The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014994	Salmonella enterica subsp. enterica serovar Tennessee strain CFSAN001387 chromosome, complete genome	4834050	886509	905009	4834050	tRNA,tail,integrase	Morganella_phage(27.27%)	22	882351:882364	897583:897596
882351:882364	attL	ACGGCGTAAACGCG	NA	NA	NA	NA
WP_010989230.1|886509_887607_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003339.1|887617_889135_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.1	4.8e-89
WP_000133999.1|889210_889756_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000244323.1|890020_890779_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	39.5	1.2e-11
WP_001131482.1|891096_892323_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.9	5.0e-145
WP_000884061.1|892459_892777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929410.1|892794_893253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024133422.1|893501_893699_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.4	6.6e-07
WP_000412530.1|893698_894133_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	54.3	1.5e-30
WP_000151280.1|894146_894734_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	53.9	1.6e-48
WP_122815458.1|894775_895522_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001024423.1|895518_895782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000064544.1|895778_895979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000064170.1|895975_896602_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.6	2.9e-24
WP_000628971.1|896611_896959_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	62.2	6.2e-32
WP_001244101.1|896951_899708_+	TOPRIM and DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.5	7.7e-303
897583:897596	attR	ACGGCGTAAACGCG	NA	NA	NA	NA
WP_000126707.1|900046_900493_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000245846.1|900504_900780_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000676494.1|900878_901352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000235158.1|901506_901677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000436982.1|901676_901997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338659.1|902006_905009_+|tail	phage tail length tape measure family protein	tail	B1GS57	Salmonella_phage	49.8	7.5e-118
>prophage 2
NZ_CP014994	Salmonella enterica subsp. enterica serovar Tennessee strain CFSAN001387 chromosome, complete genome	4834050	1493185	1552977	4834050	portal,terminase,integrase,protease,tRNA,coat,holin	Salmonella_phage(58.73%)	83	1513926:1513942	1535065:1535081
WP_001208732.1|1493185_1493389_-	hypothetical protein	NA	C6ZR24	Salmonella_phage	97.0	2.7e-32
WP_001538065.1|1493485_1493830_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	95.6	3.6e-56
WP_001538064.1|1493907_1494207_-	hypothetical protein	NA	G9L655	Escherichia_phage	98.0	1.6e-52
WP_000002089.1|1494300_1494582_-	hypothetical protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	97.8	5.9e-49
WP_023199524.1|1494574_1495261_-	DUF551 domain-containing protein	NA	A0A220NQU1	Salmonella_phage	91.0	1.0e-62
WP_000582226.1|1495271_1496027_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	99.2	2.4e-150
WP_086016725.1|1496026_1496473_-	hypothetical protein	NA	H6WRY0	Salmonella_phage	98.2	5.3e-52
WP_000665846.1|1496469_1496847_-	hypothetical protein	NA	I6R9B7	Salmonella_phage	89.6	1.9e-55
WP_001214775.1|1496843_1497014_-	DUF2737 family protein	NA	I6S642	Salmonella_phage	98.2	5.1e-24
WP_000753553.1|1497030_1497345_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	96.2	6.5e-49
WP_000041317.1|1497356_1497839_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	98.8	1.4e-79
WP_000065844.1|1497822_1498725_-	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	87.8	2.6e-146
WP_000604111.1|1498721_1499030_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	100.0	1.1e-53
WP_001243355.1|1499115_1499268_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000972063.1|1499252_1499387_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_000776966.1|1499462_1499774_-	superinfection exclusion protein	NA	A0A0N7BTN9	Escherichia_phage	99.0	9.3e-56
WP_000394576.1|1500097_1500388_-	hypothetical protein	NA	K7PH98	Enterobacteria_phage	75.8	5.1e-32
WP_000213980.1|1500427_1500628_-	antirestriction Ral family protein	NA	A0A1R3Y5S4	Salmonella_virus	93.9	9.6e-30
WP_129464611.1|1500751_1500958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000216176.1|1500967_1501306_-	hypothetical protein	NA	E7C9Q7	Salmonella_phage	98.2	9.2e-57
WP_000856894.1|1501656_1502319_-	LexA family transcriptional regulator	NA	A0A0M4QWY1	Salmonella_phage	99.5	1.7e-126
WP_000067726.1|1502437_1502653_+	helix-turn-helix transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
WP_000424138.1|1502760_1503051_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	100.0	2.4e-45
