The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014250	Listeria monocytogenes strain CFSAN010068, complete genome	2987563	72076	111653	2987563	tail,terminase,holin,integrase	Listeria_phage(92.0%)	58	64442:64458	100923:100939
64442:64458	attL	AAGCAAAAGAAAGCATT	NA	NA	NA	NA
WP_009928363.1|72076_73033_+	2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	29.6	1.2e-29
WP_031670104.1|73299_74502_-|integrase	site-specific integrase	integrase	A0A0B5CTW8	Listeria_phage	96.0	1.5e-218
WP_031670105.1|74570_75005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031670100.1|75059_75227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031670101.1|75382_75859_-	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	60.6	2.2e-40
WP_009924231.1|76027_76231_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003733687.1|76263_76458_+	hypothetical protein	NA	A0A059T6E5	Listeria_phage	95.3	1.4e-25
WP_031670099.1|76416_76776_-	DUF2513 domain-containing protein	NA	A0A2H4J4K9	uncultured_Caudovirales_phage	25.4	6.0e-06
WP_031670098.1|76839_77613_+	Rha family transcriptional regulator	NA	R9QMT9	Lactococcus_phage	40.3	1.5e-38
WP_031670097.1|77734_78259_+	hypothetical protein	NA	A8ATY1	Listeria_phage	97.1	1.0e-86
WP_060868971.1|78265_78451_+	helix-turn-helix domain-containing protein	NA	A0A059T674	Listeria_phage	98.4	5.4e-27
WP_031670096.1|78466_78655_+	hypothetical protein	NA	A0A059T7X9	Listeria_phage	96.8	3.2e-27
WP_060868972.1|78884_79079_+	hypothetical protein	NA	A8ASN1	Listeria_phage	98.4	1.6e-29
WP_060868973.1|79075_79552_+	siphovirus Gp157 family protein	NA	A0A059T5F1	Listeria_phage	50.3	1.3e-35
WP_060868974.1|79562_80207_+	ERF family protein	NA	S5MBS0	Brevibacillus_phage	47.6	1.4e-40
WP_060868975.1|80218_81133_+	DnaD domain-containing protein	NA	A0A0B5D175	Listeria_phage	89.5	5.2e-139
WP_060868976.1|81129_81843_+	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	97.5	1.7e-129
WP_060868977.1|81853_82798_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	98.4	1.7e-177
WP_031643750.1|82810_83491_+	hypothetical protein	NA	A8ATD7	Listeria_phage	96.9	4.8e-121
WP_031643752.1|83487_84045_+	DUF1642 domain-containing protein	NA	A8ATD8	Listeria_phage	58.2	6.4e-55
WP_031643753.1|84206_84413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031643755.1|84399_84816_+	hypothetical protein	NA	A8ASP1	Listeria_phage	37.2	1.4e-14
WP_031643756.1|84812_84995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060868978.1|84991_85393_+	hypothetical protein	NA	A0A059T6C9	Listeria_phage	65.4	7.6e-42
WP_060868979.1|85389_85638_+	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	85.3	3.5e-29
WP_060868980.1|85634_86114_+	single-stranded DNA-binding protein	NA	A0A059T5E0	Listeria_phage	90.6	2.8e-75
WP_003722551.1|86132_86324_+	hypothetical protein	NA	A8ASP6	Listeria_phage	98.4	1.8e-25
WP_060868981.1|86268_86673_+	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	81.3	2.3e-54
WP_060577781.1|86676_87063_+	DUF2481 domain-containing protein	NA	A0A0B5CU14	Listeria_phage	67.7	3.0e-43
WP_060868982.1|87228_87666_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	92.3	1.0e-68
WP_003723794.1|87692_88295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031670269.1|88482_89115_+	hypothetical protein	NA	A8AU05	Listeria_phage	99.0	4.0e-114
WP_012951944.1|89195_89423_+	hypothetical protein	NA	A8AU06	Listeria_phage	100.0	1.5e-34
WP_031670271.1|89462_90203_+	hypothetical protein	NA	A0A0B5CTX0	Listeria_phage	99.2	9.2e-134
WP_031670272.1|90195_91515_+|terminase	PBSX family phage terminase large subunit	terminase	A8ATU6	Listeria_phage	98.9	4.1e-262
WP_031670273.1|91529_93086_+	hypothetical protein	NA	A8ATU7	Listeria_phage	98.3	1.5e-298
WP_031670275.1|93090_94134_+	hypothetical protein	NA	A0A0B5D111	Listeria_phage	98.0	9.7e-198
WP_031670277.1|94229_94784_+	hypothetical protein	NA	A8ATU9	Listeria_phage	89.1	2.2e-84
