The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014141	Thermus parvatiensis strain RL chromosome, complete genome	1872821	94062	147850	1872821	tRNA,holin,transposase	Streptococcus_phage(27.27%)	42	NA	NA
WP_008630830.1|94062_95187_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_008630830.1|95351_96476_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_082709610.1|98290_99256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060384009.1|99793_100498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038035684.1|100506_101733_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	34.2	2.1e-34
WP_008634076.1|102541_103459_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	29.5	2.0e-13
WP_014628849.1|103455_104034_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.6	1.8e-15
WP_060384010.1|105567_106713_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_008634066.1|106972_107944_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_008634062.1|109008_109599_+	cysteine hydrolase	NA	A0A2K9L6K4	Tupanvirus	35.6	1.2e-16
WP_008634060.1|109591_110149_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011174019.1|110124_110721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008634057.1|110710_111514_+	histidinol-phosphatase	NA	NA	NA	NA	NA
WP_014628840.1|111489_111756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008634053.1|112478_112811_-	DUF190 domain-containing protein	NA	NA	NA	NA	NA
WP_008634050.1|113212_113686_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	41.1	1.4e-23
WP_060384011.1|113672_114077_-	DUF4395 family protein	NA	NA	NA	NA	NA
WP_008634046.1|114165_114933_-	SAM-dependent chlorinase/fluorinase	NA	NA	NA	NA	NA
WP_060384012.1|116419_117112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008634036.1|119986_120382_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_060384013.1|121386_121836_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_060384014.1|121944_122859_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	49.7	7.5e-77
WP_014628830.1|122871_123219_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_060384015.1|123215_123647_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	28.3	1.1e-06
WP_060384016.1|123690_124497_-	universal stress protein	NA	NA	NA	NA	NA
WP_060384017.1|124493_125630_-	MFS transporter	NA	NA	NA	NA	NA
WP_060384018.1|125851_127675_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_060384019.1|127730_129305_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	26.6	8.8e-17
WP_060384020.1|129319_130162_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_060384021.1|130158_131034_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_008634018.1|131084_132374_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_008630619.1|132457_133147_-|transposase	IS5-like element ISTth7 family transposase	transposase	NA	NA	NA	NA
WP_008634012.1|133570_133777_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	63.2	4.8e-16
WP_060384022.1|133833_134589_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.7	1.7e-42
WP_060384023.1|134585_135311_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_060384024.1|138506_139592_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_060384025.1|139602_141012_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_008634005.1|141017_142019_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	36.7	1.2e-48
WP_008634004.1|142015_142648_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_038035673.1|146020_146536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014629763.1|146556_147111_-|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_008630619.1|147160_147850_-|transposase	IS5-like element ISTth7 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP014141	Thermus parvatiensis strain RL chromosome, complete genome	1872821	1050758	1106032	1872821	integrase,transposase	Staphylococcus_phage(33.33%)	37	1030065:1030084	1069267:1069286
1030065:1030084	attL	GGCTTCCCCGGGCGAGGAGG	NA	NA	NA	NA
WP_060384463.1|1050758_1051700_+|integrase	tyrosine-type recombinase/integrase	integrase	W8EHC2	Mycobacterium_phage	30.3	3.1e-09
WP_014510310.1|1051807_1052392_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060384464.1|1052378_1053350_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_060384465.1|1053359_1053875_+	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