WP_000166968.1|1503071_1503233_+	hypothetical protein	NA	I6R9C7	Salmonella_phage	100.0	1.0e-21
WP_000539344.1|1503219_1504068_+	replication protein	NA	C6ZR51	Salmonella_phage	95.7	8.5e-152
WP_001537966.1|1504178_1506059_+	toprim domain-containing protein	NA	A0A0M4R313	Salmonella_phage	99.0	0.0e+00
WP_001064629.1|1506059_1506338_+	hypothetical protein	NA	C6ZR54	Salmonella_phage	97.8	1.9e-47
WP_001000121.1|1506408_1506687_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	93.4	4.3e-44
WP_000814615.1|1506683_1507094_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	7.2e-72
WP_001254249.1|1507090_1507267_+	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.0e-27
WP_001537967.1|1507269_1507707_+	DUF2591 family protein	NA	A0A088CQ65	Enterobacteria_phage	38.3	6.4e-10
WP_000950971.1|1507699_1507873_+	protein ninF	NA	A0A220NQX7	Salmonella_phage	100.0	5.6e-26
WP_001537969.1|1507865_1508168_+	hypothetical protein	NA	A0A220NQY7	Salmonella_phage	100.0	3.8e-54
WP_000002249.1|1508160_1508451_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	99.0	6.5e-51
WP_000861017.1|1508447_1508843_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1V0E5J0	Salmonella_phage	100.0	1.2e-71
WP_001287665.1|1508839_1509409_+	HNH endonuclease	NA	A0A192Y683	Salmonella_phage	100.0	1.1e-107
WP_000149880.1|1509405_1509609_+	phage NinH family protein	NA	A0A1V0E5I5	Salmonella_phage	100.0	5.5e-33
WP_000219140.1|1509589_1509769_+	hypothetical protein	NA	E7C9S6	Salmonella_phage	98.3	1.2e-23
WP_001235465.1|1509765_1510389_+	antitermination protein	NA	C6ZR62	Salmonella_phage	99.0	1.5e-113
WP_024133454.1|1510833_1511061_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000078277.1|1511035_1511503_+	glycoside hydrolase family protein	NA	H9C148	Vibrio_phage	45.8	2.5e-28
WP_000182933.1|1511726_1512014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877025.1|1512383_1512914_+	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	96.0	9.0e-91
WP_164708966.1|1513163_1513433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049779930.1|1513422_1513632_+	DUF551 domain-containing protein	NA	A0A193GZ43	Enterobacter_phage	81.5	3.0e-26
WP_000807785.1|1513779_1514022_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
1513926:1513942	attL	CCAGTCAGGCGGCGCTA	NA	NA	NA	NA
WP_001140559.1|1514025_1514415_+	hypothetical protein	NA	C6ZR72	Salmonella_phage	98.4	3.3e-74
WP_000013070.1|1514414_1514819_+	hypothetical protein	NA	C6ZR73	Salmonella_phage	98.5	1.7e-65
WP_000729924.1|1514822_1515311_+	DNA-packaging protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
WP_000417855.1|1515288_1516788_+|terminase	terminase large subunit	terminase	A0A1R3Y5N2	Salmonella_virus	100.0	2.8e-307
WP_000774653.1|1516787_1518965_+|portal	portal protein	portal	A0A1R3Y5N6	Salmonella_virus	99.3	0.0e+00
WP_000433852.1|1518978_1519890_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_001196939.1|1519889_1521182_+|coat	coat protein	coat	Q76H21	Enterobacteria_phage	99.3	1.8e-241
WP_000538675.1|1521222_1521783_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	98.4	7.0e-102
WP_001166102.1|1521766_1522267_+	packaged DNA stabilization gp4 family protein	NA	I1TEJ0	Salmonella_phage	98.2	1.2e-89
WP_001122422.1|1522226_1523645_+	packaged DNA stabilization protein gp10	NA	I1TEJ1	Salmonella_phage	98.7	7.3e-273
WP_000774930.1|1523648_1524287_+	hypothetical protein	NA	A0A088CPT1	Enterobacteria_phage	94.8	3.4e-84
WP_000627701.1|1524286_1524742_+	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	99.3	8.8e-87
WP_000964894.1|1524744_1525434_+	hypothetical protein	NA	B9UDK9	Salmonella_phage	91.7	5.6e-93
WP_000190208.1|1525443_1526814_+	phage DNA ejection protein	NA	A0A1R3Y5Q4	Salmonella_virus	96.9	3.4e-243
WP_000868965.1|1526813_1528880_+	hypothetical protein	NA	B9UDL1	Salmonella_phage	81.1	1.1e-288
WP_001112911.1|1528956_1530717_+	right-handed parallel beta-helix repeat-containing protein	NA	Q9AYY6	Salmonella_phage	57.1	9.1e-55
WP_001060564.1|1530753_1532205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000703620.1|1532201_1533119_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	90.8	6.0e-159
WP_000915518.1|1533115_1533478_-	GtrA family protein	NA	I1TED9	Salmonella_phage	83.3	1.2e-51
WP_023199727.1|1533613_1534783_-|integrase	tyrosine-type recombinase/integrase	integrase	I6R0M2	Salmonella_phage	99.5	3.5e-228
WP_000377772.1|1535096_1536038_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	88.2	1.4e-147
1535065:1535081	attR	TAGCGCCGCCTGACTGG	NA	NA	NA	NA
