The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	0	21439	1769679		Bacillus_phage(50.0%)	14	NA	NA
WP_062171688.1|1230_1512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062171694.1|1661_2699_-	YdcF family protein	NA	NA	NA	NA	NA
WP_062171699.1|2960_3584_-	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_062171703.1|3576_3849_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_062171707.1|4712_6215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062171711.1|6174_8778_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_062171714.1|9184_10204_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_062171717.1|10497_11538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062171720.1|11586_12396_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_082729107.1|13040_14990_+	amidase	NA	NA	NA	NA	NA
WP_062171722.1|15133_16393_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_062171725.1|16594_19210_-	DNA polymerase I	NA	S5M8J1	Bacillus_phage	34.3	3.4e-50
WP_062171728.1|19310_20495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062171732.1|20494_21439_-	heptaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	28.4	1.1e-09
>prophage 2
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	32662	35772	1769679		Staphylococcus_phage(50.0%)	3	NA	NA
WP_062171763.1|32662_33652_-	DUF348 domain-containing protein	NA	Q4Z8Z7	Staphylococcus_phage	79.6	1.2e-32
WP_062171767.1|33652_34441_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_062171770.1|34755_35772_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	51.4	2.9e-90
>prophage 3
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	45447	46065	1769679		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_062171786.1|45447_46065_-	reverse transcriptase-like protein	NA	A0A2H4JH24	uncultured_Caudovirales_phage	35.1	1.4e-31
>prophage 4
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	51123	52761	1769679		Murid_herpesvirus(50.0%)	2	NA	NA
WP_062171798.1|51123_51780_-	uracil-DNA glycosylase	NA	P88984	Murid_herpesvirus	42.7	4.7e-41
WP_062171801.1|51972_52761_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	36.2	7.2e-36
>prophage 5
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	81876	85497	1769679	integrase,tRNA,transposase	Staphylococcus_phage(50.0%)	2	84390:84415	85750:85775
WP_062171873.1|81876_84306_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	71.7	0.0e+00
84390:84415	attL	TACCGGTTTTCAAAATACAATTACAT	NA	NA	NA	NA
WP_062174635.1|84513_85497_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A8RHK4	Spiroplasma_virus	31.2	1.0e-07
WP_062174635.1|84513_85497_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A8RHK4	Spiroplasma_virus	31.2	1.0e-07
85750:85775	attR	TACCGGTTTTCAAAATACAATTACAT	NA	NA	NA	NA
>prophage 6
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	92488	102746	1769679		Planktothrix_phage(20.0%)	8	NA	NA
WP_062171881.1|92488_93421_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.9	2.8e-15
WP_062171884.1|93420_94419_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.8	3.6e-16
WP_062171888.1|94710_95496_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	40.1	5.3e-39
WP_062171891.1|95852_96956_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_062171893.1|97107_98490_-	NADH oxidase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.4	5.9e-09
WP_062171897.1|98852_99239_-	DUF1310 family protein	NA	NA	NA	NA	NA
WP_062171900.1|99573_100374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062171905.1|100943_102746_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	36.7	3.2e-95
>prophage 7
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	108737	111702	1769679	integrase,tRNA,transposase	Spiroplasma_virus(50.0%)	3	108460:108485	109819:109844
108460:108485	attL	AACACTTTTACTAAATGAAAAATTTC	NA	NA	NA	NA
WP_062174635.1|108737_109721_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A8RHK4	Spiroplasma_virus	31.2	1.0e-07
WP_062171917.1|109999_110488_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
109819:109844	attR	AACACTTTTACTAAATGAAAAATTTC	NA	NA	NA	NA
WP_062171920.1|110817_111702_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.6	1.2e-36
>prophage 8
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	118772	123028	1769679	transposase	Bacillus_phage(33.33%)	5	NA	NA
WP_062171946.1|118772_119426_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.6	1.4e-24
WP_062171949.1|119814_120741_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	37.7	5.5e-11
WP_062171952.1|121083_121812_+	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
WP_062171955.1|121835_122414_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_062171958.1|122563_123028_-|transposase	IS200/IS605 family transposase	transposase	W0UUZ0	Sulfolobus_monocaudavirus	40.8	1.4e-18
>prophage 9
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	135270	141631	1769679	transposase	Streptococcus_phage(33.33%)	5	NA	NA
WP_062171995.1|135270_136647_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	34.8	1.4e-55
WP_062171998.1|136857_137649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062172001.1|137648_138965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062172003.1|138977_140930_-	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	20.4	7.3e-13
WP_062172007.1|140929_141631_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.1	6.8e-38
>prophage 10
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	146819	155319	1769679	tRNA	Catovirus(33.33%)	7	NA	NA
WP_062172022.1|146819_148691_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	32.1	6.7e-24
WP_062172025.1|148989_149244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062172028.1|149250_150210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062172032.1|150221_151040_-	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_062172040.1|151326_153306_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	M4QMW8	Micromonas_pusilla_virus	48.6	6.7e-115
WP_062172046.1|153449_153998_-	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_062172051.1|154002_155319_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	R4TVK3	Phaeocystis_globosa_virus	28.2	5.6e-17
>prophage 11
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	163630	164671	1769679		Enterobacteria_phage(100.0%)	1	NA	NA
WP_062172064.1|163630_164671_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	22.0	1.0e-13
>prophage 12
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	172762	187152	1769679	tRNA,transposase	Bacillus_phage(14.29%)	13	NA	NA
WP_062172088.1|172762_173131_+	response regulator	NA	W8CYM9	Bacillus_phage	31.4	3.1e-05
WP_062172090.1|173260_174643_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_062172092.1|174684_175449_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	44.6	6.9e-52
WP_062172094.1|175451_175979_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_062172096.1|176275_176560_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_062172098.1|177205_178483_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	27.0	2.5e-14
WP_062172100.1|178992_179661_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_062172102.1|179660_180647_+	sensor histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	30.0	2.6e-06
WP_062172104.1|180840_181593_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.8e-29
WP_062172105.1|181594_183580_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_062172106.1|183714_183981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062172107.1|184171_185497_-	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	42.0	3.6e-96
WP_062171995.1|185775_187152_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	34.8	1.4e-55
>prophage 13
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	190241	193531	1769679		Escherichia_phage(50.0%)	4	NA	NA
WP_082729108.1|190241_190991_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.3	5.3e-20
WP_062172114.1|191008_191569_-	RDD family protein	NA	NA	NA	NA	NA
WP_021753449.1|191578_192295_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_062172116.1|192730_193531_+	DUF1444 family protein	NA	A0A2H4PQY3	Staphylococcus_phage	42.7	1.1e-23
>prophage 14
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	197378	207743	1769679		Streptococcus_phage(25.0%)	9	NA	NA
WP_062172126.1|197378_198059_+	CHAP domain-containing protein	NA	M1PKF8	Streptococcus_phage	35.1	1.7e-33
WP_062172128.1|198152_200096_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_062172130.1|200113_201031_-	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_062172132.1|201030_201786_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.4	1.5e-22
WP_156439977.1|201976_203074_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_062172134.1|203248_203875_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.0	2.6e-57
WP_062172136.1|204086_205280_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_062172138.1|205636_206836_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_062172140.1|206837_207743_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.0	1.3e-17
>prophage 15
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	212379	221924	1769679		Staphylococcus_phage(50.0%)	9	NA	NA
WP_021753478.1|212379_212622_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	51.4	1.7e-12
WP_062172147.1|212981_213413_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_062172149.1|213948_214509_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_062172151.1|214725_215019_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_062172153.1|215343_217065_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.2	1.6e-16
