The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP014857	Escherichia albertii strain EC06-170	4657167	185601	258654	4657167	tRNA,protease,plate	uncultured_Mediterranean_phage(10.0%)	60	NA	NA
WP_000753933.1|185601_187026_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
WP_025237615.1|187179_188337_+	DNA-binding transcriptional regulator CdaR	NA	NA	NA	NA	NA
WP_000272188.1|188390_188777_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_059234969.1|188935_189748_-	phosphodiesterase YaeI	NA	NA	NA	NA	NA
WP_001186660.1|189800_190625_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_060877150.1|190655_193328_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_059227835.1|193389_194184_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_000246882.1|194551_195277_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000818112.1|195534_196386_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000224577.1|196532_197258_+	UMP kinase	NA	NA	NA	NA	NA
WP_000622416.1|197591_198149_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000811947.1|198240_199437_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_010338877.1|199625_200384_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	43.7	5.0e-26
WP_000922459.1|200396_201254_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_059242086.1|201265_202618_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240910.1|202647_205080_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758953.1|205202_205688_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139291.1|205691_206717_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|206821_207277_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000566781.1|207280_208069_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000840593.1|208068_209217_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_059234963.1|209213_209810_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	41.4	1.9e-28
WP_001294809.1|209846_213329_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	1.8e-208
WP_000055744.1|213341_214301_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_000901084.1|214654_215044_+	VOC family protein	NA	NA	NA	NA	NA
WP_059234961.1|215108_216404_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_059234959.1|216456_216717_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|216703_216904_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185304.1|217069_217615_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_059234958.1|217611_218034_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_071852647.1|218050_218752_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_025237601.1|218794_220513_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_059234953.1|220623_221331_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202318.1|221327_221732_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874219.1|221849_222665_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294595.1|222704_223358_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593982.1|223350_224382_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
WP_059234951.1|224569_225142_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997008.1|231044_231848_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.8e-40
WP_000648596.1|231844_232759_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230977.1|232998_233799_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000644672.1|233985_235344_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_059219337.1|235415_236171_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_059236823.1|236204_236927_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917876.1|236923_237391_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	4.7e-51
WP_002430287.1|237455_238187_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.1	4.9e-39
WP_025237593.1|238719_239496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236626.1|239656_240124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060877151.1|240133_241048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002620.1|241081_241564_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_059242379.1|241575_242940_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_059242375.1|246493_247903_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_059236833.1|247907_248651_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_059249353.1|248647_251407_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.1	1.2e-80
WP_060877152.1|252180_253512_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001034128.1|253514_254039_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_059236837.1|254035_255316_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_059216074.1|255340_256423_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000522075.1|256386_258237_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_059216076.1|258240_258654_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_AP014857	Escherichia albertii strain EC06-170	4657167	878660	913112	4657167	tail,plate,head,integrase,portal,capsid,terminase,lysis	Salmonella_phage(81.4%)	47	878567:878586	913184:913203
878567:878586	attL	TCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_000290950.1|878660_879713_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_000900883.1|879901_880093_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001047327.1|880108_880678_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