WP_003723787.1|94806_95679_+	hypothetical protein	NA	A0A0B5CTX8	Listeria_phage	93.8	2.3e-152
WP_003723785.1|95848_96202_+	hypothetical protein	NA	A8ATV2	Listeria_phage	99.1	8.4e-61
WP_003731720.1|96201_96567_+	hypothetical protein	NA	A8ATV3	Listeria_phage	95.0	1.6e-62
WP_003723784.1|96556_96874_+	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	95.2	1.7e-49
WP_003723783.1|96870_97275_+	hypothetical protein	NA	A8ATV5	Listeria_phage	98.4	2.1e-63
WP_003723782.1|97246_97678_+	Ig domain-containing protein	NA	A0A0B5CYK8	Listeria_phage	82.9	8.1e-58
WP_031670280.1|97700_97940_+	hypothetical protein	NA	A8ASK3	Listeria_phage	89.9	1.8e-30
WP_003731721.1|97988_98420_+	hypothetical protein	NA	A8ATV7	Listeria_phage	95.1	5.4e-70
WP_075356981.1|98416_98728_+	hypothetical protein	NA	A0A0B5D116	Listeria_phage	93.4	1.9e-40
WP_060868983.1|98732_103529_+|tail	phage tail tape measure protein	tail	A0A0B5CTS6	Listeria_phage	87.4	0.0e+00
100923:100939	attR	AAGCAAAAGAAAGCATT	NA	NA	NA	NA
WP_003731724.1|103525_105094_+	hypothetical protein	NA	A8ATW0	Listeria_phage	99.6	4.7e-305
WP_060868984.1|105106_107269_+	hypothetical protein	NA	A8ATW1	Listeria_phage	97.1	0.0e+00
WP_031670289.1|107320_107626_+	hypothetical protein	NA	A0A059T5E6	Listeria_phage	93.1	1.1e-40
WP_031670291.1|107625_107889_+|holin	phage holin	holin	A0A059T684	Listeria_phage	84.9	1.5e-35
WP_031670293.1|107885_108119_+	hypothetical protein	NA	R4IBI3	Listeria_phage	85.7	2.7e-31
WP_075356982.1|108120_108894_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	R4ICC5	Listeria_phage	89.5	3.9e-87
WP_100066223.1|109346_109943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031670297.1|110459_110951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031670299.1|111216_111450_+	hypothetical protein	NA	R4IDW6	Listeria_phage	97.4	2.8e-36
WP_031670301.1|111446_111653_+	hypothetical protein	NA	A0A059T5E7	Listeria_phage	98.5	1.2e-30
>prophage 2
NZ_CP014250	Listeria monocytogenes strain CFSAN010068, complete genome	2987563	149541	156068	2987563	tail	Listeria_phage(33.33%)	10	NA	NA
WP_003728215.1|149541_149994_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
WP_003721740.1|149999_150335_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_009927883.1|150551_150980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731177.1|150991_151408_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	37.9	6.5e-20
WP_003728212.1|151687_152077_+	DUF5072 domain-containing protein	NA	NA	NA	NA	NA
WP_003721744.1|152089_152602_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003721745.1|152649_152952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003740367.1|152993_153398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009928420.1|153384_155253_+	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	4.5e-20
WP_003734720.1|155249_156068_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
>prophage 3
NZ_CP014250	Listeria monocytogenes strain CFSAN010068, complete genome	2987563	1152369	1159792	2987563		Hokovirus(33.33%)	8	NA	NA
WP_003730941.1|1152369_1152753_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_003727002.1|1152774_1153758_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.8	2.0e-11
WP_023550414.1|1153772_1154786_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.2	1.8e-10
WP_003721509.1|1154994_1156485_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_023550416.1|1156496_1157321_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.2	1.3e-67
WP_009929872.1|1157333_1157642_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_009929871.1|1157702_1158107_+	PTS lactose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_023550418.1|1158235_1159792_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.2	6.0e-18
>prophage 4
NZ_CP014250	Listeria monocytogenes strain CFSAN010068, complete genome	2987563	1255757	1357504	2987563	terminase,capsid,tail,tRNA,protease,holin,portal,integrase	Listeria_phage(76.56%)	110	1324814:1324834	1326474:1326494