WP_062172155.1|217064_218678_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.6	7.1e-22
WP_062172157.1|219086_220631_+	alveolysin	NA	NA	NA	NA	NA
WP_062172159.1|220781_221363_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_062172161.1|221366_221924_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	50.3	2.4e-41
>prophage 16
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	228264	242912	1769679		Streptococcus_phage(44.44%)	14	NA	NA
WP_062172174.1|228264_229737_+	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	52.3	4.4e-111
WP_062174643.1|229758_230490_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_062172176.1|230507_231206_+	capsular biosynthesis protein CpsC	NA	A0A1X9I5E1	Streptococcus_phage	42.8	3.9e-41
WP_062172178.1|231215_231911_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	50.2	1.0e-54
WP_062172180.1|231935_233297_+	sugar transferase	NA	NA	NA	NA	NA
WP_062172181.1|233511_234579_+	hypothetical protein	NA	A0A1G5SA08	Enterococcus_phage	29.2	8.8e-21
WP_062172183.1|234590_235454_+	LicD family protein	NA	A0A1V0SAS8	Catovirus	43.4	1.7e-06
WP_062172185.1|235434_236292_+	LicD family protein	NA	A0A1V0SD50	Indivirus	40.7	1.4e-05
WP_062172187.1|236284_237358_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_062172189.1|237371_238697_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A0F7LBI5	uncultured_marine_virus	32.8	4.8e-08
WP_106388761.1|238710_239556_+	LicD family protein	NA	A0A1V0SD50	Indivirus	43.6	9.8e-07
WP_062172191.1|239552_240743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062172193.1|240756_241758_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_062172195.1|241811_242912_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	66.3	1.1e-146
>prophage 17
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	247953	256329	1769679	holin,transposase	Tupanvirus(33.33%)	6	NA	NA
WP_062172205.1|247953_249171_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L470	Tupanvirus	29.6	9.7e-32
WP_106388767.1|249202_250000_+|holin	phosphorylcholine transferase LicD	holin	NA	NA	NA	NA
WP_062172208.1|249989_250952_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_062172211.1|250961_253112_+|holin	lipopolysaccharide cholinephosphotransferase	holin	A0A1V0SD50	Indivirus	28.7	1.1e-06
WP_062172213.1|253111_253828_+	phosphate ABC transporter permease	NA	NA	NA	NA	NA
WP_062172215.1|254970_256329_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.3	5.0e-45
>prophage 18
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	264236	282159	1769679	integrase,transposase	Bacillus_phage(28.57%)	14	263960:263985	265319:265344
263960:263985	attL	CTAGTTTTTTTCTCGGTTTTAATTAT	NA	NA	NA	NA
WP_062174648.1|264236_265220_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A8RHK4	Spiroplasma_virus	31.2	1.0e-07
WP_114889575.1|265354_266086_+	hypothetical protein	NA	NA	NA	NA	NA
265319:265344	attR	CTAGTTTTTTTCTCGGTTTTAATTAT	NA	NA	NA	NA
WP_062172234.1|266399_267269_+	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_062172238.1|267258_268134_+	DMT family transporter	NA	NA	NA	NA	NA
WP_062172240.1|268148_268838_+	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	43.4	1.0e-06
WP_062172244.1|269225_270911_+	endo-beta-N-acetylglucosaminidase	NA	R4JKF9	Bacillus_phage	42.2	1.7e-21
WP_062172247.1|270970_271972_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_062172248.1|272153_273911_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.3	8.8e-26
WP_062172250.1|273903_275631_+	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	24.7	7.1e-20
WP_062172252.1|275643_276255_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_062172254.1|276340_277180_-	DegV family protein	NA	NA	NA	NA	NA
WP_062172256.1|277613_278459_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	32.3	1.6e-36
WP_072520099.1|278876_279608_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_062172258.1|279975_282159_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	61.9	4.0e-270
>prophage 19
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	293933	298016	1769679	tRNA	Cronobacter_phage(50.0%)	5	NA	NA
WP_062172682.1|293933_295187_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.3	3.9e-84
WP_062174652.1|295277_295955_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_062172685.1|295973_297026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021752550.1|297041_297359_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_062172687.1|297530_298016_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	H2EF51	Moumouvirus	47.5	8.6e-24
>prophage 20
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	303344	307291	1769679		Staphylococcus_phage(33.33%)	3	NA	NA
WP_062172692.1|303344_304925_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.5	8.3e-108
WP_062172693.1|305085_306111_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	44.0	1.4e-63
WP_062172694.1|306103_307291_+	restriction endonuclease subunit S	NA	A0A1V0SLK8	Klosneuvirus	24.0	1.7e-09
>prophage 21
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	317638	318622	1769679	integrase,transposase	Spiroplasma_virus(100.0%)	1	317361:317386	318720:318745
317361:317386	attL	AATAAATAATGATAACATTTACACAG	NA	NA	NA	NA
WP_062174648.1|317638_318622_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A8RHK4	Spiroplasma_virus	31.2	1.0e-07
WP_062174648.1|317638_318622_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A8RHK4	Spiroplasma_virus	31.2	1.0e-07
318720:318745	attR	AATAAATAATGATAACATTTACACAG	NA	NA	NA	NA
>prophage 22
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	322954	329633	1769679		Bacillus_virus(66.67%)	6	NA	NA
WP_062172704.1|322954_324748_+	M24 family metallopeptidase	NA	A0A0P0I8D7	Acinetobacter_phage	37.0	8.2e-112
WP_062172706.1|324885_326115_+	aminopeptidase	NA	NA	NA	NA	NA
WP_062172708.1|326252_326513_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_062172710.1|326517_327081_+	septum formation initiator	NA	NA	NA	NA	NA
WP_062172712.1|327354_328800_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.3	1.7e-112
WP_062172714.1|328811_329633_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.7	1.4e-69
>prophage 23
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	337869	344303	1769679		Ochrobactrum_phage(33.33%)	6	NA	NA
WP_021753214.1|337869_338628_+	ParA family protein	NA	A0A240F4U1	Ochrobactrum_phage	29.3	9.1e-20
WP_062172716.1|338620_339478_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	32.2	3.2e-13
WP_062172717.1|339480_340353_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_062172719.1|340356_340545_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_062174654.1|340770_341865_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_062172721.1|342068_344303_+	HAD-IC family P-type ATPase	NA	E4ZFI9	Streptococcus_phage	23.5	1.3e-26
>prophage 24
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	349116	354040	1769679		Streptococcus_phage(50.0%)	3	NA	NA
WP_062172731.1|349116_349845_+	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	37.6	4.2e-38
WP_062172733.1|349866_350445_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_062172735.1|350767_354040_+	DNA polymerase III subunit alpha	NA	R4TPF1	Streptomyces_phage	36.7	1.9e-114
>prophage 25
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	361406	366370	1769679	integrase,transposase	Streptococcus_phage(33.33%)	3	365263:365289	366623:366649
WP_156439978.1|361406_362753_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	34.4	3.1e-55
WP_062172749.1|363106_364651_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.1	3.4e-21
365263:365289	attL	CTTATCCAGATTACAAAAAATAATTTT	NA	NA	NA	NA
WP_062174648.1|365386_366370_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A8RHK4	Spiroplasma_virus	31.2	1.0e-07
WP_062174648.1|365386_366370_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A8RHK4	Spiroplasma_virus	31.2	1.0e-07
366623:366649	attR	CTTATCCAGATTACAAAAAATAATTTT	NA	NA	NA	NA
>prophage 26
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	370150	371794	1769679		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_062172757.1|370150_371794_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	33.3	5.7e-43
>prophage 27
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	383170	383869	1769679		Planktothrix_phage(100.0%)	1	NA	NA
WP_062172767.1|383170_383869_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.5	3.2e-35
>prophage 28
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	401393	402122	1769679		Bacillus_phage(100.0%)	1	NA	NA
WP_062172800.1|401393_402122_-	serine/threonine protein phosphatase	NA	A0A127AVW0	Bacillus_phage	29.9	1.1e-14
>prophage 29
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	405534	411560	1769679		Synechococcus_phage(66.67%)	4	NA	NA
WP_062172811.1|405534_406998_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	3.0e-96
WP_062172813.1|407091_408543_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_062172815.1|408784_410197_+	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.7	1.2e-25
WP_082729111.1|410168_411560_+	glucose-6-phosphate dehydrogenase	NA	E3SKF6	Synechococcus_phage	33.1	1.1e-66
>prophage 30
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	417941	423832	1769679		Streptococcus_phage(50.0%)	5	NA	NA
WP_062172827.1|417941_419258_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	78.1	5.2e-188
WP_062172829.1|420345_421281_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_062174662.1|421435_422047_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	55.7	8.5e-61
WP_062172831.1|422064_423309_+	NADPH-dependent FMN reductase	NA	A0A2P0ZL82	Lactobacillus_phage	47.4	4.6e-53