WP_001247707.1|880803_881025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460891.1|881057_881567_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000956188.1|881574_881871_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	92.3	1.3e-22
WP_000934004.1|881956_882205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047086312.1|882286_882628_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	95.6	9.6e-54
WP_001244216.1|882695_882929_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	9.2e-32
WP_000752613.1|882928_883156_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_047086311.1|883152_884010_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.9	7.1e-162
WP_060877221.1|884006_886421_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.9	0.0e+00
WP_001154434.1|886573_886762_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217574.1|886772_887006_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	8.0e-36
WP_000700647.1|887119_887797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171841106.1|888047_889988_+	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	28.8	1.8e-11
WP_024240750.1|890029_891055_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.6	4.9e-170
WP_001098431.1|891054_892821_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_060877223.1|892963_893797_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.3	2.1e-118
WP_000742511.1|893813_894872_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000059191.1|894875_895526_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673523.1|895621_896086_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000868175.1|896085_896289_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|896292_896508_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_060877224.1|896488_897001_+	lysozyme	NA	E5G6N1	Salmonella_phage	90.5	5.8e-87
WP_001513114.1|897002_897380_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.0e-16
WP_016232552.1|897376_897805_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.6	6.4e-47
WP_060877225.1|897879_898332_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	1.5e-70
WP_029796948.1|898324_898774_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	90.6	5.8e-67
WP_024240755.1|898788_899724_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	93.6	5.1e-174
WP_024240756.1|899809_900388_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.2e-93
WP_024240757.1|900384_900744_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	6.1e-51
WP_001583364.1|900730_901639_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
WP_024240758.1|901631_902237_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	91.5	1.7e-109
WP_029796950.1|902233_903793_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	73.7	4.4e-210
WP_024240759.1|903792_904395_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	5.0e-98
WP_024235286.1|904366_904816_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.5	1.3e-50
WP_125295755.1|904836_905229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016232560.1|905256_905823_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	6.4e-87
WP_024240761.1|905965_907138_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	1.0e-203
WP_001207660.1|907147_907663_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_016232562.1|907717_908020_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	1.4e-40
WP_000763311.1|908034_908154_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_024240762.1|908146_911224_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	68.8	0.0e+00
WP_024240763.1|911220_911706_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.3e-67
WP_024240764.1|911702_912803_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	7.6e-177
WP_000972391.1|912893_913112_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
913184:913203	attR	TCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 3
NZ_AP014857	Escherichia albertii strain EC06-170	4657167	1323709	1412018	4657167	tail,integrase,protease,portal,holin,terminase	Enterobacteria_phage(42.31%)	93	1364910:1364927	1415762:1415779
WP_059236870.1|1323709_1324840_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	1.1e-101
WP_059219684.1|1324817_1325066_-	excisionase	NA	NA	NA	NA	NA
WP_060877267.1|1325130_1327590_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.9	7.9e-57
WP_059219682.1|1327670_1327874_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_059219681.1|1327870_1328059_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001241297.1|1328730_1329108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379591.1|1329107_1329260_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001003381.1|1329452_1329860_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|1329937_1330165_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_059259531.1|1330148_1330670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059245561.1|1330650_1331616_+	hypothetical protein	NA	U5P0A0	Shigella_phage	64.4	1.6e-58
WP_059259526.1|1331622_1332369_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.7	3.4e-112
WP_060877268.1|1332392_1333154_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	86.2	3.0e-116
WP_059225508.1|1333161_1333578_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	68.3	1.2e-45
WP_060877269.1|1333736_1334300_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	38.0	2.3e-20
WP_000813254.1|1334571_1334727_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980991.1|1334943_1335195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023140913.1|1335261_1335540_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_060877271.1|1335541_1336597_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	4.9e-88