WP_000776787.1|1536326_1537082_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_001537977.1|1537142_1538450_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000030904.1|1538820_1539105_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001248132.1|1539282_1540593_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000214144.1|1540592_1542740_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195800.1|1542948_1543434_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000730794.1|1543533_1544085_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001537978.1|1544250_1545183_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000918460.1|1545218_1546304_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.5	1.6e-89
WP_000750429.1|1546307_1547132_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000368599.1|1547131_1547941_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001066345.1|1547940_1548489_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559749.1|1548521_1548797_+	YfcL family protein	NA	NA	NA	NA	NA
WP_000816083.1|1548848_1550849_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817159.1|1551008_1552223_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_001142912.1|1552320_1552977_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP014994	Salmonella enterica subsp. enterica serovar Tennessee strain CFSAN001387 chromosome, complete genome	4834050	1773428	1782599	4834050	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_000569166.1|1773428_1774376_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824852.1|1774359_1775091_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1775071_1775179_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1775238_1775970_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1776192_1777878_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1777874_1778594_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1778640_1779108_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000703137.1|1779866_1780325_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195343.1|1780565_1782599_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 4
NZ_CP014994	Salmonella enterica subsp. enterica serovar Tennessee strain CFSAN001387 chromosome, complete genome	4834050	1976578	1983805	4834050		Morganella_phage(33.33%)	8	NA	NA
WP_000394196.1|1976578_1976998_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457659.1|1977000_1978269_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.7	1.7e-225
WP_000208509.1|1978714_1978927_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1978937_1979126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080668.1|1979386_1980565_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	6.6e-110
WP_000107439.1|1981214_1981526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377038.1|1981605_1982301_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.2	2.8e-07
WP_001157313.1|1982374_1983805_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
NZ_CP014994	Salmonella enterica subsp. enterica serovar Tennessee strain CFSAN001387 chromosome, complete genome	4834050	2053120	2107022	4834050	tail,lysis,terminase,tRNA,holin	Salmonella_phage(68.97%)	64	NA	NA
WP_001025363.1|2053120_2054854_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.4	2.8e-85
WP_000024796.1|2055090_2055660_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185768.1|2055679_2056426_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_000569026.1|2056661_2057633_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019612.1|2057629_2058373_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.9	2.4e-25
WP_000252975.1|2058413_2058809_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_029412303.1|2058861_2059635_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	80.3	4.2e-57
WP_000357987.1|2059613_2060927_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	87.6	1.0e-228
WP_000065274.1|2060985_2061222_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	93.6	7.1e-40
WP_001237031.1|2061262_2061502_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077905240.1|2061544_2062702_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	98.7	2.8e-214
WP_000017131.1|2062664_2065580_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	97.2	0.0e+00
WP_023195475.1|2065706_2066057_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.8	2.0e-59
WP_000917563.1|2066078_2066237_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	100.0	2.4e-23
WP_001009038.1|2066633_2067038_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	100.0	4.2e-72
WP_000869364.1|2067167_2067404_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001538023.1|2067369_2067744_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	100.0	3.0e-64
WP_001540689.1|2067828_2068812_+	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800016.1|2068814_2069564_+	ATP-binding protein	NA	H6WRX8	Salmonella_phage	100.0	6.6e-140
WP_000113626.1|2069574_2069922_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	100.0	4.5e-59
WP_024145847.1|2069918_2070254_+	hypothetical protein	NA	H6WRY0	Salmonella_phage	97.2	8.8e-52