WP_062172833.1|423472_423832_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	M1PLC0	Streptococcus_phage	44.5	1.2e-17
>prophage 31
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	440166	440742	1769679		Lactobacillus_phage(100.0%)	1	NA	NA
WP_062172860.1|440166_440742_+	NUDIX hydrolase	NA	A0A2K9VCP4	Lactobacillus_phage	29.9	1.1e-09
>prophage 32
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	443754	444456	1769679		Planktothrix_phage(100.0%)	1	NA	NA
WP_062172872.1|443754_444456_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.5	9.9e-37
>prophage 33
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	449891	461196	1769679	tRNA	uncultured_Caudovirales_phage(33.33%)	10	NA	NA
WP_062172879.1|449891_451805_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.0	1.2e-55
WP_062172881.1|451808_452186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062172883.1|452213_453848_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_021752427.1|453868_454345_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_021752428.1|454580_454781_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.7	1.1e-17
WP_062172886.1|455192_456599_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	26.0	3.3e-31
WP_040460791.1|456765_457482_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_062172888.1|457750_458131_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	50.4	4.0e-24
WP_062172890.1|458117_460208_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	74.1	4.1e-304
WP_021752530.1|460227_461196_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	64.9	1.3e-119
>prophage 34
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	467764	468472	1769679		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_062172903.1|467764_468472_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	29.8	1.0e-17
>prophage 35
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	480799	486630	1769679	integrase,tRNA,transposase	Enterobacteria_phage(25.0%)	5	482870:482895	484230:484255
WP_062172919.1|480799_481243_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	39.9	6.3e-21
WP_062172921.1|481459_482014_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.8	6.4e-15
WP_062172923.1|482352_482793_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
482870:482895	attL	AAGTATAGTAAATATAGTATAACTTG	NA	NA	NA	NA
WP_062174673.1|482993_483977_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A8RHK4	Spiroplasma_virus	31.2	7.9e-08
WP_062172925.1|484632_486630_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	38.4	3.2e-96
484230:484255	attR	AAGTATAGTAAATATAGTATAACTTG	NA	NA	NA	NA
>prophage 36
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	490877	498404	1769679		Bacillus_phage(50.0%)	5	NA	NA
WP_062172934.1|490877_492311_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.5	5.0e-11
WP_062172936.1|492426_493377_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	36.0	1.7e-47
WP_062172938.1|493389_494001_+	NUDIX domain-containing protein	NA	A0A127AYS1	Bacillus_phage	40.2	1.2e-25
WP_062172939.1|494254_495391_+	exonuclease subunit SbcD	NA	NA	NA	NA	NA
WP_062172942.1|495377_498404_+	SMC family ATPase	NA	S6ATP3	Bacillus_phage	27.3	6.0e-06
>prophage 37
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	502813	507347	1769679		Klosneuvirus(25.0%)	5	NA	NA
WP_062172947.1|502813_503644_+	energy-coupling factor transporter ATPase	NA	A0A1V0SJ29	Klosneuvirus	29.5	1.3e-14
WP_062172948.1|503619_504507_+	energy-coupling factor transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.4	5.5e-16
WP_062172949.1|504499_505288_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_062172950.1|505344_506376_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.8	8.8e-42
WP_062172951.1|506390_507347_+	glycosyltransferase family 2 protein	NA	A0A2H5BFL1	Salmonella_phage	39.1	1.2e-48
>prophage 38
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	511614	512379	1769679		Bacillus_virus(100.0%)	1	NA	NA
WP_062172955.1|511614_512379_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.8	9.5e-17
>prophage 39
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	526509	534883	1769679	integrase,transposase	Spiroplasma_virus(25.0%)	8	524999:525014	529979:529994
524999:525014	attL	ATCAACACCATCTTTA	NA	NA	NA	NA
WP_062174043.1|526509_527493_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A8RHK4	Spiroplasma_virus	31.2	1.0e-07
WP_062172966.1|528213_528978_+	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	25.1	9.8e-06
WP_062174677.1|529478_530336_+	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
529979:529994	attR	TAAAGATGGTGTTGAT	NA	NA	NA	NA
WP_062172967.1|530462_531191_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_062172968.1|531184_531961_+	JAB domain-containing protein	NA	A0A1B2LRS6	Wolbachia_phage	29.1	1.7e-13
WP_082729115.1|532553_533195_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_062172971.1|533197_533905_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_082729116.1|534004_534883_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.9	3.9e-14
>prophage 40
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	539826	541107	1769679	tRNA	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_062172975.1|539826_541107_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.6	1.5e-91
>prophage 41
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	553862	557501	1769679		Bacillus_phage(100.0%)	1	NA	NA
WP_062172984.1|553862_557501_+	AAA family ATPase	NA	A7KV33	Bacillus_phage	23.8	3.3e-11
>prophage 42
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	569486	574252	1769679	protease	Agrobacterium_phage(50.0%)	4	NA	NA
WP_062172995.1|569486_570095_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.8	5.9e-54
WP_062172996.1|570670_571084_+	YjdF family protein	NA	NA	NA	NA	NA
WP_062172997.1|571251_571773_+	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062172998.1|571777_574252_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	39.3	4.9e-123
>prophage 43
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	577466	584319	1769679		Lactococcus_phage(33.33%)	4	NA	NA
WP_062173001.1|577466_579611_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	35.5	2.0e-72
WP_062173002.1|579607_580063_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	61.3	1.9e-44
WP_062173003.1|580628_582284_+	L-lactate permease	NA	NA	NA	NA	NA
WP_062173004.1|582474_584319_+	translational GTPase TypA	NA	A0A2K9L6L3	Tupanvirus	36.5	1.3e-22
>prophage 44
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	587412	588042	1769679		Streptococcus_phage(100.0%)	1	NA	NA
WP_062173008.1|587412_588042_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	39.5	1.7e-35
>prophage 45
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	596381	597116	1769679		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_062173014.1|596381_597116_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.3	7.4e-19
>prophage 46
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	600971	674217	1769679	integrase,transposase	Streptococcus_phage(23.81%)	68	603118:603134	668616:668632
WP_062171995.1|600971_602348_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	34.8	1.4e-55
603118:603134	attL	GAAAATATTATAAATAT	NA	NA	NA	NA
WP_062173018.1|603858_604629_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_062173019.1|604638_605088_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_062173020.1|605683_606988_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_062173021.1|606999_607446_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_062173022.1|607693_609037_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	42.4	1.1e-97
WP_003042651.1|609033_609192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005541379.1|609198_609480_+	membrane protein	NA	NA	NA	NA	NA
WP_062173023.1|609567_610347_+	replication initiator protein A	NA	A0A2P0VK56	Streptococcus_phage	35.6	1.0e-13
WP_062173024.1|610343_611195_+	ATP-binding protein	NA	H7BWC4	unidentified_phage	35.1	4.3e-34
WP_062173025.1|611191_611677_+	PcfB family protein	NA	NA	NA	NA	NA
WP_062173026.1|611673_612243_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_062173027.1|612284_613940_+	DUF4368 domain-containing protein	NA	D0R0F3	Streptococcus_phage	26.9	6.6e-23
WP_002694906.1|614037_614250_+	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	42.6	5.8e-09
WP_009525604.1|614263_615118_+	DNA adenine methylase	NA	A0A1S5PRR3	Streptococcus_phage	47.9	6.7e-72
WP_040012695.1|615110_616415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014262136.1|616522_616843_+	DUF3847 domain-containing protein	NA	NA	NA	NA	NA
WP_062173028.1|617080_618541_+	conjugal transfer protein TraA	NA	NA	NA	NA	NA
WP_006627246.1|618602_619022_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_006627245.1|619037_619652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006627244.1|619759_619924_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_062173029.1|619998_620460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062173030.1|620500_622348_+	DUF4368 domain-containing protein	NA	D2XR37	Bacillus_phage	27.8	9.9e-20
WP_062173031.1|622396_622768_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062173032.1|622873_623287_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_062173033.1|623472_623889_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_062173034.1|623974_624343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062173035.1|624661_626302_+	MobA/MobL protein	NA	NA	NA	NA	NA
WP_062173036.1|626510_627242_+	hypothetical protein	NA	A0A0S2MYA8	Enterococcus_phage	59.8	2.9e-39