WP_053898848.1|1336597_1336978_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.2e-36
WP_059222302.1|1336974_1337796_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.3	7.2e-79
WP_000839572.1|1338535_1338751_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_077874049.1|1338755_1339307_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	96.4	7.0e-38
WP_001557934.1|1339254_1339515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060877272.1|1339628_1340162_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	97.7	1.3e-100
WP_171841102.1|1340318_1340456_+	hypothetical protein	NA	Q687G2	Enterobacteria_phage	91.1	6.0e-15
WP_059259517.1|1340677_1340860_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	72.9	2.7e-15
WP_000373425.1|1341454_1341949_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_060877273.1|1341948_1344051_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.1	0.0e+00
WP_001072975.1|1344047_1344260_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_023908451.1|1344187_1345768_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	3.1e-288
WP_077874050.1|1345712_1347740_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.4	0.0e+00
WP_001097050.1|1347826_1348150_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|1348142_1348418_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677106.1|1348429_1349008_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001079419.1|1349004_1349406_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000211129.1|1349416_1350160_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.6	1.0e-132
WP_001300035.1|1350220_1350607_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|1350615_1350945_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_060877274.1|1350916_1353991_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	92.3	0.0e+00
WP_000847354.1|1353987_1354317_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	8.1e-58
WP_060877275.1|1354316_1355015_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
WP_060877276.1|1355019_1355763_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	3.0e-145
WP_059236966.1|1355699_1356308_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	3.8e-101
WP_060877278.1|1356368_1359782_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	95.6	0.0e+00
WP_060877279.1|1359842_1361156_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	95.4	2.2e-74
WP_001023428.1|1361157_1361427_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	98.9	2.4e-44
WP_059241852.1|1361540_1362131_+	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	44.8	2.7e-35
WP_060877280.1|1362191_1362836_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	60.5	1.6e-65
WP_024262848.1|1364119_1364746_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.8	5.9e-25
1364910:1364927	attL	TTTTATAAAAAGGAATTA	NA	NA	NA	NA
WP_060877282.1|1364929_1365520_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_071852665.1|1365610_1365808_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_059224340.1|1366526_1367333_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_059235763.1|1367332_1368526_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_072250362.1|1368537_1369899_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	8.6e-37
WP_025237097.1|1369899_1371495_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	6.5e-52
WP_060877283.1|1371494_1373057_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1373148_1373193_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_060877284.1|1373330_1374212_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_010332801.1|1374208_1374829_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291224.1|1374929_1375805_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_060877285.1|1375974_1376997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000706.1|1377006_1377315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288268.1|1377369_1377960_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_059224327.1|1377956_1378715_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.8	2.0e-06
WP_060877286.1|1378933_1379983_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.0	3.0e-21
WP_001031530.1|1380017_1380269_-	YciN family protein	NA	NA	NA	NA	NA
WP_059239922.1|1380649_1383247_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	36.2	9.8e-90
WP_025237091.1|1383457_1384432_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_059251488.1|1384682_1387358_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_060877287.1|1387420_1388011_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	1.5e-41
WP_001256520.1|1388180_1388945_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_000876304.1|1389093_1389402_+	lipopolysaccharide assembly protein LapA	NA	NA	NA	NA	NA
WP_059241838.1|1389408_1390578_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_059235758.1|1390768_1391506_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_010332626.1|1391505_1391832_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_000471009.1|1391956_1392175_-	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_001088632.1|1392442_1393192_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_001288320.1|1393280_1393454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000859924.1|1393600_1395586_-	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_102204214.1|1395640_1395712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059251484.1|1395821_1397756_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	28.3	3.7e-33