WP_003721619.1|1255757_1256810_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.9	1.3e-29
WP_009927922.1|1256809_1259218_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003721621.1|1259378_1260080_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	3.0e-33
WP_023550449.1|1260093_1263504_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003724750.1|1263601_1264054_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003724751.1|1264069_1267270_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_060869009.1|1267373_1268048_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	47.3	8.3e-49
WP_012681263.1|1268085_1269012_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_003740576.1|1269165_1269429_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_003726937.1|1269428_1269971_+	CvpA family protein	NA	NA	NA	NA	NA
WP_023550452.1|1270062_1271775_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.5	1.9e-17
WP_003734676.1|1271797_1274155_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	50.4	1.0e-21
WP_003723853.1|1274235_1274547_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	39.6	5.4e-19
WP_003726544.1|1274622_1276434_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_060869010.1|1276614_1277829_+	aspartate kinase	NA	NA	NA	NA	NA
WP_012681265.1|1277884_1278379_-	YslB family protein	NA	NA	NA	NA	NA
WP_003723856.1|1278526_1279327_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003730987.1|1279339_1280086_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_009928777.1|1280088_1280700_+	XTP/dITP diphosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	28.0	8.7e-05
WP_003726034.1|1280736_1281261_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_014930113.1|1281547_1282702_-|integrase	site-specific integrase	integrase	A8ATC7	Listeria_phage	94.8	2.0e-207
WP_060869011.1|1282835_1283450_-	hypothetical protein	NA	A0A059T7Z1	Listeria_phage	94.1	7.2e-100
WP_060869012.1|1283499_1283952_-	ImmA/IrrE family metallo-endopeptidase	NA	R4IBK9	Listeria_phage	90.0	2.5e-78
WP_014930118.1|1283972_1284296_-	helix-turn-helix transcriptional regulator	NA	Q8W5Y0	Listeria_phage	66.4	8.8e-33
WP_009931099.1|1285100_1285424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060869013.1|1285438_1285642_+	helix-turn-helix transcriptional regulator	NA	A0A059T5F8	Listeria_phage	98.5	1.6e-27
WP_015987310.1|1285643_1285886_+	hypothetical protein	NA	A8ATD2	Listeria_phage	100.0	1.4e-43
WP_009929539.1|1285888_1286074_+	hypothetical protein	NA	A0A059T7Z3	Listeria_phage	96.7	1.7e-28
WP_060868976.1|1287295_1288009_+	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	97.5	1.7e-129
WP_060868977.1|1288019_1288964_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	98.4	1.7e-177
WP_031643750.1|1288976_1289657_+	hypothetical protein	NA	A8ATD7	Listeria_phage	96.9	4.8e-121
WP_031643752.1|1289653_1290211_+	DUF1642 domain-containing protein	NA	A8ATD8	Listeria_phage	58.2	6.4e-55
WP_060869014.1|1290369_1290744_+	hypothetical protein	NA	A8ATD9	Listeria_phage	89.6	2.0e-57
WP_014601509.1|1290740_1290950_+	hypothetical protein	NA	A8ATE0	Listeria_phage	100.0	1.7e-32
WP_003731704.1|1290950_1291280_+	hypothetical protein	NA	A8ATE1	Listeria_phage	100.0	1.1e-57
WP_003731705.1|1291276_1291549_+	hypothetical protein	NA	A8ATE2	Listeria_phage	100.0	2.0e-46
WP_003731672.1|1292003_1292237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731671.1|1292233_1292464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731670.1|1292453_1292720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014929534.1|1293223_1293607_+	hypothetical protein	NA	A0A059T6A2	Listeria_phage	99.2	5.5e-66
WP_009928021.1|1293608_1294088_+	siphovirus Gp157 family protein	NA	A0A059T803	Listeria_phage	77.2	2.6e-57