WP_009218609.1|627466_627913_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_062173037.1|627944_628430_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009529888.1|628545_628731_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_062173038.1|629712_630024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072520163.1|630027_630186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062173039.1|630312_630525_+	helix-turn-helix domain-containing protein	NA	A0A2K5B261	Erysipelothrix_phage	40.0	4.2e-07
WP_062173040.1|631724_632204_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_062173041.1|632242_632680_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_062173042.1|633280_633898_+	phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_062173043.1|634147_634486_+|transposase	IS200/IS605 family transposase	transposase	W0UUZ0	Sulfolobus_monocaudavirus	35.6	4.0e-12
WP_062173044.1|634718_635456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062173045.1|635762_636464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062173046.1|636986_638009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062173049.1|639841_641320_+	Lsa family ABC-F type ribosomal protection protein	NA	A0A2K9L0W2	Tupanvirus	26.5	7.4e-26
WP_156439982.1|641445_641589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072520166.1|643892_644039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062173051.1|644228_645134_+	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_062173052.1|645456_646512_+	acyltransferase	NA	NA	NA	NA	NA
WP_062173053.1|646873_647386_+|transposase	transposase	transposase	A0A146ICT8	Staphylococcus_phage	41.2	2.5e-21
WP_062173054.1|648140_648518_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_062173055.1|648702_648993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062173056.1|649634_650225_+	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_114889632.1|650225_650921_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_062173057.1|650931_652398_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	26.2	4.5e-23
WP_062173058.1|652409_653903_+	carboxylesterase family protein	NA	NA	NA	NA	NA
WP_062173059.1|655229_656270_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_062173060.1|656645_657212_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062173061.1|657350_660320_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_062173062.1|660551_662300_+	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	30.7	2.7e-27
WP_062173063.1|662259_664008_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	8.5e-29
WP_062173064.1|664418_665795_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	34.5	9.3e-55
WP_062174685.1|665945_666929_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A8RHK4	Spiroplasma_virus	31.8	3.6e-08
WP_062173065.1|667115_668048_+	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	45.0	2.7e-66
WP_062173066.1|668132_668759_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
668616:668632	attR	ATATTTATAATATTTTC	NA	NA	NA	NA
WP_062173067.1|668758_669856_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_062173068.1|670082_670607_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_062173069.1|670782_671664_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	32.4	9.8e-26
WP_062173070.1|671680_672970_+	dihydroorotase	NA	NA	NA	NA	NA
WP_062173071.1|673122_674217_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.0	6.0e-57
>prophage 47
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	679910	683007	1769679		Pandoravirus(50.0%)	3	NA	NA
WP_062173076.1|679910_680525_+	orotate phosphoribosyltransferase	NA	S4W4D9	Pandoravirus	36.6	1.7e-24
WP_082729147.1|680708_681260_+	signal peptidase I	NA	NA	NA	NA	NA
WP_062173077.1|681405_683007_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.3	1.0e-145
>prophage 48
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	690572	695471	1769679		Staphylococcus_phage(50.0%)	3	NA	NA
WP_062173087.1|690572_690938_+	single-stranded DNA-binding protein	NA	A0A1P8L6D9	Staphylococcus_phage	42.0	1.0e-16
WP_062173088.1|691618_693109_+	amino acid permease	NA	NA	NA	NA	NA
WP_062173089.1|693290_695471_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1S6KV06	Providencia_phage	31.0	4.6e-08
>prophage 49
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	699040	701151	1769679	transposase	Klosneuvirus(50.0%)	2	NA	NA
WP_062173095.1|699040_699646_+	ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	24.7	1.2e-06
WP_062173096.1|699774_701151_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	34.3	4.6e-54
>prophage 50
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	710658	715982	1769679	integrase,transposase	Thermobifida_phage(33.33%)	4	714721:714746	716081:716106
WP_062173100.1|710658_711519_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.4	7.7e-07
WP_062173101.1|711523_712507_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	38.7	2.9e-58
WP_062173102.1|712528_713878_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
714721:714746	attL	GTGAGACAAAAAAAGTATAAATAAAA	NA	NA	NA	NA
WP_062174691.1|714998_715982_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A8RHK4	Spiroplasma_virus	31.2	1.8e-07
WP_062174691.1|714998_715982_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A8RHK4	Spiroplasma_virus	31.2	1.8e-07
716081:716106	attR	GTGAGACAAAAAAAGTATAAATAAAA	NA	NA	NA	NA
>prophage 51
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	723182	723971	1769679		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_062174694.1|723182_723971_+	ribonuclease HII	NA	A0A0N9QYD4	Chrysochromulina_ericina_virus	41.3	2.3e-26
>prophage 52
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	729761	731138	1769679	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_062173096.1|729761_731138_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	34.3	4.6e-54
>prophage 53
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	736470	741021	1769679	tRNA	uncultured_Mediterranean_phage(33.33%)	5	NA	NA
WP_062173120.1|736470_737625_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.9	2.7e-84
WP_062173121.1|737703_737967_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_062173122.1|738039_738510_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_062173123.1|738645_739863_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	54.4	5.4e-107
WP_062173124.1|740070_741021_+	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.8	1.8e-41
>prophage 54
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	748154	749402	1769679		Bacillus_phage(100.0%)	1	NA	NA
WP_062173130.1|748154_749402_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	46.7	1.0e-89
>prophage 55
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	756229	758445	1769679		Klosneuvirus(100.0%)	2	NA	NA
WP_062173139.1|756229_757561_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	30.6	7.3e-49
WP_062173140.1|757560_758445_+	deoxyribonuclease IV	NA	A0A1V0SHV6	Klosneuvirus	28.4	3.2e-24
>prophage 56
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	763168	770121	1769679	integrase,tRNA,transposase	Pyramimonas_orientalis_virus(33.33%)	4	768300:768315	777517:777532
WP_062173144.1|763168_765841_+	DNA mismatch repair protein MutS	NA	F2QAF7	Pyramimonas_orientalis_virus	24.8	1.9e-43
WP_062173145.1|765845_767819_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.5	2.3e-62
WP_062173146.1|767828_768725_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
768300:768315	attL	TATGCAATATCAGAAA	NA	NA	NA	NA
WP_062174673.1|769137_770121_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A8RHK4	Spiroplasma_virus	31.2	7.9e-08
WP_062174673.1|769137_770121_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A8RHK4	Spiroplasma_virus	31.2	7.9e-08
777517:777532	attR	TATGCAATATCAGAAA	NA	NA	NA	NA
>prophage 57
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	777866	783453	1769679		Brevibacillus_phage(33.33%)	5	NA	NA
WP_062173149.1|777866_778751_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	33.2	4.0e-27
WP_062173150.1|778924_779710_+	RecX family transcriptional regulator	NA	NA	NA	NA	NA
WP_062173151.1|779723_781541_+	elongation factor 4	NA	A0A1B0RXH7	Streptococcus_phage	25.3	6.1e-22
WP_062173152.1|781540_782674_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_062173153.1|782742_783453_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	34.6	3.7e-23
>prophage 58
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	799400	808735	1769679	tRNA,transposase	Orpheovirus(25.0%)	8	NA	NA
WP_062173163.1|799400_802130_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	27.7	2.8e-95
WP_062173164.1|802948_803242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062173165.1|803213_803447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062173166.1|803546_803732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062173167.1|803969_804179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062173168.1|804755_804950_+	hypothetical protein	NA	S4TZT2	uncultured_phage	73.2	3.4e-16
WP_062173169.1|805554_806850_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	28.2	1.6e-32
WP_062173170.1|807433_808735_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	5.5e-41
>prophage 59
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	811796	819899	1769679		Streptococcus_phage(33.33%)	5	NA	NA
WP_062173173.1|811796_813362_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.7	1.4e-38
WP_062173174.1|813512_813944_+	GtrA family protein	NA	NA	NA	NA	NA
WP_062173175.1|813948_814794_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_062173178.1|816338_818633_+	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.7	8.8e-18
WP_082729118.1|818747_819899_-	NADH peroxidase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.4	1.2e-07