WP_060877288.1|1397823_1398951_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506483.1|1399094_1399883_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_001086166.1|1400406_1400973_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059251480.1|1401121_1402243_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_059251478.1|1402242_1405350_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_059251476.1|1405353_1406727_+	TolC family protein	NA	NA	NA	NA	NA
WP_059251474.1|1406735_1407908_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.3	9.1e-27
WP_000573416.1|1407962_1408769_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.2	1.0e-13
WP_001128851.1|1408770_1409763_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146159.1|1409762_1410653_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_059214817.1|1410830_1412018_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.4	4.4e-114
1415762:1415779	attR	TTTTATAAAAAGGAATTA	NA	NA	NA	NA
>prophage 4
NZ_AP014857	Escherichia albertii strain EC06-170	4657167	1977813	2034812	4657167	tail,transposase,head,integrase,portal,holin,capsid,terminase,lysis	Enterobacteria_phage(43.75%)	63	1969221:1969235	2037213:2037227
1969221:1969235	attL	ACGGTTTTTATGCCA	NA	NA	NA	NA
WP_001298831.1|1977813_1978404_-	T3SS effector NleG family protein	NA	B6DZB9	Enterobacteria_phage	58.9	2.3e-23
WP_122988840.1|1978425_1978503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060877337.1|1978613_1978883_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	97.8	2.1e-43
WP_060877338.1|1978884_1980198_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	95.7	1.3e-74
WP_060877339.1|1980257_1983671_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	95.4	0.0e+00
WP_025238684.1|1983804_1984326_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	66.7	2.0e-63
WP_054413253.1|1984368_1984971_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	82.7	4.4e-86
WP_060877340.1|1984907_1985651_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	4.3e-147
WP_024241847.1|1985656_1986355_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
WP_000847354.1|1986354_1986684_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	8.1e-58
WP_060877341.1|1986680_1989254_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	78.6	0.0e+00
WP_071852674.1|1989234_1989648_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000479086.1|1989674_1990106_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_054412995.1|1990119_1990872_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	2.2e-127
WP_000683071.1|1990879_1991275_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_000975035.1|1991271_1991847_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.3	1.7e-50
WP_054412997.1|1991861_1992215_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	68.4	4.3e-41
WP_059242536.1|1992207_1992582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054412999.1|1992633_1993662_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	7.8e-115
WP_000256840.1|1993719_1994067_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_054413001.1|1994103_1995609_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.2	2.1e-100
WP_060877342.1|1995598_1997191_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	6.0e-183
WP_000259002.1|1997187_1997394_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_059242538.1|1997377_1999306_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	1.2e-262
WP_000235446.1|1999277_1999787_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_059242540.1|2000101_2000506_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	41.9	7.2e-24
WP_000708309.1|2000749_2001061_-	DUF4406 domain-containing protein	NA	A0A2I6TCY5	Escherichia_phage	100.0	3.5e-55
WP_059242541.1|2001102_2001540_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.2	1.2e-69
WP_059242542.1|2001536_2002070_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	97.2	7.4e-101
WP_001315200.1|2002175_2002448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060877343.1|2002413_2002758_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	90.5	9.1e-36
WP_001382056.1|2002762_2002978_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.0e-32
WP_060877344.1|2003199_2005050_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	92.8	0.0e+00
WP_059275006.1|2005959_2006649_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	2.1e-60
WP_038347044.1|2006645_2007011_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.3	2.1e-38
WP_059275005.1|2007011_2008067_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_032278866.1|2008068_2008347_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_059236911.1|2008413_2008674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001585819.1|2008986_2009139_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_059274977.1|2009242_2009464_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	86.8	2.7e-25
WP_059227621.1|2009431_2010151_-	DUF551 domain-containing protein	NA	A0A2D1GLX9	Escherichia_phage	50.4	6.8e-49
WP_060877345.1|2010309_2010726_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	67.6	7.6e-45
WP_059274976.1|2010733_2011495_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	85.0	1.8e-113
WP_000789001.1|2011517_2012264_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.7	3.4e-112
WP_060877346.1|2012270_2013224_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.8e-58
WP_052931681.1|2013204_2013726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025237252.1|2013709_2013940_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000379971.1|2014023_2014431_+	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	54.7	2.6e-13