WP_031658794.1|1294106_1294799_+	AAA family ATPase	NA	A8ATF0	Listeria_phage	94.3	4.1e-120
WP_031641708.1|1294862_1296119_+	DEAD/DEAH box helicase	NA	Q8W5V9	Listeria_phage	96.4	1.6e-234
WP_009928019.1|1296143_1296629_+	DUF669 domain-containing protein	NA	A0A059T5G4	Listeria_phage	100.0	2.9e-88
WP_011702028.1|1296651_1298994_+	DNA primase	NA	A0A059T6A4	Listeria_phage	43.2	1.3e-146
WP_026747297.1|1299290_1299611_+	VRR-NUC domain-containing protein	NA	A0A059T805	Listeria_phage	100.0	4.0e-54
WP_060869015.1|1299607_1299877_+	hypothetical protein	NA	W0GBM0	Listeria_phage	90.6	3.2e-20
WP_060869055.1|1299987_1300518_+	DUF3310 domain-containing protein	NA	A0A059T7T5	Listeria_phage	77.1	2.6e-74
WP_003731655.1|1300517_1300745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003747284.1|1300757_1301183_+	DUF722 domain-containing protein	NA	Q8W5V4	Listeria_phage	92.2	5.0e-68
WP_003731653.1|1301540_1301723_+	hypothetical protein	NA	A8ATF7	Listeria_phage	96.7	2.8e-28
WP_003731652.1|1301766_1302081_+	HNH endonuclease	NA	A8ATF8	Listeria_phage	98.1	3.2e-56
WP_031668694.1|1302129_1302486_+	hypothetical protein	NA	A0A059T7Y1	Listeria_phage	96.0	1.0e-45
WP_060869016.1|1302482_1304126_+|terminase	terminase large subunit	terminase	A8AT95	Listeria_phage	97.8	0.0e+00
WP_023548926.1|1304137_1305268_+|portal	phage portal protein	portal	A8AT96	Listeria_phage	93.1	1.7e-203
WP_023548924.1|1305264_1306062_+|protease	Clp protease ClpP	protease	A0A059T5F2	Listeria_phage	95.1	1.2e-136
WP_009917704.1|1306088_1307240_+|capsid	phage major capsid protein	capsid	A8AT98	Listeria_phage	93.2	7.2e-202
WP_003731645.1|1307426_1307726_+	hypothetical protein	NA	A8ATA0	Listeria_phage	100.0	5.3e-48
WP_003731644.1|1307709_1308075_+	hypothetical protein	NA	A8ATA1	Listeria_phage	100.0	1.3e-64
WP_003731643.1|1308071_1308473_+	hypothetical protein	NA	A8ATA2	Listeria_phage	100.0	2.1e-68
WP_012581456.1|1308469_1308853_+	hypothetical protein	NA	A8ATA3	Listeria_phage	100.0	3.8e-67
WP_023548920.1|1308874_1309462_+|tail	phage tail protein	tail	A8ATA4	Listeria_phage	99.5	1.5e-107
WP_023548918.1|1309533_1309866_+	hypothetical protein	NA	A8ATA5	Listeria_phage	97.3	4.3e-51
WP_060869017.1|1310080_1315000_+|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	93.0	0.0e+00
WP_060869018.1|1314992_1316642_+|tail	phage tail protein	tail	A0A059T682	Listeria_phage	99.3	0.0e+00
WP_060869019.1|1316657_1318952_+	hypothetical protein	NA	A0A059T7Y6	Listeria_phage	95.3	0.0e+00
WP_060869020.1|1318941_1320033_+	hypothetical protein	NA	A0A059T7R4	Listeria_phage	84.6	6.4e-176
WP_060869021.1|1320085_1320394_+	hypothetical protein	NA	A0A059T5E6	Listeria_phage	87.9	5.1e-38
WP_060869022.1|1320393_1320660_+|holin	phage holin	holin	A0A059T684	Listeria_phage	96.6	8.0e-40
WP_060869023.1|1320659_1321367_+	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	94.5	2.6e-125
WP_060869024.1|1321523_1322426_+	ATP-binding protein	NA	J7KDG8	Streptococcus_phage	33.1	2.0e-37
WP_031667948.1|1322419_1322719_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_003723291.1|1322793_1323243_-	anti-CRISPR protein AcrIIA1	NA	Q9T196	Listeria_phage	94.6	1.3e-71
WP_003723290.1|1323247_1323511_-	anti-CRISPR protein AcrIIA4	NA	A0A2D0TCG7	unidentified_phage	100.0	1.9e-41
WP_031646278.1|1323848_1324058_-	hypothetical protein	NA	R4IBK5	Listeria_phage	92.8	7.5e-25
WP_009933528.1|1324431_1324623_+	hypothetical protein	NA	R4IBI5	Listeria_phage	88.9	8.9e-25
1324814:1324834	attL	ATGTTTTAGAGATTTTTTTAT	NA	NA	NA	NA
WP_075356968.1|1324851_1324953_-|integrase	integrase	integrase	A0A059T688	Listeria_phage	63.6	7.0e-05
WP_003726037.1|1325349_1325823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009928186.1|1325928_1326291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031645846.1|1329467_1331531_+	LapB repeat-containing protein	NA	NA	NA	NA	NA
1326474:1326494	attR	ATGTTTTAGAGATTTTTTTAT	NA	NA	NA	NA
WP_003726042.1|1331653_1333012_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