>prophage 60
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	826394	829358	1769679		Indivirus(100.0%)	2	NA	NA
WP_062173185.1|826394_827156_+	type I methionyl aminopeptidase	NA	A0A1V0SDD9	Indivirus	29.3	3.4e-06
WP_062173186.1|827306_829358_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	36.4	2.5e-96
>prophage 61
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	834746	838070	1769679		Streptococcus_phage(100.0%)	4	NA	NA
WP_062173191.1|834746_835376_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	45.0	3.1e-42
WP_062173192.1|836205_836937_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_062174700.1|836929_837274_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_062173193.1|837236_838070_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.5	6.2e-54
>prophage 62
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	841507	844397	1769679		Helicobacter_phage(50.0%)	2	NA	NA
WP_062173197.1|841507_843301_+	DNA primase	NA	A0A1S5RF89	Helicobacter_phage	29.5	2.7e-38
WP_062173198.1|843311_844397_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	37.1	1.2e-36
>prophage 63
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	850223	850844	1769679		Murmansk_poxvirus(100.0%)	1	NA	NA
WP_021752691.1|850223_850844_+	guanylate kinase	NA	A0A223FN12	Murmansk_poxvirus	29.9	3.1e-18
>prophage 64
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	861558	863214	1769679		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_062173213.1|861558_863214_-	fibronectin/fibrinogen-binding protein	NA	A0A1J0F9J4	Only_Syngen_Nebraska_virus	42.9	3.2e-09
>prophage 65
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	869125	869860	1769679		Planktothrix_phage(100.0%)	1	NA	NA
WP_062173229.1|869125_869860_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	7.7e-24
>prophage 66
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	876799	895820	1769679	transposase	Streptococcus_phage(36.36%)	20	NA	NA
WP_082729121.1|876799_877084_+	winged helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	51.1	1.3e-11
WP_062174710.1|877142_878966_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.2	2.1e-99
WP_062173248.1|879089_880100_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003144688.1|880300_880573_+	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	66.7	3.7e-24
WP_062173249.1|880730_881291_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	47.0	5.1e-36
WP_021752615.1|881303_881507_+	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_062173251.1|881777_883889_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.4	1.5e-40
WP_062173253.1|884064_885102_+	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_062173096.1|885213_886590_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	34.3	4.6e-54
WP_062173255.1|886967_887348_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062173257.1|887369_887762_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_062173258.1|887877_888621_+	SDR family oxidoreductase	NA	A0A2P0VP75	Tetraselmis_virus	32.5	7.5e-11
WP_062173260.1|888671_889220_-	VanZ family protein	NA	NA	NA	NA	NA
WP_062173262.1|889632_890946_+	amino acid permease	NA	NA	NA	NA	NA
WP_082729122.1|890986_892111_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	30.8	1.9e-37
WP_062173264.1|892342_893119_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_021752603.1|893136_893526_+	transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_082729123.1|893538_894471_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	67.7	6.8e-126
WP_062173267.1|894485_894980_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	38.7	8.5e-27
WP_062173270.1|894980_895820_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.9	1.3e-14
>prophage 67
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	900951	909087	1769679		Methanothermobacter_phage(25.0%)	5	NA	NA
WP_062173284.1|900951_902118_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	4.5e-42
WP_062173286.1|902181_904533_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_062173288.1|904705_905161_-	nucleoside 2-deoxyribosyltransferase	NA	Q2WG40	Clostridium_botulinum_D_phage	35.8	7.3e-17
WP_062173290.1|905605_907351_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.7	6.5e-45
WP_062173292.1|907350_909087_+	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	27.1	3.8e-21
>prophage 68
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	916802	924672	1769679	integrase,tRNA,transposase	Klosneuvirus(25.0%)	7	920127:920152	921487:921512
WP_062173310.1|916802_918401_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	28.1	7.7e-53
WP_062173312.1|918681_920055_+|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	30.8	3.1e-50
920127:920152	attL	ATTTAATTTAAGATAAAATTATTATT	NA	NA	NA	NA
WP_062174720.1|920404_921388_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A8RHK4	Spiroplasma_virus	31.8	3.6e-08
WP_062173314.1|921609_922284_+	(d)CMP kinase	NA	NA	NA	NA	NA
921487:921512	attR	ATTTAATTTAAGATAAAATTATTATT	NA	NA	NA	NA
WP_062173316.1|922297_922885_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_062173317.1|922886_923312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062173318.1|923523_924672_+	cysteine desulfurase	NA	H7BUW1	unidentified_phage	34.9	7.3e-21
>prophage 69
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	932043	932682	1769679		Bacillus_virus(100.0%)	1	NA	NA
WP_062173324.1|932043_932682_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.8	3.0e-24
>prophage 70
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	936777	938775	1769679		Sulfolobus_islandicus_filamentous_virus(100.0%)	1	NA	NA
WP_062173331.1|936777_938775_-	excinuclease ABC subunit UvrB	NA	A0A1D8BJ75	Sulfolobus_islandicus_filamentous_virus	30.7	3.4e-05
>prophage 71
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	960754	973484	1769679	integrase,transposase	Bacillus_phage(16.67%)	12	951608:951623	975013:975028
951608:951623	attL	AAATTATTTCAAAAAA	NA	NA	NA	NA
WP_062173366.1|960754_962470_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	25.7	1.4e-28
WP_062174722.1|962459_964202_+	thiol reductant ABC exporter subunit CydC	NA	A0A1V0SE00	Indivirus	35.4	3.7e-24
WP_062173368.1|964897_965347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062173370.1|965506_965968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062171958.1|966224_966689_+|transposase	IS200/IS605 family transposase	transposase	W0UUZ0	Sulfolobus_monocaudavirus	40.8	1.4e-18
WP_062173373.1|966932_968180_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_062174724.1|968361_969345_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A8RHK4	Spiroplasma_virus	31.2	1.0e-07
WP_003145327.1|969923_970169_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_062173375.1|970281_970860_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	44.0	2.2e-34
WP_062173377.1|970873_971962_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_062173379.1|971961_972801_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_062173382.1|972854_973484_-	helix-turn-helix domain-containing protein	NA	A0A139ZPI6	Marinitoga_camini_virus	31.7	5.8e-20
975013:975028	attR	AAATTATTTCAAAAAA	NA	NA	NA	NA
>prophage 72
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	981480	1010797	1769679	transposase	Synechococcus_phage(14.29%)	22	NA	NA
WP_062173391.1|981480_982029_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	41.0	2.9e-07
WP_062173393.1|982039_982771_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_021752818.1|982793_983510_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.8	7.2e-35
WP_062173395.1|983524_984826_+	Mur ligase family protein	NA	NA	NA	NA	NA
WP_062173397.1|984827_985556_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_062171995.1|985709_987086_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	34.8	1.4e-55
WP_062173399.1|987873_988350_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	2.8e-19
WP_062173401.1|988346_989393_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_062173403.1|989382_993057_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	30.3	3.4e-27
WP_062173405.1|993058_993766_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	40.7	6.0e-42
WP_062173407.1|993752_995219_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.4	2.2e-46
WP_062173409.1|995202_996207_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	42.1	5.7e-62
WP_062173411.1|996203_996767_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	36.9	3.1e-25
WP_062173413.1|996763_998284_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.8	6.8e-67
WP_062173415.1|998286_999522_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_062173417.1|999642_1000947_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	30.9	3.8e-18
WP_062173419.1|1003130_1004417_+	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	35.4	1.5e-67
WP_062173421.1|1004533_1005385_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_062173422.1|1005481_1006513_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_062173424.1|1006679_1009259_+	AAA domain-containing protein	NA	A0A223W0B1	Agrobacterium_phage	36.7	3.1e-120
WP_062173426.1|1009479_1010139_+	glutamate racemase	NA	NA	NA	NA	NA
WP_021752837.1|1010284_1010797_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.1	4.4e-26
>prophage 73
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1021791	1024820	1769679		Mycobacterium_phage(33.33%)	3	NA	NA
WP_062174734.1|1021791_1023819_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.1	2.3e-86
WP_062173444.1|1024009_1024246_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	38.8	4.6e-07