WP_000582226.1|2070253_2071009_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	99.2	2.4e-150
WP_023199006.1|2071019_2071886_+	DUF550 domain-containing protein	NA	A0A075B8H2	Enterobacteria_phage	76.0	6.8e-112
WP_001217670.1|2072406_2072646_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_001804676.1|2072701_2072941_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	5.9e-42
WP_000929802.1|2072980_2073583_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_001096543.1|2073791_2074403_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	96.6	2.7e-91
WP_000801757.1|2074399_2074540_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_000993186.1|2074536_2075226_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.2	5.3e-59
WP_164708967.1|2075426_2075768_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	7.4e-46
WP_001005894.1|2075770_2076397_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	80.7	7.1e-95
WP_023199005.1|2076393_2076876_+|lysis	lysis protein	lysis	H6WRZ5	Salmonella_phage	83.6	3.9e-61
WP_000877029.1|2077088_2077619_+	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	97.2	5.3e-91
WP_000147264.1|2077973_2078405_+|terminase	terminase small subunit	terminase	A0A1V0E5Q4	Salmonella_phage	100.0	7.6e-72
WP_000445799.1|2078388_2079708_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1V0E5Q3	Salmonella_phage	99.5	5.4e-262
WP_000130173.1|2079840_2081190_+	DUF1073 domain-containing protein	NA	Q5G8Y4	Enterobacteria_phage	98.9	7.0e-257
WP_000201916.1|2081149_2082076_+	hypothetical protein	NA	Q5G8Y3	Enterobacteria_phage	98.7	1.2e-170
WP_001122569.1|2082078_2083344_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	97.1	2.0e-229
WP_000092740.1|2083356_2083806_+	hypothetical protein	NA	I6S1Q2	Salmonella_phage	100.0	9.6e-78
WP_000273927.1|2083823_2084900_+	hypothetical protein	NA	I6RSK5	Salmonella_phage	99.7	9.0e-207
WP_001151798.1|2084909_2085089_+	hypothetical protein	NA	I6R9A3	Salmonella_phage	100.0	6.8e-27
WP_000633372.1|2085140_2085542_+	hypothetical protein	NA	I6S619	Salmonella_phage	97.7	7.8e-71
WP_001276816.1|2085713_2086076_+	hypothetical protein	NA	A0A1V0E5P3	Salmonella_phage	92.5	1.6e-62
WP_001144358.1|2086163_2086601_+	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	98.6	3.9e-76
WP_000198519.1|2086597_2086984_+	hypothetical protein	NA	Q5G8X4	Enterobacteria_phage	96.9	1.1e-66
WP_000742046.1|2086999_2087737_+	immunoglobulin domain-containing protein	NA	Q5G8X3	Enterobacteria_phage	98.4	1.0e-129
WP_000644473.1|2087782_2088436_+	hypothetical protein	NA	I6R0Q2	Salmonella_phage	98.2	3.3e-119
WP_000065273.1|2088657_2089386_+	KilA-N domain-containing protein	NA	I6S1R0	Salmonella_phage	98.8	3.4e-141
WP_000262086.1|2089895_2091425_+	DUF4041 domain-containing protein	NA	Q5G8X0	Enterobacteria_phage	98.4	7.9e-164
WP_000827040.1|2091537_2092275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000829989.1|2092337_2095691_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	90.7	0.0e+00
WP_001240563.1|2095718_2095940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001115296.1|2095996_2096344_+|tail	phage tail protein	tail	A0A1V0E5N3	Salmonella_phage	97.4	2.2e-61
WP_001046970.1|2096355_2096616_+	DUF1327 domain-containing protein	NA	A0A1V0E5N5	Salmonella_phage	98.8	3.6e-37
WP_000439677.1|2096620_2096908_-	hypothetical protein	NA	A0A1V0E5N9	Salmonella_phage	100.0	5.6e-47
WP_001204735.1|2097071_2097776_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	100.0	3.8e-137
WP_001156983.1|2097775_2098495_+	C40 family peptidase	NA	A0A1V0E5M9	Salmonella_phage	97.9	3.3e-144
WP_000904513.1|2098437_2098965_+|tail	tail assembly protein	tail	I6RSM0	Salmonella_phage	93.8	6.4e-65
WP_000094330.1|2098974_2102154_+|tail	phage tail protein	tail	A0A1V0E5M1	Salmonella_phage	96.0	0.0e+00
WP_001113925.1|2102162_2103122_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	100.0	9.6e-184
WP_001272648.1|2103132_2104431_+	hypothetical protein	NA	I6R0Q9	Salmonella_phage	99.8	1.1e-246
WP_000394200.1|2104667_2105087_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.8	3.8e-36
WP_000457670.1|2105089_2106358_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	99.1	3.4e-245
WP_000334555.1|2106350_2107022_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.3e-80
>prophage 6
NZ_CP014994	Salmonella enterica subsp. enterica serovar Tennessee strain CFSAN001387 chromosome, complete genome	4834050	4419980	4462749	4834050	tRNA,holin,tail,plate	Burkholderia_phage(40.0%)	45	NA	NA
