612110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010121261.1|2612216_2612885_-	DUF159 family protein	NA	Q8W6R8	Burkholderia_virus	92.8	4.1e-125
WP_025990441.1|2612969_2613611_+	hypothetical protein	NA	Q8W6R9	Burkholderia_virus	89.7	1.3e-107
WP_025990442.1|2613740_2614835_-	DUF3396 domain-containing protein	NA	Q8W6S0	Burkholderia_virus	95.5	5.2e-202
WP_010109969.1|2614862_2615597_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	96.3	7.0e-134
WP_010121267.1|2615593_2616154_-	hypothetical protein	NA	A4JX23	Burkholderia_virus	93.5	1.8e-97
WP_081470002.1|2616349_2617249_-	hypothetical protein	NA	A4JX22	Burkholderia_virus	83.3	4.4e-130
WP_010121271.1|2617310_2617853_-	lysozyme	NA	Q8W6S5	Burkholderia_virus	87.2	1.9e-72
WP_025990443.1|2617852_2618350_-	lysozyme	NA	A4JX20	Burkholderia_virus	79.5	3.1e-69
WP_025990444.1|2618342_2618555_-|holin	holin	holin	A4JX19	Burkholderia_virus	100.0	1.3e-29
WP_081470003.1|2618597_2619314_-	hypothetical protein	NA	A4JX18	Burkholderia_virus	90.8	2.0e-125
WP_010121280.1|2619621_2622927_-	DUF1983 domain-containing protein	NA	Q8W6T0	Burkholderia_virus	94.5	0.0e+00
WP_025990446.1|2622923_2623508_-|tail	tail assembly protein	tail	Q8W6T1	Burkholderia_virus	93.3	2.5e-94
WP_010109982.1|2623504_2624257_-	C40 family peptidase	NA	Q6JIL4	Burkholderia_virus	89.2	4.2e-134
WP_010121284.1|2624306_2624990_-|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	95.2	2.8e-129
WP_010121286.1|2624986_2626372_-|tail	tail fiber domain-containing protein	tail	A4JX12	Burkholderia_virus	81.0	2.9e-221
WP_010121288.1|2626380_2626719_-|tail	phage tail protein	tail	Q8W6T5	Burkholderia_virus	92.0	7.8e-56
WP_010121289.1|2626715_2630780_-|tail	phage tail tape measure protein	tail	Q6JIL8	Burkholderia_virus	84.6	0.0e+00
WP_010109990.1|2630793_2631078_-	DUF4035 domain-containing protein	NA	Q6JIL9	Burkholderia_virus	93.6	3.5e-41
WP_025990447.1|2631077_2631542_-|tail	tail assembly protein	tail	A4JX08	Burkholderia_virus	90.3	5.5e-76
WP_025990448.1|2631569_2632025_-	hypothetical protein	NA	A4JX07	Burkholderia_virus	94.0	8.5e-74
WP_010121292.1|2632088_2632436_-	DUF3168 domain-containing protein	NA	Q6JIM2	Burkholderia_virus	93.0	4.0e-55
WP_009901139.1|2632432_2632855_-	HK97 gp10 family phage protein	NA	Q6JIM3	Burkholderia_virus	96.4	5.5e-67
WP_010121293.1|2632847_2633174_-|head	phage head closure protein	head	Q8W6U2	Burkholderia_virus	95.4	1.6e-53
WP_010121294.1|2633173_2633740_-	hypothetical protein	NA	Q8W6U3	Burkholderia_virus	92.0	1.4e-94
WP_010121295.1|2633746_2633932_-	hypothetical protein	NA	Q8W6U4	Burkholderia_virus	75.4	9.2e-19
WP_010121296.1|2633991_2635299_-|capsid	phage major capsid protein	capsid	A4JX01	Burkholderia_virus	86.2	1.1e-201
WP_010121298.1|2635400_2636369_-	S49 family peptidase	NA	A4JX00	Burkholderia_virus	93.8	5.2e-161
WP_025990449.1|2636365_2637625_-|portal	phage portal protein	portal	Q8W6U7	Burkholderia_virus	94.0	9.8e-229
WP_010121302.1|2637628_2637814_-	hypothetical protein	NA	Q8W6U8	Burkholderia_virus	83.6	8.6e-17
WP_010121303.1|2637810_2639523_-|terminase	terminase large subunit	terminase	Q8W6U9	Burkholderia_virus	95.8	0.0e+00
WP_025990450.1|2639532_2640018_-|terminase	phage terminase small subunit P27 family	terminase	Q8W6V0	Burkholderia_virus	94.4	7.4e-84
WP_025990451.1|2640166_2640523_-	HNH endonuclease	NA	Q8W6N0	Burkholderia_virus	93.2	1.1e-60
WP_004549735.1|2640583_2640841_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q8W6N1	Burkholderia_virus	100.0	2.4e-41
WP_004548635.1|2640837_2641224_+	helix-turn-helix transcriptional regulator	NA	Q8W6N2	Burkholderia_virus	99.2	1.4e-64
WP_010121307.1|2642655_2643855_+	nucleoside 2-deoxyribosyltransferase	NA	NA	NA	NA	NA
WP_010121309.1|2643851_2644448_+	7-cyano-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_157135679.1|2644434_2645097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010121313.1|2645112_2645904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010121314.1|2646277_2646925_-	hypothetical protein	NA	Q8W6N4	Burkholderia_virus	91.1	1.2e-102
WP_025990452.1|2646933_2647194_-	hypothetical protein	NA	Q8W6N5	Burkholderia_virus	84.9	1.9e-38
WP_124072284.1|2647169_2647478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010121320.1|2647474_2647897_-	DUF1364 family protein	NA	Q6JIF7	Burkholderia_virus	74.5	4.2e-51
WP_025990453.1|2647893_2648268_-	hypothetical protein	NA	A4JX57	Burkholderia_virus	84.7	6.8e-53
WP_010121324.1|2648264_2648768_-	DUF1064 domain-containing protein	NA	A4JX56	Burkholderia_virus	87.4	1.0e-75
WP_038802137.1|2648812_2649805_-	hypothetical protein	NA	Q6JIG0	Burkholderia_virus	97.6	7.1e-174