WP_000379568.1|2014597_2014750_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394553.1|2014761_2015400_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	43.0	2.5e-07
WP_001133037.1|2015400_2015610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560212.1|2016178_2016400_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	82.2	4.3e-31
WP_060877348.1|2016523_2018995_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.2	5.0e-59
WP_000096344.1|2019053_2019257_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_060877349.1|2019256_2020282_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	8.9e-103
WP_024164886.1|2020517_2021315_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_059236211.1|2021531_2022482_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_059236213.1|2023595_2023814_+	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_059274973.1|2024084_2028275_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.5	1.1e-21
WP_059215835.1|2028262_2028676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060877350.1|2029347_2030661_+	shikimate transporter	NA	NA	NA	NA	NA
WP_060877351.1|2030762_2032217_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_059249412.1|2033789_2034812_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.3e-199
2037213:2037227	attR	ACGGTTTTTATGCCA	NA	NA	NA	NA
>prophage 5
NZ_AP014857	Escherichia albertii strain EC06-170	4657167	2088194	2161305	4657167	tail,transposase,head,tRNA,integrase,portal,holin,capsid,terminase	Escherichia_phage(34.62%)	67	2138543:2138602	2161255:2162503
WP_077874057.1|2088194_2088350_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_060877371.1|2088524_2089760_-	colanic acid biosynthesis glycosyltransferase WcaL	NA	NA	NA	NA	NA
WP_000183060.1|2091420_2092314_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_157730401.1|2092812_2092965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000454704.1|2093642_2095226_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	9.4e-35
WP_060877372.1|2095676_2097530_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234780.1|2097551_2098133_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.6	2.7e-32
WP_001295424.1|2098224_2098866_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_060877373.1|2099183_2102501_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.1	1.8e-16
WP_059224841.1|2102611_2103460_-	DNA-3-methyladenine glycosylase 2	NA	NA	NA	NA	NA
WP_060877374.1|2103593_2104946_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.1e-07
WP_103054298.1|2105232_2105289_-	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_102204210.1|2105559_2105616_-	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_053896784.1|2106208_2107534_+	type III secretion system effector NleA	NA	Q6H9S2	Enterobacteria_phage	86.1	9.7e-219
WP_032321283.1|2108227_2108875_-	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.3	1.4e-37
WP_060877337.1|2109084_2109354_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	97.8	2.1e-43
WP_060877375.1|2109355_2110669_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	95.9	4.5e-75
WP_060877376.1|2110733_2111333_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	87.9	3.8e-98
WP_060877377.1|2111402_2114816_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	95.6	0.0e+00
WP_071852678.1|2114876_2115509_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.1	2.5e-95
WP_060877379.1|2115445_2116189_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	1.1e-147
WP_024241847.1|2116194_2116893_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
WP_000847354.1|2116892_2117222_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	8.1e-58
WP_060877380.1|2117218_2119798_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.9	0.0e+00
WP_059236887.1|2119790_2120216_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.2e-63
WP_032329098.1|2120197_2120620_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.4e-70
WP_059236901.1|2120635_2121376_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	97.6	6.1e-130
WP_059236889.1|2121383_2121779_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	96.2	5.5e-69
WP_059236891.1|2121775_2122309_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	72.9	1.0e-62
WP_032151592.1|2122320_2122674_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	2.6e-62
WP_000158905.1|2122685_2123084_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	99.2	1.2e-63
WP_059236893.1|2123125_2124151_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	1.6e-189
WP_032285278.1|2124206_2124539_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	2.9e-55
WP_059236895.1|2124548_2125868_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	94.8	3.8e-223
WP_059242530.1|2125848_2127450_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.2e-309
WP_000198148.1|2127446_2127653_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	3.8e-29
WP_059236899.1|2127649_2129575_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	96.7	0.0e+00
WP_021559710.1|2129546_2130053_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	48.1	8.1e-33
WP_032275416.1|2130467_2130692_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	76.1	1.9e-18
WP_001302717.1|2130772_2131087_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_076738654.1|2131612_2131795_-	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	93.3	2.1e-15
WP_059236958.1|2132011_2132509_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	2.1e-89