WP_003726043.1|1333054_1333648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726044.1|1333784_1334192_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_003726045.1|1334356_1334956_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	41.0	1.3e-29
WP_009928848.1|1334987_1335248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023550481.1|1335371_1336784_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	4.9e-51
WP_003726048.1|1336808_1337072_+	DUF3116 domain-containing protein	NA	NA	NA	NA	NA
WP_003727535.1|1337239_1337716_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003726050.1|1337753_1337999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726051.1|1337995_1339201_-	MFS transporter	NA	NA	NA	NA	NA
WP_003726058.1|1339221_1339407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726052.1|1339405_1340065_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003726053.1|1340104_1340299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726054.1|1340365_1341214_-	YitT family protein	NA	NA	NA	NA	NA
WP_003726055.1|1341831_1342545_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_014929571.1|1342575_1344222_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_003727531.1|1344240_1345725_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_003726723.1|1345842_1346304_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003726717.1|1346342_1346807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726718.1|1346995_1347910_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023550483.1|1347935_1349183_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.8	7.2e-107
WP_003726720.1|1349166_1349997_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	3.6e-46
WP_003734523.1|1350143_1351283_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|1351362_1351758_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1351908_1352124_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003727523.1|1352247_1352781_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003731300.1|1352796_1353462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003727521.1|1353723_1354662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1354776_1356060_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1356244_1357504_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
>prophage 5
NZ_CP014250	Listeria monocytogenes strain CFSAN010068, complete genome	2987563	1898073	1906359	2987563		Synechococcus_phage(33.33%)	8	NA	NA
WP_003726209.1|1898073_1898640_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	8.3e-26
WP_003726210.1|1898636_1899686_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	3.2e-63
WP_003722245.1|1899704_1901132_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_009918191.1|1901116_1903336_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.8	6.5e-159
WP_060869034.1|1903328_1904012_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|1904015_1904261_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003726214.1|1904272_1904986_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	2.0e-40
WP_003729814.1|1905066_1906359_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 6
NZ_CP014250	Listeria monocytogenes strain CFSAN010068, complete genome	2987563	2578230	2586072	2987563		Streptococcus_phage(50.0%)	7	NA	NA
WP_003725407.1|2578230_2579202_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003731212.1|2579209_2580178_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.6	1.8e-68
WP_003722606.1|2580179_2581055_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_009927825.1|2581162_2582893_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.1	2.1e-173
WP_009918600.1|2582934_2583996_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_009918601.1|2584012_2584996_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	3.1e-52