WP_062173446.1|1024235_1024820_-	XTP/dITP diphosphatase	NA	A0A0N9Z738	Cassava_brown_streak_virus	31.6	2.6e-14
>prophage 74
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1030586	1043519	1769679		Bacillus_phage(75.0%)	7	NA	NA
WP_062173465.1|1030586_1032854_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.9	9.8e-78
WP_062173467.1|1032869_1033160_-	LapA family protein	NA	NA	NA	NA	NA
WP_062173469.1|1035153_1037337_-	AAA family ATPase	NA	A7KV33	Bacillus_phage	39.4	1.1e-113
WP_062173470.1|1037568_1038696_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.5	1.5e-111
WP_062173473.1|1038711_1039626_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_062174737.1|1039734_1041480_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_062173475.1|1041671_1043519_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	S4VR00	Pandoravirus	29.0	3.1e-21
>prophage 75
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1051965	1052430	1769679		Bacillus_phage(100.0%)	1	NA	NA
WP_062173497.1|1051965_1052430_-	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	54.0	1.2e-33
>prophage 76
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1058626	1066084	1769679		uncultured_virus(33.33%)	7	NA	NA
WP_062173513.1|1058626_1059625_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	2.6e-06
WP_062173515.1|1059634_1060210_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_062173517.1|1060289_1060742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062173519.1|1061260_1062367_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_062173521.1|1062368_1063346_+	alpha-ketoacid dehydrogenase subunit beta	NA	E3SJ83	Synechococcus_phage	26.2	2.7e-08
WP_072520502.1|1063367_1064672_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_062173525.1|1064674_1066084_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	30.2	9.8e-52
>prophage 77
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1072371	1074699	1769679		Virus_Rctr197k(100.0%)	1	NA	NA
WP_062173539.1|1072371_1074699_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	26.5	5.2e-34
>prophage 78
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1080009	1084498	1769679	tRNA	Megavirus(33.33%)	3	NA	NA
WP_062173551.1|1080009_1081296_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EJK5	Megavirus	28.9	3.6e-53
WP_062173553.1|1081438_1083286_-	DNA polymerase III subunit epsilon	NA	A0A1X9I5C8	Streptococcus_phage	35.7	3.2e-18
WP_062173555.1|1083328_1084498_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	49.3	5.8e-42
>prophage 79
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1088732	1096815	1769679	protease	Mycobacterium_phage(20.0%)	7	NA	NA
WP_062173562.1|1088732_1089167_-	SUF system NifU family Fe-S cluster assembly protein	NA	V5R992	Mycobacterium_phage	35.4	8.9e-12
WP_062173564.1|1089156_1090386_-	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.3	1.3e-95
WP_062173566.1|1090392_1091688_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_062173568.1|1091689_1092430_-	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FG22	Brazilian_cedratvirus	27.6	1.9e-09
WP_062173570.1|1092688_1093282_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_062173573.1|1093283_1095581_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	39.7	3.6e-144
WP_062173574.1|1095603_1096815_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.5	2.6e-130
>prophage 80
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1103618	1116348	1769679	transposase	Bacillus_phage(50.0%)	10	NA	NA
WP_062173582.1|1103618_1104074_-|transposase	IS200/IS605 family transposase	transposase	W0UUZ0	Sulfolobus_monocaudavirus	41.2	1.9e-17
WP_062173583.1|1104105_1105197_-	ORF6N domain-containing protein	NA	NA	NA	NA	NA
WP_062173584.1|1105135_1106680_-	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	28.0	2.7e-18
WP_062173586.1|1106681_1108364_-	recombinase family protein	NA	Q3HKZ2	Bacillus_phage	24.7	3.8e-26
WP_062173588.1|1108364_1110035_-	DUF4368 domain-containing protein	NA	E4ZFN8	Streptococcus_phage	26.0	6.4e-26
WP_062174740.1|1110176_1110407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006267676.1|1110870_1111281_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_062173589.1|1111520_1112870_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_062173591.1|1112886_1114605_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.5	8.6e-34
WP_062173593.1|1114614_1116348_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.3	1.8e-31
>prophage 81
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1119525	1121095	1769679		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_021676601.1|1119525_1120314_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.2	2.1e-11
WP_062173597.1|1120315_1121095_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	36.4	1.1e-07
>prophage 82
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1127183	1144205	1769679		Streptococcus_phage(75.0%)	7	NA	NA
WP_062173608.1|1127183_1136318_-	helicase	NA	A0A248SL14	Klebsiella_phage	36.2	2.8e-272
WP_062173610.1|1136378_1138091_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	36.4	4.4e-38
WP_062173612.1|1138187_1139063_-	DUF4366 domain-containing protein	NA	NA	NA	NA	NA
WP_062173614.1|1139040_1139277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062173616.1|1139298_1141470_-	cell wall hydrolase	NA	A0A1S5SEZ8	Streptococcus_phage	48.1	8.9e-28
WP_062173618.1|1141474_1143904_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_062173620.1|1143815_1144205_-	PrgI family protein	NA	E4ZFJ8	Streptococcus_phage	77.4	7.6e-47
>prophage 83
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1148341	1155815	1769679		Bacillus_virus(50.0%)	6	NA	NA
WP_062173626.1|1148341_1149073_-	phage antirepressor KilAC domain-containing protein	NA	M1PKL6	Streptococcus_phage	43.8	3.8e-47
WP_062173628.1|1149069_1149555_-	PcfB family protein	NA	NA	NA	NA	NA
WP_062173630.1|1149557_1150586_-	hypothetical protein	NA	A0A1W6JNI1	Staphylococcus_phage	56.4	4.8e-24
WP_041954212.1|1150675_1150960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062173631.1|1151434_1153882_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	36.5	9.2e-122
WP_062173633.1|1153898_1155815_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.5	6.5e-139
>prophage 84
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1159113	1172635	1769679		Agrobacterium_phage(20.0%)	10	NA	NA
WP_021752744.1|1159113_1159641_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	1.2e-10
WP_062173643.1|1159874_1163555_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	23.8	7.9e-61
WP_062173645.1|1163623_1167421_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.0	9.4e-49
WP_062173646.1|1167571_1168168_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_021752740.1|1168323_1168686_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_062173648.1|1168726_1169227_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_062173650.1|1169490_1170225_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062173652.1|1170408_1170936_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	36.8	1.7e-09
WP_062173654.1|1171296_1171539_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_062173656.1|1171786_1172635_-	bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/5,10-methylene-tetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	41.7	8.6e-35
>prophage 85
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1175652	1178542	1769679	tRNA	Tupanvirus(50.0%)	3	NA	NA
WP_062173664.1|1175652_1176678_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	35.3	6.9e-31
WP_062173666.1|1177110_1177581_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_062173668.1|1177621_1178542_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	48.9	2.7e-82
>prophage 86
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1187366	1187996	1769679		Planktothrix_phage(100.0%)	1	NA	NA
WP_062173686.1|1187366_1187996_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	2.2e-27
>prophage 87
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1191075	1262798	1769679	integrase,holin,capsid,portal,tRNA,tail,transposase,terminase	Streptococcus_phage(46.34%)	93	1199398:1199422	1200757:1200781
WP_062174742.1|1191075_1192227_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.5	4.0e-35
WP_062173690.1|1192528_1192672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062173692.1|1192699_1193287_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_062173695.1|1193312_1194173_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_062173697.1|1194165_1194366_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_062173699.1|1194366_1195626_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	27.9	2.8e-42
WP_062173701.1|1195637_1196033_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_062173702.1|1196044_1196350_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_062173704.1|1196479_1199104_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	35.1	5.9e-66
1199398:1199422	attL	TTTATTTTGAATTTCTAATTTCCAT	NA	NA	NA	NA
WP_062174743.1|1199520_1200504_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A8RHK4	Spiroplasma_virus	31.2	7.9e-08
WP_062173706.1|1200757_1201129_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
1200757:1200781	attR	TTTATTTTGAATTTCTAATTTCCAT	NA	NA	NA	NA
WP_062173708.1|1201118_1203095_-	transketolase	NA	NA	NA	NA	NA
WP_062173710.1|1203111_1203708_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_062173712.1|1203712_1204030_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_062173714.1|1204135_1205800_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	43.4	1.1e-54