WP_000284524.1|2132508_2132724_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_060877381.1|2132945_2134799_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	93.2	0.0e+00
WP_071852679.1|2135142_2135292_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|2135377_2136121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054413075.1|2136373_2136997_-	antitermination protein	NA	A0A088CQ66	Enterobacteria_phage	99.0	2.0e-113
WP_054413073.1|2136993_2137659_-	serine/threonine protein phosphatase	NA	A0A088CPU5	Enterobacteria_phage	96.8	3.0e-128
WP_059217943.1|2137636_2137843_-	phage NinH family protein	NA	Q716C0	Shigella_phage	98.5	2.8e-32
WP_059242596.1|2137839_2138460_-	recombination protein NinG	NA	A0A2D1GLP2	Escherichia_phage	97.6	5.7e-97
2138543:2138602	attL	TGAAGTGGTCAACAAAAACTGGCCACCGAGTTAGAGTTTTTCCAGTATCGATTTTCCGAT	NA	NA	NA	NA
WP_102203946.1|2138550_2139719_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.7	1.2e-183
WP_001281192.1|2140128_2140473_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_001303849.1|2140578_2140797_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_054412160.1|2140774_2141848_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	97.2	2.5e-196
WP_059218208.1|2142190_2143438_+	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_059225548.1|2143437_2146560_+	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
WP_059236516.1|2146560_2149638_+	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_059225550.1|2149638_2151045_+	MFS transporter	NA	NA	NA	NA	NA
WP_000675180.1|2151041_2152445_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	4.1e-34
WP_000137865.1|2152441_2153164_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	8.3e-31
WP_025238759.1|2153351_2153684_+	YegP family protein	NA	NA	NA	NA	NA
WP_059236514.1|2153831_2155193_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	98.1	1.1e-214
WP_071852681.1|2155853_2156630_+	cytolethal distending toxin type II subunit CdtA	NA	G1BEM3	Escherichia_phage	93.8	2.3e-127
WP_059236512.1|2156626_2157436_+	cytolethal distending toxin type II nuclease subunit CdtB	NA	G1BEM4	Escherichia_phage	94.1	5.0e-141
WP_059219458.1|2157450_2157996_+	cytolethal distending toxin type II subunit CdtC	NA	M1SNM4	Escherichia_phage	90.1	8.3e-92
WP_059242182.1|2158329_2159229_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.6	7.5e-13
WP_102203946.1|2160137_2161305_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.7	1.2e-183
2161255:2162503	attR	ATCGGAAAATCGATACTGGAAAAACTCTAACTCGGTGGCCAGTTTTTGTTGACCACTTCACTTCAATCGCCAGTTCAACAATATTCTTCGGGTCGAAATAGAGCGGATTAGCGGCAAATGAAGCCCCCGCAGAATGCTCAACCCCCTGGTCCACGGGCAGAATAGAAAGATATCCAGTTCCTGCCAGACGCCCGGTGTTGTACAGAGTTTGCATATTACGTAGCACTGCTGGCGGACGATTATTATCCATCATCACGCGGTCTACGTAGTCATGTCCAGGGAGATAAAGCTGGTCAGAAGGAATAGTCATACAACGATGCTGTAAAAGGTTGTCGGCGTCTTTGCCAAGCAACTGCGCAATATCTGTCATTACATGCTCCCGTAAATTCCGATTAGATATCGGCTATGGATTGTCCTGGCCCGCTTTCCGCGGACAATCATAATCCTGGTTGCTATGCGCGATTTTTTCCATCTTTCGGCTGTTTTTTCAGCGTTTACTATTGGCGCTATTCATCAGAAAAGTGTTATGGCGGTCAAGTTTTCACCTTAAAGGTATTTAAAAGGTATTATTAAATGGTATTGTCATCGCGTACCTTACATTACCTGTCATGAAGGAATTAAAAGATGAAAACAACAGCAAAGCTGTCGTTCATGATGTTTGTTGAATGGTTTATCTGGGGCGCGTGGTTCGTACCATTGTGGCTGTGGTTAAGTAAAAGCGGTTTTAGTGCCGGAGAAATTGGTTGGTCGTATGCCTGTACCGCCATTGCGGCGATCCTGTCGCCGATTCTGGTTGGATCTATCACCGACCGCTTTTTCTCGGCGCAGAAAGTGCTGGCAGTGTTGATGTTTGCTGGTGCCGTACTGATGTATTTCGCTGCACAACAGACAACGTTTGCCGGGTTCTTCCCGTTACTGCTGGCCTACTCGCTAACCTATATGCCGACCATTGCACTGACTAACAGTATCGCCTTTGCCAATGTGCCAGATGTTGAGCGTGATTTTCCGCGCATCCGCGTGATGGGCACCATCGGCTGGATTGCTTCTGGTCTGGCGTGTGGCTTCTTGCCGCAAATGCTGGGTTATGCCGATATCTCACCAACCAATATTCCACTGCTGATCACCGCCGCAAGTTCGGCACTGCTGGGCGTTTTTGCGTTGTTCTTGCCAGATACGCCGCCAAAAAGCACCGGCAAAATGGATATAAAAGTTATGCTCGGCCTGGATGCGTTGATCCTGCTGCGTGATA	NA	NA	NA	NA
>prophage 6
NZ_AP014857	Escherichia albertii strain EC06-170	4657167	2212215	2221662	4657167		Enterobacteria_phage(85.71%)	10	NA	NA
WP_059236491.1|2212215_2213352_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	94.1	2.0e-159
WP_059236489.1|2213348_2215346_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	85.4	0.0e+00
WP_000643193.1|2215476_2215938_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	89.5	8.4e-69
WP_000950402.1|2215980_2216451_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	96.2	2.8e-80
WP_002461811.1|2216497_2217217_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_002461809.1|2217213_2218899_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	97.7	2.7e-298
WP_001240387.1|2219120_2219852_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	96.5	2.2e-108
WP_001216963.1|2219911_2220019_+	protein YohO	NA	NA	NA	NA	NA
WP_000783146.1|2219999_2220731_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569309.1|2220735_2221662_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 7
NZ_AP014857	Escherichia albertii strain EC06-170	4657167	2793422	2800563	4657167		Escherichia_phage(66.67%)	6	NA	NA
WP_059241919.1|2793422_2795984_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.2e-31
WP_059235891.1|2796090_2796747_+	protein-serine/threonine phosphatase	NA	K7P7V3	Enterobacteria_phage	44.9	8.0e-49
WP_002461462.1|2796797_2797565_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	1.1e-68
WP_059221372.1|2797760_2798669_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	6.6e-118
WP_060877430.1|2798665_2799928_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	2.2e-135
WP_000997544.1|2799924_2800563_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.5	5.7e-84
>prophage 8
NZ_AP014857	Escherichia albertii strain EC06-170	4657167	4231894	4279305	4657167	tail,transposase,tRNA,protease,integrase,portal,holin,terminase,lysis	Enterobacteria_phage(48.15%)	59	4253363:4253377	4289302:4289316