WP_060384466.1|1054606_1055062_+	phenylacetate-CoA oxygenase subunit PaaJ	NA	NA	NA	NA	NA
WP_060384467.1|1058334_1059087_+	LamB/YcsF family protein	NA	NA	NA	NA	NA
WP_008632378.1|1061738_1062224_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
WP_156423365.1|1063665_1063833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060384468.1|1064005_1064428_-	thioesterase family protein	NA	NA	NA	NA	NA
WP_060384469.1|1064430_1065765_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_060384835.1|1065721_1066111_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_060384472.1|1068598_1069576_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
1069267:1069286	attR	GGCTTCCCCGGGCGAGGAGG	NA	NA	NA	NA
WP_060384473.1|1070880_1071840_-	3,4-dihydroxyphenylacetate 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_060384474.1|1071827_1072277_-	flavin reductase	NA	NA	NA	NA	NA
WP_060384475.1|1072273_1073725_-	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
WP_060384476.1|1073688_1075284_-	5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_060384477.1|1075280_1076021_-	2-hydroxyhepta-2,4-diene-1,7-dioate isomerase	NA	NA	NA	NA	NA
WP_060384478.1|1076017_1076917_-	2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase	NA	NA	NA	NA	NA
WP_060384479.1|1080453_1081218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060384480.1|1083285_1084128_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	33.3	4.1e-13
WP_060384481.1|1084102_1084954_+	DegV family protein	NA	NA	NA	NA	NA
WP_060384482.1|1085488_1086526_+	fatty acid desaturase	NA	A0A1V0SAL5	Catovirus	28.3	5.0e-29
WP_060384483.1|1086533_1087286_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_008632333.1|1087282_1087678_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_008632330.1|1087674_1087899_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_008632327.1|1088027_1089158_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A068A1P5	Thermus_phage	70.5	8.7e-152
WP_019550163.1|1089150_1089567_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	41.1	2.2e-23
WP_060384484.1|1089729_1091193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008632324.1|1091516_1091720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081481460.1|1092862_1094014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008632315.1|1095382_1096507_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_008632309.1|1096554_1096818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038035326.1|1097065_1098025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060384485.1|1099020_1099932_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	5.6e-24
WP_015716433.1|1103762_1104278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014629763.1|1104298_1104853_-|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_082367395.1|1104907_1106032_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP014141	Thermus parvatiensis strain RL chromosome, complete genome	1872821	1752672	1774840	1872821	integrase	Thermus_virus(90.62%)	34	1752610:1752654	1771796:1771840
1752610:1752654	attL	TGGTGGGCGATGGTGGACTTGAACCACCGACCTCACGCTTATCAG	NA	NA	NA	NA
WP_141607718.1|1752672_1753722_-|integrase	tyrosine-type recombinase/integrase	integrase	Q859R3	Thermus_virus	95.4	1.7e-197
WP_038035068.1|1753887_1754781_-	restriction endonuclease	NA	Q859R2	Thermus_virus	98.0	1.9e-170
WP_081481418.1|1754858_1755572_-	helix-turn-helix domain-containing protein	NA	Q859R0	Thermus_virus	85.6	5.0e-105
WP_008630989.1|1755636_1755840_+	helix-turn-helix domain-containing protein	NA	B3XVT0	Thermus_virus	61.7	4.0e-07
WP_167345971.1|1755836_1756013_+	hypothetical protein	NA	B3XVT1	Thermus_virus	96.6	2.0e-18
WP_008630979.1|1756126_1756351_+	helix-turn-helix domain-containing protein	NA	Q859Q8	Thermus_virus	95.9	1.1e-34
WP_008630977.1|1756347_1756791_+	hypothetical protein	NA	Q859Q7	Thermus_virus	100.0	2.1e-48
WP_008630973.1|1757035_1758262_+	hypothetical protein	NA	Q859U0	Thermus_virus	91.0	1.9e-197
WP_038034990.1|1758251_1758611_+	hypothetical protein	NA	Q859T8	Thermus_virus	76.3	6.1e-43
WP_060384765.1|1758594_1759602_+	phosphoadenosine phosphosulfate reductase family protein	NA	R9TRT5	Rhizobium_phage	32.1	1.0e-34
WP_038034987.1|1759684_1759966_+	hypothetical protein	NA	Q859T6	Thermus_virus	98.9	2.5e-44
WP_008630963.1|1760674_1761076_+	hypothetical protein	NA	Q859T4	Thermus_virus	66.3	5.1e-14
