The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010337	Mycobacterium tuberculosis strain 22115 chromosome, complete genome	4401829	2949037	2987302	4401829	capsid,protease,terminase,head,integrase,tRNA	Mycobacterium_phage(30.0%)	46	2977831:2977858	2987455:2987482
WP_003413486.1|2949037_2951116_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2951224_2951452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413569.1|2953175_2953676_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2953692_2954133_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2954279_2954957_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2954941_2955295_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2955307_2955733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2955729_2956404_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2956481_2957303_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2957438_2958332_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2958334_2959153_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2959167_2960349_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2960407_2960839_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2961352_2962594_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2962903_2963266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2963612_2964737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2964738_2965278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2965417_2966716_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2966754_2967036_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2967180_2967666_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2967692_2967950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899405.1|2970311_2970554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2970554_2971232_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2971427_2972084_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2972246_2972693_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2972867_2973200_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2973319_2973679_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2973780_2974239_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2974374_2974755_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2974751_2976248_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2976482_2976674_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2976746_2976920_+	hypothetical protein	NA	NA	NA	NA	NA
2977831:2977858	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2977964_2978396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2978392_2979391_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2979404_2979869_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003908028.1|2979856_2980108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899411.1|2980278_2981718_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2981725_2982259_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2982411_2983038_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899414.1|2983069_2983393_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2983472_2983718_-	type II toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
WP_031664026.1|2983714_2985142_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2985143_2985536_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2985532_2985793_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2985809_2986172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2986174_2987302_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2987455:2987482	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