WP_062173717.1|1206005_1206725_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	2.9e-31
WP_062173718.1|1206734_1207376_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_062173721.1|1207394_1208216_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_062173723.1|1208667_1209252_-	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_062173726.1|1209264_1210668_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	22.2	1.5e-20
WP_062173728.1|1210654_1211344_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_062173730.1|1211481_1213821_-	endonuclease MutS2	NA	F2Y0V3	Organic_Lake_phycodnavirus	21.8	1.8e-13
WP_062173732.1|1214343_1214877_-	CvpA family protein	NA	NA	NA	NA	NA
WP_062173734.1|1214969_1216616_-	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_062173736.1|1216627_1216987_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_062173738.1|1217201_1218134_-	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_062173739.1|1218415_1219462_-	PTS transporter subunit IIC	NA	NA	NA	NA	NA
WP_062174745.1|1219615_1220524_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_062173742.1|1220525_1220783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062173744.1|1220926_1221127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062173751.1|1221593_1221875_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_062174747.1|1221864_1222308_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_040460736.1|1222282_1222561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062173753.1|1222727_1223492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062173755.1|1223613_1224444_-	Rha family transcriptional regulator	NA	A0A0E3Y6H2	Fusobacterium_phage	38.2	3.3e-23
WP_062173757.1|1224552_1224732_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_156439984.1|1224803_1224959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062173759.1|1225157_1225334_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_021753567.1|1225442_1226288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062173761.1|1226429_1227179_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	NA	NA	NA	NA
WP_062173763.1|1227352_1228084_-	CHAP domain-containing protein	NA	F8HGP2	Streptococcus_phage	61.5	2.3e-76
WP_021753571.1|1228129_1228648_-	hypothetical protein	NA	M1Q0Z8	Streptococcus_phage	39.3	6.2e-28
WP_062174749.1|1228944_1229163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021753573.1|1229202_1229592_-|holin	phage holin family protein	holin	A0A097BY69	Enterococcus_phage	36.6	2.3e-11
WP_062173766.1|1229597_1229846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062173768.1|1229845_1230271_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	44.7	1.1e-22
WP_062173770.1|1230274_1231231_-|tail	tail fiber domain-containing protein	tail	C5J973	Streptococcus_phage	35.4	5.0e-31
WP_062173772.1|1231501_1232626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082729128.1|1232988_1234272_-	hypothetical protein	NA	Q938K1	Temperate_phage	40.1	1.8e-76
WP_062173776.1|1234253_1234979_-	hypothetical protein	NA	A0A2H4JGR0	uncultured_Caudovirales_phage	34.6	2.5e-35
WP_062173778.1|1234975_1238515_-	tape measure protein	NA	C5IUK3	Streptococcus_phage	46.8	4.9e-100
WP_062173780.1|1238541_1239111_-	hypothetical protein	NA	A0A1S5SAD5	Streptococcus_phage	52.1	2.2e-47
WP_062173782.1|1239113_1239473_-	hypothetical protein	NA	A0A286QNZ4	Streptococcus_phage	36.7	7.3e-12
WP_062173784.1|1239490_1239946_-	hypothetical protein	NA	A0A1P8VVM4	Streptococcus_phage	58.9	1.1e-44
WP_062173786.1|1239948_1240350_-|capsid	capsid protein	capsid	M1I9U2	Streptococcus_phage	56.0	1.9e-37
WP_062173788.1|1240346_1240691_-|capsid	capsid protein	capsid	A0A1P8VVL8	Streptococcus_phage	45.4	3.7e-21
WP_062173790.1|1240690_1241029_-	hypothetical protein	NA	A0A0M3ULI3	Streptococcus_phage	51.8	8.1e-21
WP_062173792.1|1241018_1241408_-	hypothetical protein	NA	C5IUJ7	Streptococcus_phage	50.4	2.9e-30
WP_062173795.1|1241409_1241640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062173796.1|1241650_1242529_-	hypothetical protein	NA	A0A1P8VVM7	Streptococcus_phage	67.1	4.2e-109
WP_062173798.1|1242547_1243111_-	scaffolding protein	NA	A0A2H4JBH4	uncultured_Caudovirales_phage	44.8	1.2e-32
WP_062173800.1|1243335_1244874_-	hypothetical protein	NA	B3GW01	Streptococcus_phage	48.6	1.1e-93
WP_062173802.1|1244857_1246354_-|portal	phage portal protein	portal	M1IFC5	Streptococcus_phage	63.1	6.7e-184
WP_062173804.1|1246362_1247667_-|terminase	PBSX family phage terminase large subunit	terminase	A0A286QNX6	Streptococcus_phage	72.3	3.5e-189
WP_082729129.1|1247659_1248085_-|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	60.1	7.8e-37
WP_062173808.1|1248247_1248628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062173809.1|1248663_1248942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062173811.1|1248958_1249531_-	hypothetical protein	NA	A0A060AGD9	Listeria_phage	52.5	1.2e-43
WP_156439985.1|1249539_1249710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062173813.1|1249725_1250019_-	helix-turn-helix transcriptional regulator	NA	D2XR39	Bacillus_phage	40.3	1.7e-06
WP_062173814.1|1250011_1250425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062173816.1|1250424_1250868_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A097BY81	Enterococcus_phage	43.8	4.8e-21
WP_062173818.1|1250869_1251586_-	oxidoreductase	NA	M1PS05	Streptococcus_phage	68.5	1.1e-88
WP_062173820.1|1251599_1252835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062173822.1|1252838_1253408_-	single-stranded DNA-binding protein	NA	A0A240FHW1	Streptococcus_phage	54.6	4.9e-26
WP_062173824.1|1253400_1253973_-	Dna2/Cas4 domain-containing protein	NA	NA	NA	NA	NA
WP_062173825.1|1253947_1254223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062173827.1|1254189_1254753_-	hypothetical protein	NA	A0A0A7RVW0	Clostridium_phage	39.3	4.0e-12
WP_062173829.1|1254786_1255215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062173831.1|1255189_1255573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062173833.1|1255652_1256162_-	hypothetical protein	NA	A0A0E3XBR0	Staphylococcus_phage	33.7	7.7e-15
WP_062173835.1|1256161_1256350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062173837.1|1256600_1256999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062173839.1|1256995_1257379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062173841.1|1257572_1258172_+	hypothetical protein	NA	A0A097PAT4	Streptococcus_pyogenes_phage	40.6	1.5e-22
WP_062173843.1|1258248_1258446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082729130.1|1258485_1258620_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_082729131.1|1258765_1258909_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_156439986.1|1258874_1259030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082729151.1|1259108_1259297_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_040461279.1|1259458_1260100_+	helix-turn-helix domain-containing protein	NA	A0A1J0MG99	Staphylococcus_phage	37.3	1.5e-31
WP_062173845.1|1260130_1260943_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q4ZE81	Staphylococcus_phage	28.2	1.6e-17
WP_062173848.1|1261385_1262798_+	recombinase family protein	NA	A8R7E9	Staphylococcus_phage	32.8	6.8e-61
>prophage 88
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1266791	1269617	1769679		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_062173856.1|1266791_1269617_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.8	5.0e-297
>prophage 89
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1272750	1275394	1769679		Bacillus_virus(50.0%)	3	NA	NA
WP_062173864.1|1272750_1273842_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.9	7.9e-33
WP_062173866.1|1273854_1274400_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_062173868.1|1274620_1275394_-	TerC family protein	NA	S5MAL1	Bacillus_phage	39.8	3.7e-29
>prophage 90
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1280186	1281251	1769679		Synechococcus_phage(100.0%)	1	NA	NA
WP_062173878.1|1280186_1281251_-	NAD(P)-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.3	7.0e-10
>prophage 91
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1287655	1292382	1769679	tRNA	unidentified_phage(33.33%)	6	NA	NA
WP_062173894.1|1287655_1288780_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	35.5	4.9e-22
WP_062173895.1|1288940_1289963_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.7	1.3e-61
WP_062173897.1|1289949_1290402_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_062173899.1|1290385_1291063_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_062173901.1|1291050_1291512_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_062173903.1|1291821_1292382_+	thermonuclease	NA	O64020	Bacillus_phage	52.4	8.7e-28
>prophage 92
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1295742	1300568	1769679		Mycoplasma_phage(50.0%)	4	NA	NA
WP_082729153.1|1295742_1297167_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.7	6.9e-53
WP_062173911.1|1297200_1298601_-	protoporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_062173913.1|1298614_1299832_-	ABC transporter	NA	NA	NA	NA	NA
WP_062173914.1|1299824_1300568_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.9	1.4e-25
>prophage 93
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1307101	1313417	1769679		uncultured_virus(40.0%)	7	NA	NA
WP_062173929.1|1307101_1307407_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	42.2	1.4e-19
WP_062173931.1|1307489_1309094_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.3	6.4e-156
WP_062173933.1|1309106_1309385_-	co-chaperone GroES	NA	A0A221S3X0	uncultured_virus	32.3	2.1e-06
