The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014225	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4659625	304424	313095	4659625		Escherichia_phage(28.57%)	8	NA	NA
WP_000272486.1|304424_305528_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
WP_001393538.1|305535_306783_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100981.1|306779_307337_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_000783975.1|307336_308218_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001023610.1|308275_309175_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000699460.1|309174_310260_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_000183060.1|310632_311526_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116026.1|311700_313095_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 2
NZ_CP014225	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4659625	662500	673710	4659625	integrase,tail	Enterobacteria_phage(50.0%)	17	660475:660491	677385:677401
660475:660491	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|662500_663433_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|663744_664902_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|665054_665417_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|665413_666334_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|666330_667662_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|667696_667978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|668276_668717_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|668743_669262_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|669311_669587_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|669586_670081_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|670077_670446_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|670803_671166_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|671231_672056_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|672183_672720_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|672710_673073_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|673072_673378_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|673509_673710_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
677385:677401	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 3
NZ_CP014225	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4659625	1054292	1061431	4659625		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|1054292_1056854_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|1056959_1057616_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272547.1|1057666_1058464_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_000848004.1|1058629_1059538_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|1059534_1060701_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|1060792_1061431_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 4
NZ_CP014225	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4659625	3086377	3135837	4659625	transposase,integrase	Streptococcus_phage(20.0%)	48	3101639:3101698	3135947:3136006
WP_000006255.1|3086377_3086875_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|3087098_3088838_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|3088782_3089568_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|3089638_3090694_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|3090745_3091039_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|3091041_3091440_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|3091449_3091902_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|3092207_3092474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|3092406_3092943_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|3092999_3094457_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|3094717_3095176_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|3095267_3096512_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000749863.1|3097785_3098841_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|3099128_3100232_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|3100243_3101497_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3101639:3101698	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|3102068_3102410_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|3102430_3102748_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|3102766_3102988_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|3102996_3103473_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|3103488_3103947_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|3104044_3104284_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|3104360_3104828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|3104850_3105294_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|3105293_3105521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|3105924_3106746_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|3106837_3107701_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|3108029_3108923_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|3109343_3110495_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|3112841_3113858_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|3114065_3115469_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|3115455_3116388_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|3116496_3117543_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|3118764_3119103_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|3119125_3119476_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|3119569_3120724_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|3121018_3121927_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|3121941_3123909_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|3124135_3125518_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|3125529_3127140_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|3127144_3127903_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|3128041_3129046_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|3130240_3130972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|3131062_3131689_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|3131960_3132659_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|3132685_3133540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|3133658_3133883_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|3133879_3134320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|3134436_3135837_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
3135947:3136006	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 5
NZ_CP014225	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4659625	3357879	3420838	4659625	tRNA,lysis,terminase,protease,integrase,transposase	Enterobacteria_phage(50.0%)	66	3403496:3403542	3424798:3424844
WP_001295836.1|3357879_3358503_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|3358473_3359160_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|3359156_3361571_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|3362001_3366282_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|3366321_3366690_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|3367380_3367641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|3368872_3369967_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|3370035_3370962_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|3371191_3371674_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|3371751_3372567_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|3372656_3374438_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|3374450_3375227_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|3375326_3376205_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|3376373_3377828_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|3377887_3379249_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|3379305_3380607_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|3380628_3381774_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|3382001_3382787_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|3382797_3384033_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|3384054_3385104_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|3385420_3387088_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|3387097_3388357_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|3388367_3389183_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|3389179_3390073_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|3390267_3391335_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|3391331_3391841_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|3391958_3392681_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|3392683_3393178_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|3393351_3394737_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|3394772_3395294_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|3395401_3395614_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|3395615_3396482_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|3396952_3397495_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|3397714_3398407_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|3398437_3401041_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|3401019_3402060_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|3402070_3402586_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|3402588_3403221_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
