The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010339	Mycobacterium tuberculosis strain 22103 chromosome, complete genome	4399422	2940724	2978993	4399422	terminase,tRNA,head,capsid,integrase,protease	Mycobacterium_phage(33.33%)	44	2969522:2969549	2979146:2979173
WP_003413486.1|2940724_2942803_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2942911_2943139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413569.1|2944864_2945365_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945381_2945822_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003902320.1|2945917_2946646_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2946630_2946984_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2946996_2947422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2947418_2948093_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948170_2948992_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949127_2950021_+	universal stress protein TB31.7	NA	NA	NA	NA	NA
WP_003413594.1|2950023_2950842_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2950856_2952038_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952096_2952528_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_031582886.1|2953041_2954283_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_085976157.1|2954697_2954955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955301_2956426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956427_2956967_+	archease	NA	NA	NA	NA	NA
WP_003413619.1|2958443_2958725_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2958869_2959355_-	non-heme di-iron catalase	NA	NA	NA	NA	NA
WP_003908019.1|2959381_2959636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899405.1|2962002_2962245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962245_2962923_+	chloramphenicol phosphotransferase CPT family protein	NA	NA	NA	NA	NA
WP_003413654.1|2963118_2963775_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2963937_2964384_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964558_2964891_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965010_2965370_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965471_2965930_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966065_2966446_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966442_2967939_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2968173_2968365_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
2969522:2969549	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2969655_2970087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034163937.1|2970083_2971082_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.2	3.1e-60
WP_003900539.1|2971095_2971560_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003908028.1|2971547_2971799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899411.1|2971969_2973409_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2973416_2973950_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003900541.1|2974102_2974594_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	9.4e-18
WP_003899414.1|2974760_2975084_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2975163_2975409_-	type II toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2975405_2976833_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2976834_2977227_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2977223_2977484_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2977500_2977863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2977865_2978993_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2979146:2979173	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