WP_003722610.1|2585112_2586072_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 1
NZ_CP014251	Listeria monocytogenes strain CFSAN010068 plasmid pCFSAN010068_01, complete sequence	55521	0	28014	55521	transposase	Streptococcus_phage(46.67%)	21	NA	NA
WP_031645742.1|704_1049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011011045.1|1206_1887_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	69.5	5.5e-93
WP_031670319.1|2191_6844_-	DEAD/DEAH box helicase	NA	A0A2H4UTW8	Bodo_saltans_virus	28.3	1.6e-50
WP_031670320.1|7386_8547_-	replication initiation protein	NA	A0A1V0E006	Clostridioides_phage	25.2	2.3e-06
WP_011011045.1|8804_9485_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	69.5	5.5e-93
WP_031645006.1|9998_10646_-	type III secretion system protein EcsC	NA	NA	NA	NA	NA
WP_031645005.1|10790_11405_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	31.6	3.7e-11
WP_060869056.1|11839_14755_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	36.6	2.1e-173
WP_003728468.1|14758_15313_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	53.4	7.0e-38
WP_003728467.1|15592_15952_+	Cd(II)-sensing metalloregulatory transcriptional repressor CadC	NA	E4ZFI8	Streptococcus_phage	50.0	3.1e-26
WP_003728466.1|15951_18087_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	64.5	1.6e-247
WP_002319817.1|18226_18907_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_003728476.1|19026_20910_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.3	5.6e-87
WP_003769220.1|21372_22098_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003769259.1|22162_23032_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	51.1	7.1e-69
WP_003728514.1|23046_23301_-|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	46.4	1.6e-13
WP_003750113.1|23550_23871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728479.1|23870_24110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728480.1|24230_25100_+	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003728481.1|25345_26710_-	hypothetical protein	NA	A0A2K5B2C5	Erysipelothrix_phage	23.5	1.9e-07
WP_002389568.1|27333_28014_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	90.7	2.6e-119
>prophage 2
NZ_CP014251	Listeria monocytogenes strain CFSAN010068 plasmid pCFSAN010068_01, complete sequence	55521	35491	42874	55521	transposase	Lactococcus_phage(33.33%)	9	NA	NA
WP_003728498.1|35491_36094_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.7	2.0e-33
WP_003755398.1|36170_36968_-	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	63.2	3.3e-81
WP_031670161.1|36936_38163_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	60.6	2.8e-135
WP_109909798.1|38334_39423_-	class I SAM-dependent methyltransferase	NA	A0A248SL14	Klebsiella_phage	41.2	8.6e-64
WP_109909797.1|39464_39809_-	TnpV protein	NA	NA	NA	NA	NA
WP_011011011.1|40521_40920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728486.1|41093_41429_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPK3	Marinitoga_camini_virus	35.0	2.8e-05
WP_003728487.1|41465_41996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728488.1|42109_42874_-	Fic family protein	NA	A0A0G3Y4Q5	Ostreid_herpesvirus	29.4	2.6e-06
>prophage 3
NZ_CP014251	Listeria monocytogenes strain CFSAN010068 plasmid pCFSAN010068_01, complete sequence	55521	47549	50221	55521	transposase	Lactococcus_phage(66.67%)	3	NA	NA
WP_003728496.1|47549_48776_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	60.6	4.7e-135
WP_003755398.1|48744_49542_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	63.2	3.3e-81
WP_003728498.1|49618_50221_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.7	2.0e-33
>prophage 4
NZ_CP014251	Listeria monocytogenes strain CFSAN010068 plasmid pCFSAN010068_01, complete sequence	55521	53658	54633	55521		Enterococcus_phage(100.0%)	1	NA	NA
WP_003728501.1|53658_54633_+	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	35.0	2.4e-33