3403496:3403542	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|3403555_3404719_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|3404838_3405102_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|3405424_3405520_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000169527.1|3405582_3405882_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|3405878_3406745_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001070439.1|3407055_3407388_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|3407435_3407585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|3407642_3409169_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|3409633_3410185_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|3410194_3410992_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|3411108_3411210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|3411206_3411662_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|3411661_3411832_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|3411824_3412115_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|3412111_3412474_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|3412470_3412611_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|3412696_3413080_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|3413477_3414494_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|3414498_3415566_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|3416138_3416354_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|3416353_3416851_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|3417067_3417250_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|3417340_3417634_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|3417924_3418335_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|3418620_3418827_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|3418991_3419186_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|3419574_3420120_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|3420094_3420838_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
3424798:3424844	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 6
NZ_CP014225	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4659625	4031590	4052983	4659625	tRNA,plate,portal,integrase,tail	Shigella_phage(31.58%)	31	4023585:4023599	4059686:4059700
4023585:4023599	attL	CTTCAGCGTGGTTGT	NA	NA	NA	NA
WP_001297484.1|4031590_4032697_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|4032750_4033212_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|4033221_4033875_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444484.1|4034046_4035297_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_000241967.1|4035790_4036456_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010723094.1|4036456_4037161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257372.1|4037618_4038512_+	cell death peptidase Lit	NA	NA	NA	NA	NA
WP_000741310.1|4038602_4039730_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
WP_000939945.1|4039710_4039956_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_011443584.1|4039992_4040304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723095.1|4040420_4040762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005353.1|4040699_4041008_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_000848748.1|4041182_4041857_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|4041947_4042148_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515837.1|4042191_4042749_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_001250269.1|4042924_4043104_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104929.1|4043093_4044461_+	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_000605606.1|4044472_4044655_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001350502.1|4044654_4045128_+|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_001350503.1|4045054_4045846_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_000383574.1|4045836_4046421_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_000554707.1|4046424_4047213_+|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.7e-51
WP_000548498.1|4047212_4047815_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_010723096.1|4047786_4048200_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000905001.1|4048608_4049163_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_000557907.1|4049269_4050103_+	5-methylcytosine-specific endonuclease McrA	NA	NA	NA	NA	NA
WP_000943927.1|4050336_4050501_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_001295666.1|4050603_4050927_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|4051463_4051574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|4051626_4052031_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|4052251_4052983_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
4059686:4059700	attR	ACAACCACGCTGAAG	NA	NA	NA	NA
>prophage 7
NZ_CP014225	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4659625	4234999	4275817	4659625	tRNA,lysis,integrase,tail,transposase	Escherichia_phage(45.16%)	43	4236146:4236164	4266521:4266539
WP_010723085.1|4234999_4236016_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
4236146:4236164	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000605090.1|4236288_4236546_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|4236595_4237546_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|4237697_4238450_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945011.1|4238644_4239160_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|4239170_4240697_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156451.1|4240733_4242179_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444929.1|4242178_4243489_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885458.1|4243664_4244573_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|4244902_4245466_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|4245486_4246719_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|4246973_4247957_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|4248434_4249808_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|4249936_4250872_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|4250923_4252159_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|4252160_4252376_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|4252454_4252664_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|4252656_4252851_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|4252907_4253717_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|4253709_4256310_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|4256411_4256687_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|4256761_4256932_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|4256931_4257153_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|4257594_4258083_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|4258079_4258235_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|4258688_4259165_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|4259288_4259585_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|4259607_4260030_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|4260042_4260900_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|4260906_4261653_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|4261675_4262236_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|4262323_4262509_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|4262705_4264163_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|4264300_4264564_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|4264544_4264904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|4266669_4267650_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
4266521:4266539	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_000279097.1|4267972_4271335_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|4271334_4271910_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|4272007_4272598_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|4272914_4273148_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|4273216_4273330_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|4274108_4274543_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|4274683_4275817_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 8
NZ_CP014225	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4659625	4468376	4487587	4659625	lysis,tail	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|4468376_4469837_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|4469925_4471209_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|4471813_4471927_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|4471995_4472229_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|4472545_4473136_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|4473233_4473809_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|4473808_4474771_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|4474721_4475291_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|4475679_4475913_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|4475970_4476381_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|4476532_4476706_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|4476877_4477033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|4477111_4477177_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|4477179_4477368_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|4477378_4477591_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|4477953_4478451_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|4478447_4478981_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|4478977_4479289_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|4479293_4479509_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|4480262_4480478_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|4480778_4480991_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|4481045_4481135_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|4481412_4482165_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001393597.1|4482178_4483228_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	5.7e-113
WP_012304870.1|4483229_4483508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|4483574_4483826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|4484042_4484198_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|4484269_4484557_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|4484556_4484796_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|4484820_4485126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|4485328_4485661_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|4486097_4486247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|4486543_4486774_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|4486857_4487265_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|4487431_4487587_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