WP_000549966.1|4231894_4232329_+	type II toxin-antitoxin system YafO family toxin	NA	A0A0S2SYH1	Pseudomonas_phage	51.0	5.2e-36
WP_001093909.1|4232355_4232628_-	pyocin activator PrtN family protein	NA	S5MQM5	Escherichia_phage	86.7	5.9e-38
WP_059249412.1|4232897_4233920_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.3e-199
WP_001297096.1|4233919_4234699_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000073886.1|4235195_4235507_-	hypothetical protein	NA	A0A2H4N7F8	Pectobacterium_phage	42.6	1.1e-11
WP_025237882.1|4235503_4235887_-	hypothetical protein	NA	A5LH60	Enterobacteria_phage	70.5	1.3e-27
WP_021513303.1|4235888_4236080_-	hypothetical protein	NA	G9L660	Escherichia_phage	95.2	5.2e-25
WP_059260026.1|4236081_4236669_-	hypothetical protein	NA	Q9MCT8	Escherichia_phage	76.0	2.4e-97
WP_000008180.1|4236659_4237196_-	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	98.9	1.1e-99
WP_000081297.1|4237323_4238148_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.6	4.6e-150
WP_060877545.1|4238213_4238576_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	7.3e-60
WP_032174256.1|4238979_4239153_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_059249429.1|4239525_4240152_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.3	7.2e-47
WP_000205494.1|4240249_4240450_+	cell division protein	NA	NA	NA	NA	NA
WP_000514174.1|4240487_4241072_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
WP_001250270.1|4241247_4241460_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	5.4e-15
WP_000054957.1|4241416_4242409_+	hypothetical protein	NA	U5P0A0	Shigella_phage	98.2	1.2e-93
WP_000066917.1|4242503_4243157_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210170.1|4243153_4243480_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767103.1|4243476_4243866_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_024246862.1|4243885_4244695_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	99.3	1.1e-153
WP_059260025.1|4244702_4245692_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	3.3e-195
WP_001047112.1|4245705_4246458_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.8	6.9e-137
WP_059249446.1|4246738_4247164_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	99.3	4.7e-74
WP_000839572.1|4247978_4248194_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_059260024.1|4248198_4248543_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	6.3e-37
WP_047089677.1|4248508_4248781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059260023.1|4248886_4249420_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.6	6.2e-100
WP_059249421.1|4249416_4249884_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	95.5	3.9e-74
WP_001139675.1|4249871_4250024_+	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_000421825.1|4250697_4251237_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_024241854.1|4251245_4253345_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.9	0.0e+00
WP_001072975.1|4253341_4253554_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
4253363:4253377	attL	GCCATGATTCAGCGT	NA	NA	NA	NA
WP_077871487.1|4253481_4255062_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	3.1e-288
WP_001360054.1|4255006_4257034_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_001097050.1|4257120_4257444_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|4257436_4257712_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677114.1|4257723_4258314_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.6	5.5e-81
WP_001079419.1|4258310_4258712_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000211121.1|4258722_4259466_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	100.0	1.6e-133
WP_001298500.1|4259526_4259913_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_001161009.1|4259921_4260251_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_060877546.1|4260222_4263297_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	92.5	0.0e+00
WP_000847335.1|4263293_4263623_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	98.2	1.5e-56
WP_060877547.1|4263622_4264321_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	2.0e-130
WP_060877548.1|4264325_4265063_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	6.1e-146
WP_071852678.1|4264999_4265632_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.1	2.5e-95
WP_060877377.1|4265692_4269106_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	95.6	0.0e+00
WP_059222142.1|4269175_4269775_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	96.0	4.1e-108
WP_060877549.1|4269839_4271153_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.3	1.1e-78
WP_001023428.1|4271154_4271424_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	98.9	2.4e-44
WP_059260084.1|4271537_4272128_+	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	44.8	5.9e-35
WP_059268216.1|4272188_4272833_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	59.9	2.9e-67
WP_072248026.1|4272945_4273581_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	78.7	9.5e-63
WP_059221814.1|4274871_4275498_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	38.4	2.4e-26
WP_059258130.1|4275680_4276271_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_001217553.1|4276771_4277020_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000332271.1|4277081_4278179_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.7	9.5e-212
WP_025237879.1|4278267_4279305_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
4289302:4289316	attR	GCCATGATTCAGCGT	NA	NA	NA	NA