WP_050927489.1|1760987_1761509_+	hypothetical protein	NA	Q859T3	Thermus_virus	92.9	5.0e-70
WP_008630959.1|1761486_1762020_+	N-acetylmuramoyl-L-alanine amidase	NA	C8CHK8	Thermus_virus	82.2	1.4e-75
WP_156423376.1|1762007_1762160_+	hypothetical protein	NA	Q859T1	Thermus_virus	76.6	2.8e-13
WP_008630955.1|1762159_1762348_+	hypothetical protein	NA	B3XVS9	Thermus_virus	88.6	3.7e-15
WP_008630953.1|1762348_1763029_+	AAA family ATPase	NA	Q859T0	Thermus_virus	96.0	1.3e-123
WP_008630952.1|1763163_1763580_+	hypothetical protein	NA	Q859S9	Thermus_virus	94.2	1.4e-67
WP_008630950.1|1763591_1764107_+	hypothetical protein	NA	Q859S8	Thermus_virus	95.3	5.1e-91
WP_008630948.1|1764115_1764991_+	hypothetical protein	NA	Q859S7	Thermus_virus	93.8	1.4e-144
WP_050927501.1|1765068_1765398_+	hypothetical protein	NA	Q859S6	Thermus_virus	63.4	4.6e-13
WP_038035056.1|1765400_1765655_+	hypothetical protein	NA	Q859S5	Thermus_virus	97.0	8.3e-10
WP_038035053.1|1765651_1766302_+	hypothetical protein	NA	Q859S4	Thermus_virus	90.8	2.7e-81
WP_008630941.1|1766301_1766526_+	hypothetical protein	NA	Q859S3	Thermus_virus	100.0	2.2e-27
WP_038034985.1|1766515_1766818_+	hypothetical protein	NA	Q859S2	Thermus_virus	91.0	5.5e-37
WP_038035049.1|1767056_1767485_+	hypothetical protein	NA	C8CHM2	Thermus_virus	63.4	4.6e-37
WP_008630936.1|1767774_1768227_+	hypothetical protein	NA	Q859S0	Thermus_virus	98.7	2.8e-77
WP_038035048.1|1768373_1769396_+	hypothetical protein	NA	C8CHM6	Thermus_virus	79.9	2.5e-105
WP_008630934.1|1769405_1770512_+	hypothetical protein	NA	C8CHM7	Thermus_virus	45.2	1.1e-74
WP_038035044.1|1770959_1771460_+	transglycosylase SLT domain-containing protein	NA	Q859R5	Thermus_virus	93.3	1.4e-85
WP_008630931.1|1771456_1771729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060384768.1|1771913_1772801_-	acyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	32.1	2.5e-05
1771796:1771840	attR	TGGTGGGCGATGGTGGACTTGAACCACCGACCTCACGCTTATCAG	NA	NA	NA	NA
WP_008630929.1|1772845_1773751_-	GTPase Era	NA	NA	NA	NA	NA
WP_060384769.1|1773835_1774840_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	33.6	9.2e-20
>prophage 1
NZ_CP014142	Thermus parvatiensis strain RL plasmid pTP143, complete sequence	143277	28134	68416	143277	transposase	uncultured_virus(33.33%)	26	NA	NA
WP_008630830.1|28134_29259_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_008633641.1|29313_30342_-	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_008633626.1|32837_33344_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_008633618.1|34803_35400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060384860.1|35421_35847_+	osmotic signal transduction-like protein	NA	NA	NA	NA	NA
WP_008633616.1|35945_37124_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_060384861.1|37104_39822_+	SMC family ATPase	NA	G3MAB6	Bacillus_virus	23.5	1.2e-08
WP_060384862.1|39829_40108_-	hypothetical protein	NA	A0MN33	Thermus_phage	30.7	5.1e-05
WP_015717156.1|41521_41830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008633608.1|45326_45635_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_060384863.1|45627_45822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167345978.1|46742_46919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008633604.1|46890_47367_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_060384864.1|48714_49149_-	ParA family protein	NA	NA	NA	NA	NA
WP_008633600.1|49206_49662_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_008633599.1|49642_49885_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_008630830.1|49994_51119_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_167345979.1|51225_52539_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.4	2.0e-22
WP_060384865.1|52829_53783_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	33.6	5.0e-07
WP_060384866.1|53813_55034_+|transposase	IS256-like element ISTth4 family transposase	transposase	A0A218MNI5	uncultured_virus	35.4	2.4e-22
WP_060384868.1|55728_56142_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_008631365.1|56138_56354_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_008633013.1|56444_56633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060384869.1|56717_57527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038035114.1|59156_59774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060384865.1|67462_68416_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	33.6	5.0e-07