WP_001182232.1|4419980_4420979_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039336.1|4421066_4422377_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416271.1|4422623_4423139_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001538094.1|4423238_4423448_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001575282.1|4423469_4423583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128115.1|4423579_4424905_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4425083_4425692_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4425800_4426169_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4426339_4428760_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4428858_4429731_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4429744_4430242_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4430422_4431340_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973681.1|4431503_4432862_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4432950_4434060_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4434421_4435612_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382564.1|4435743_4437288_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|4437302_4438193_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982735.1|4438358_4438769_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750800.1|4438911_4441008_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977963.1|4441007_4441745_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_161126850.1|4441741_4442410_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4442443_4442686_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790025.1|4443129_4444779_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4445123_4446473_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4446603_4446951_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226439.1|4447527_4447815_+|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_001270433.1|4447817_4448423_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	2.7e-59
WP_000777266.1|4448435_4448750_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449432.1|4448909_4449365_+	Gp37 family protein	NA	NA	NA	NA	NA
WP_000875314.1|4449361_4449559_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729844.1|4449548_4450976_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	1.4e-194
WP_000907495.1|4450975_4451500_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003637.1|4451551_4451869_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4451828_4451957_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262483.1|4452053_4454408_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.9	1.8e-66
WP_000271425.1|4454407_4455361_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269717.1|4455360_4455570_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_001538099.1|4455557_4456601_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.9	1.5e-76
WP_000679395.1|4456610_4457333_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593184.1|4457659_4458022_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_000703634.1|4458018_4458948_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_001095010.1|4458947_4460495_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4460658_4461018_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951739.1|4461008_4462124_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	51.7	4.1e-101
WP_000359506.1|4462116_4462749_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
>prophage 1
NZ_CP014995	Salmonella enterica subsp. enterica serovar Tennessee strain CFSAN001387 plasmid unnamed, complete sequence	109917	0	96260	109917	terminase,integrase,transposase,tail	Salmonella_phage(94.62%)	100	924:944	85369:85389
WP_000176291.1|593_860_+	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
924:944	attL	ATATATACGGAAGCAGGTTCT	NA	NA	NA	NA
WP_060455557.1|1055_1697_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	99.5	2.3e-109
WP_002211787.1|1699_2956_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_060453931.1|2989_4564_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.4	2.4e-301
WP_045339224.1|4586_5483_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	99.3	4.2e-149
WP_060453932.1|5509_6391_+	hypothetical protein	NA	J9Q710	Salmonella_phage	93.9	4.0e-152
WP_060453934.1|6790_7225_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	98.6	8.1e-74
WP_060453935.1|7224_8058_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.3	4.9e-152
WP_060453936.1|8155_8500_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	99.1	9.4e-57
WP_000523626.1|8490_8964_+	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
WP_057102242.1|8965_9349_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	97.6	9.4e-66
WP_048231971.1|9423_10170_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.4	2.6e-128
WP_000163862.1|10229_10547_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_000952684.1|10672_10897_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_060455558.1|10904_15485_+	tape measure protein	NA	J9Q712	Salmonella_phage	99.3	0.0e+00