WP_010110014.1|2649958_2650219_-	helix-turn-helix domain-containing protein	NA	Q6JIG2	Burkholderia_virus	87.2	1.3e-34
WP_010121328.1|2650215_2651037_-	hypothetical protein	NA	Q8W6P2	Burkholderia_virus	97.4	3.5e-142
WP_010121330.1|2651071_2652034_-	phosphoadenosine phosphosulfate reductase family protein	NA	A9YWY5	Burkholderia_phage	96.5	2.0e-165
WP_085970892.1|2652030_2653263_-	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	53.8	4.3e-112
WP_010110021.1|2653273_2653714_-	hypothetical protein	NA	Q8W6P5	Burkholderia_virus	89.0	1.0e-68
WP_009901179.1|2653897_2654134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107950890.1|2654385_2654625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038801590.1|2654631_2654946_-	transcriptional regulator	NA	Q6JIG9	Burkholderia_virus	82.2	2.3e-41
WP_010110024.1|2655009_2655411_+	hypothetical protein	NA	Q6JIH0	Burkholderia_virus	89.5	8.9e-59
WP_010110026.1|2655756_2657046_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	91.1	8.3e-215
WP_025990457.1|2657200_2658094_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	92.3	5.8e-159
WP_085970893.1|2658441_2658708_+	hypothetical protein	NA	Q8W6Q1	Burkholderia_virus	88.2	4.1e-36
WP_010121339.1|2658718_2658850_+	hypothetical protein	NA	Q8W6Q2	Burkholderia_virus	78.6	4.2e-10
WP_038802134.1|2659061_2659298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010121343.1|2659343_2659559_+	hypothetical protein	NA	Q6JIH9	Burkholderia_virus	80.3	1.1e-28
WP_025990459.1|2660075_2660714_-	hypothetical protein	NA	A4JX33	Burkholderia_virus	56.3	6.5e-11
WP_010121347.1|2660963_2661113_+	hypothetical protein	NA	Q8W6Q6	Burkholderia_virus	93.9	8.2e-18
WP_010121349.1|2661109_2661922_+	prohibitin family protein	NA	Q8W6Q7	Burkholderia_virus	95.9	1.7e-141
WP_010121351.1|2662180_2662342_+	hypothetical protein	NA	Q8W6Q8	Burkholderia_virus	83.0	7.3e-12
WP_157135680.1|2663771_2663930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124072285.1|2663922_2664162_+	hypothetical protein	NA	Q6JIJ1	Burkholderia_virus	78.4	3.1e-27
WP_010121356.1|2664158_2664419_+	hypothetical protein	NA	A9YWU5	Burkholderia_phage	81.2	3.8e-34
WP_107950822.1|2664411_2664696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010121358.1|2664692_2665736_+	phage Gp37/Gp68 family protein	NA	Q8W6R4	Burkholderia_virus	66.2	6.4e-133
WP_010121362.1|2666173_2666383_-	hypothetical protein	NA	Q6JIJ5	Burkholderia_virus	91.3	2.4e-31
WP_025990460.1|2666464_2666689_-	hypothetical protein	NA	Q6JIJ6	Burkholderia_virus	89.2	4.7e-33
WP_010121366.1|2666982_2668062_+|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	38.2	4.5e-57
WP_010121369.1|2668330_2669161_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
2668087:2668132	attR	CTGGCCCGCCCTACACGATTCGAACGTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_010102906.1|2669710_2670619_+	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_010102904.1|2670824_2671526_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	43.8	1.9e-11
>prophage 7
NZ_CP013358	Burkholderia oklahomensis C6786 chromosome 1, complete sequence	4131753	3181551	3189964	4131753	transposase	Stx2-converting_phage(50.0%)	6	NA	NA
WP_124072298.1|3181551_3183345_+	alpha-galactosidase	NA	A0A2P0VP48	Tetraselmis_virus	30.3	4.6e-46
WP_010112903.1|3183939_3184293_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.8	9.7e-17
WP_038802501.1|3185726_3187274_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	51.2	2.2e-137
WP_010122309.1|3187416_3188781_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.5	5.2e-34
WP_038802500.1|3189227_3189560_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	71.6	4.7e-37
WP_038802864.1|3189556_3189964_-	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	44.1	2.0e-13
>prophage 8
NZ_CP013358	Burkholderia oklahomensis C6786 chromosome 1, complete sequence	4131753	3268659	3279517	4131753	protease	Agrobacterium_phage(16.67%)	9	NA	NA
WP_010114282.1|3268659_3270960_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.3	6.7e-167
WP_009892611.1|3270956_3271271_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	2.6e-13
WP_004196460.1|3271800_3272004_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_045568050.1|3272127_3273714_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_010102073.1|3273881_3275141_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	1.5e-11
WP_010102068.1|3275400_3275979_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_081463944.1|3276242_3276458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025989693.1|3276645_3277155_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.5e-14
WP_010102066.1|3277402_3279517_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.8	4.4e-56