WP_045339239.1|15526_15862_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	99.1	5.2e-60
WP_060453984.1|15951_16650_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.6	1.1e-136
WP_060455559.1|16642_17440_+	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	99.2	9.5e-161
WP_016051626.1|17427_18018_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	100.0	2.1e-109
WP_060453959.1|18036_22194_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	99.7	0.0e+00
WP_060455560.1|22281_25836_+|tail	tail fiber domain-containing protein	tail	J9Q6E3	Salmonella_phage	64.7	1.1e-253
WP_022649954.1|25835_26372_+	hypothetical protein	NA	J9Q7Y6	Salmonella_phage	98.9	1.0e-94
WP_022649955.1|26415_26670_+	hypothetical protein	NA	J9Q7R5	Salmonella_phage	95.2	2.4e-41
WP_022649956.1|26669_27278_+	hypothetical protein	NA	J9Q7G0	Salmonella_phage	100.0	1.4e-103
WP_071930363.1|27289_27523_+	membrane lipoprotein lipid attachment site-containing protein	NA	J9Q714	Salmonella_phage	98.7	2.9e-38
WP_016051633.1|27615_27939_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	100.0	1.9e-51
WP_060453938.1|27951_28644_+	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	99.6	1.7e-129
WP_016051635.1|28645_28897_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	100.0	6.6e-36
WP_016051638.1|29245_29668_+	hypothetical protein	NA	J9Q6E9	Salmonella_phage	100.0	5.7e-72
WP_032623541.1|29700_30402_+	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	99.6	5.4e-136
WP_022649960.1|30556_31222_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	99.5	1.4e-117
WP_161496783.1|31227_31581_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.9e-45
WP_060453939.1|31626_32385_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	98.4	8.7e-148
WP_060453940.1|32581_33307_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	99.2	1.7e-140
WP_006812582.1|33367_34708_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	99.8	1.3e-247
WP_060453941.1|34856_35972_+	hypothetical protein	NA	J9Q720	Salmonella_phage	98.9	2.6e-217
WP_060453942.1|36053_36848_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	97.3	2.6e-142
WP_171839471.1|36929_37406_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	98.7	5.8e-81
WP_060453980.1|37440_38763_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	99.3	3.6e-258
WP_004110177.1|38922_39135_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	100.0	2.6e-33
WP_060453981.1|39134_39287_+	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	96.0	9.9e-19
WP_042863561.1|39283_39577_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.8	1.7e-38
WP_060453953.1|40456_43579_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.3	1.6e-25
WP_060453954.1|43699_44920_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_060453955.1|44916_46473_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.1	2.2e-105
WP_060453978.1|47135_47381_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	1.0e-12
WP_164708968.1|47476_48085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048228574.1|48094_48505_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_060455561.1|48678_49785_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	32.6	9.5e-26
WP_000224608.1|49776_50163_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_004110118.1|50427_50640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060455562.1|50749_53116_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	93.4	0.0e+00
WP_060453979.1|53212_54448_+	AAA family ATPase	NA	J9Q733	Salmonella_phage	99.5	1.3e-238
WP_060455563.1|54628_58147_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.1	0.0e+00
WP_162493220.1|58161_58587_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	98.6	2.2e-71
WP_060453948.1|58624_59590_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_060453949.1|59733_60165_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	2.6e-72
WP_060453950.1|60284_61295_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	99.7	6.2e-165
WP_022649902.1|61355_62300_+	hypothetical protein	NA	J9Q7S6	Salmonella_phage	99.7	4.0e-182
WP_060453951.1|62299_62566_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	98.9	8.0e-40
WP_000589750.1|63736_63937_+	hypothetical protein	NA	J9Q6J0	Salmonella_phage	93.9	9.3e-25
WP_004110049.1|63940_64771_+	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	99.3	1.1e-127
WP_060453946.1|64933_65305_+	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	98.4	5.2e-69
WP_032655922.1|65288_65699_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	98.5	4.8e-76
WP_004110038.1|65767_66043_+	hypothetical protein	NA	J9Q738	Salmonella_phage	97.8	4.1e-47
WP_060453945.1|66083_66263_+	hypothetical protein	NA	J9Q6J1	Salmonella_phage	94.9	1.6e-20
WP_060453944.1|66259_66595_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	98.2	1.3e-55
WP_006812558.1|66594_66807_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	98.6	3.1e-34
WP_040110284.1|67375_68440_-	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.0	7.9e-187
WP_022649908.1|69184_69829_+	hypothetical protein	NA	J9Q739	Salmonella_phage	99.1	2.2e-123
WP_060453943.1|69904_70399_+	hypothetical protein	NA	J9Q6J3	Salmonella_phage	97.0	5.6e-87
WP_047055043.1|70575_71661_+	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	99.2	7.0e-207
WP_060455565.1|71890_73807_+	AAA family ATPase	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
WP_060453965.1|73796_74543_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.0	9.9e-136
WP_002214145.1|74555_75125_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
WP_022649913.1|75202_77518_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
WP_002231164.1|77625_78768_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	100.0	1.7e-219
WP_060453971.1|78850_79720_+	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	99.3	2.1e-161
WP_060453970.1|79909_81013_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.6	2.6e-217
WP_164708970.1|81032_81428_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	95.4	3.3e-66
WP_000781812.1|81424_81901_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
WP_060455566.1|81900_82545_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	99.5	1.2e-116
WP_004109992.1|82608_83028_+	hypothetical protein	NA	J9Q743	Salmonella_phage	97.8	6.4e-68
WP_000208226.1|83037_83595_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
WP_060455567.1|83723_84566_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	89.6	3.7e-99
WP_060453975.1|84751_85345_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	99.0	8.7e-111
WP_000262979.1|85547_85778_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
85369:85389	attR	AGAACCTGCTTCCGTATATAT	NA	NA	NA	NA
WP_060453960.1|86718_88401_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_060453961.1|88583_89822_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.1	2.1e-10
WP_071930369.1|90302_90797_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	97.6	7.8e-81
WP_060453962.1|90806_90995_+	hypothetical protein	NA	J9Q800	Salmonella_phage	96.8	2.3e-25
WP_060455569.1|91112_91685_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	97.9	5.9e-96
WP_060455570.1|91826_93512_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	98.8	0.0e+00
WP_060453911.1|93570_94260_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	96.9	5.7e-122
WP_060453912.1|94256_94538_+	hypothetical protein	NA	J9Q801	Salmonella_phage	98.9	1.9e-47
WP_060453913.1|94540_94912_+	hypothetical protein	NA	J9Q7T4	Salmonella_phage	97.6	1.4e-61
WP_060453914.1|94963_95167_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	95.5	2.6e-30
WP_060453915.1|95354_95621_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	71.6	1.8e-31
WP_060453916.1|95706_95943_+	DUF1380 domain-containing protein	NA	J9Q7H8	Salmonella_phage	94.9	3.0e-38
WP_058672029.1|95942_96260_+	hypothetical protein	NA	J9Q750	Salmonella_phage	81.9	3.3e-48
>prophage 2
NZ_CP014995	Salmonella enterica subsp. enterica serovar Tennessee strain CFSAN001387 plasmid unnamed, complete sequence	109917	99560	109605	109917		Salmonella_phage(100.0%)	17	NA	NA
WP_060453920.1|99560_99761_+	hypothetical protein	NA	J9Q7I0	Salmonella_phage	96.2	1.5e-22
WP_016051704.1|100047_100263_+	hypothetical protein	NA	J9Q6K7	Salmonella_phage	100.0	6.3e-35
WP_164708971.1|100276_100492_+	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	2.4e-34
WP_022649933.1|100632_100944_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	97.1	1.6e-47
WP_016051707.1|101071_101467_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	100.0	6.7e-67
WP_060453921.1|101594_101876_+	hypothetical protein	NA	J9Q753	Salmonella_phage	97.8	4.5e-49
WP_048231962.1|102081_102564_+	hypothetical protein	NA	J9Q805	Salmonella_phage	96.2	2.1e-86
WP_016051712.1|103208_103412_-	hypothetical protein	NA	J9Q7I3	Salmonella_phage	100.0	1.3e-29
WP_023316005.1|103462_104113_-	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	7.1e-114
WP_060453922.1|104436_104964_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.6	9.9e-82
WP_048231964.1|104968_105391_-	hypothetical protein	NA	J9Q806	Salmonella_phage	99.3	4.8e-71
WP_016051715.1|105451_105730_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	100.0	6.9e-42
WP_006812522.1|105732_107292_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.6	4.4e-295
WP_060453923.1|107356_108055_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
WP_058687819.1|108054_108723_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	99.1	2.5e-114
WP_016051719.1|108719_109358_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	100.0	3.8e-112
WP_001113021.1|109350_109605_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