WP_021752661.1|1309630_1310017_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062173935.1|1310061_1311387_+	type I glutamate--ammonia ligase	NA	A0A2P1EM84	Moumouvirus	25.2	1.2e-11
WP_021752663.1|1311551_1312418_-	class II fructose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_062173937.1|1312517_1313417_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.8	4.1e-11
>prophage 94
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1317561	1374689	1769679	protease,integrase,transposase	Streptococcus_phage(28.57%)	50	1317439:1317463	1318797:1318821
1317439:1317463	attL	AATTACACTTTTTACATGATAAACT	NA	NA	NA	NA
WP_062174751.1|1317561_1318545_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A8RHK4	Spiroplasma_virus	31.2	1.0e-07
WP_062173951.1|1319461_1320508_+	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
1318797:1318821	attR	AATTACACTTTTTACATGATAAACT	NA	NA	NA	NA
WP_062173954.1|1321300_1322011_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SGN0	Hokovirus	28.1	2.6e-08
WP_062173956.1|1322003_1322798_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_062173958.1|1322911_1323847_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_062173960.1|1324372_1325722_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_062173963.1|1326085_1326970_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_021752950.1|1327121_1328675_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_062173965.1|1329074_1329500_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_062173966.1|1329513_1330206_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_062173967.1|1330329_1331193_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.5	1.8e-35
WP_062173968.1|1331387_1332020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062173970.1|1332711_1333104_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062173972.1|1333224_1333908_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_021752943.1|1334175_1334517_+	alkylhydroperoxidase AhpD family core domain protein	NA	NA	NA	NA	NA
WP_062173974.1|1334523_1335471_+	radical SAM/Cys-rich domain protein	NA	NA	NA	NA	NA
WP_062173096.1|1335651_1337028_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	34.3	4.6e-54
WP_062173976.1|1337213_1337444_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_062173978.1|1337446_1338433_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_062173981.1|1338425_1339061_-	class A sortase	NA	NA	NA	NA	NA
WP_062173983.1|1339072_1341085_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_021752937.1|1341077_1341950_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_062173985.1|1341961_1342630_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_062173987.1|1342633_1344304_-	ribonuclease J	NA	R9ZY20	Cellulophaga_phage	28.1	6.3e-05
WP_062173990.1|1344296_1344515_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_062173993.1|1344514_1346089_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_062173994.1|1346357_1347548_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_062173996.1|1347585_1347951_-	iron-sulfur cluster assembly accessory protein	NA	NA	NA	NA	NA
WP_062173998.1|1348091_1348346_+	NifU family protein	NA	NA	NA	NA	NA
WP_062174000.1|1348446_1349508_-	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_021752928.1|1349509_1349785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062174002.1|1349795_1350668_-	2-oxoacid:ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_062174004.1|1350669_1352415_-	2-oxoacid:acceptor oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_062174006.1|1352682_1354488_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_062174007.1|1354872_1355337_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_062174009.1|1355576_1357034_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_062174011.1|1357033_1357279_-	DUF997 family protein	NA	NA	NA	NA	NA
WP_062174014.1|1357271_1357874_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_062174017.1|1357875_1358958_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_062174019.1|1358960_1359452_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	44.4	1.0e-27
WP_062174021.1|1359454_1360006_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_062174023.1|1360066_1360336_-	DUF2129 domain-containing protein	NA	NA	NA	NA	NA
WP_062174024.1|1360347_1362435_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_062174026.1|1362694_1365130_-	Cna B-type domain-containing protein	NA	NA	NA	NA	NA
WP_082729134.1|1365588_1365801_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_062174028.1|1365980_1367267_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.2e-09
WP_062174030.1|1367465_1371587_-	Cna B-type domain-containing protein	NA	NA	NA	NA	NA
WP_062174032.1|1372180_1373815_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_027130209.1|1374072_1374354_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_021752405.1|1374359_1374689_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
>prophage 95
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1378373	1392298	1769679	integrase,tRNA,transposase	Enterobacteria_phage(14.29%)	10	1384188:1384214	1385547:1385573
WP_062174034.1|1378373_1379654_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.7	3.6e-61
WP_062174035.1|1380055_1380394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062174037.1|1380584_1381049_-|transposase	IS200/IS605 family transposase	transposase	W0UUZ0	Sulfolobus_monocaudavirus	41.6	7.2e-20
WP_062174039.1|1381286_1381871_-	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	41.8	1.0e-23
WP_062174041.1|1381944_1383888_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.9	2.6e-111
1384188:1384214	attL	GTCTTTTAAAAATAATTTGTTAATTTT	NA	NA	NA	NA
WP_062174043.1|1384310_1385294_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A8RHK4	Spiroplasma_virus	31.2	1.0e-07
WP_062174045.1|1385594_1386857_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
1385547:1385573	attR	GTCTTTTAAAAATAATTTGTTAATTTT	NA	NA	NA	NA
WP_062174047.1|1386955_1388413_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.6	4.7e-57
WP_062174049.1|1390010_1390751_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_062171995.1|1390921_1392298_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	34.8	1.4e-55
>prophage 96
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1401749	1405127	1769679		Aureococcus_anophage(50.0%)	2	NA	NA
WP_021753309.1|1401749_1402937_-	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	26.4	1.4e-30
WP_062174069.1|1403045_1405127_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	6.3e-63
>prophage 97
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1410616	1425264	1769679	tRNA	Streptococcus_phage(28.57%)	13	NA	NA
WP_062174080.1|1410616_1411339_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.1	2.1e-26
WP_062174083.1|1412891_1413797_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	43.4	8.8e-62
WP_062174085.1|1413966_1414485_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_062174088.1|1414583_1415348_-	alpha/beta hydrolase	NA	A0A249XPN5	Mycobacterium_phage	33.0	2.1e-08
WP_062174090.1|1415491_1416742_+	peptidoglycan bridge formation glycyltransferase FemA/FemB family protein	NA	NA	NA	NA	NA
WP_062174092.1|1417032_1418208_-	AAA family ATPase	NA	A0A2K9VDE3	Lactobacillus_phage	40.9	3.2e-72
WP_062174094.1|1418499_1419378_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	30.3	3.0e-22
WP_062174096.1|1419549_1420947_+|tRNA	cysteine--tRNA ligase	tRNA	A0A161HRB7	Powai_lake_megavirus	30.5	1.5e-52
WP_062174098.1|1420931_1421363_+	mini-ribonuclease	NA	NA	NA	NA	NA
WP_062174100.1|1421346_1422156_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_062174102.1|1422167_1423052_+	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_062174105.1|1423085_1423613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062174107.1|1423911_1425264_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.7	4.8e-40
>prophage 98
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1431547	1435579	1769679		Staphylococcus_phage(50.0%)	3	NA	NA
WP_062174122.1|1431547_1432282_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	3.7e-18
WP_062174124.1|1432283_1432496_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_062174127.1|1432942_1435579_-	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	40.4	1.9e-93
>prophage 99
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1439412	1442052	1769679	tRNA	Catovirus(100.0%)	1	NA	NA
WP_062174137.1|1439412_1442052_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.8	7.5e-154
>prophage 100
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1452201	1464236	1769679	integrase,tRNA,transposase	Tupanvirus(40.0%)	12	1459586:1459610	1460944:1460968
WP_062174143.1|1452201_1453974_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	22.8	1.7e-13
WP_062174145.1|1453973_1455254_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	24.1	1.5e-22
WP_062174147.1|1455763_1456147_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_062174149.1|1456171_1457311_-	PLP-dependent transferase	NA	A0A0B5JD48	Pandoravirus	26.6	8.0e-12
WP_062174151.1|1457312_1457975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062174153.1|1458270_1458933_+	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_062174154.1|1459006_1459552_+	hypothetical protein	NA	NA	NA	NA	NA
1459586:1459610	attL	CCGGCTATATTTTCTATATAAGAAA	NA	NA	NA	NA
WP_062174156.1|1459861_1460845_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A8RHK4	Spiroplasma_virus	31.8	6.1e-08
WP_062174159.1|1461034_1461523_+	universal stress protein	NA	NA	NA	NA	NA
1460944:1460968	attR	CCGGCTATATTTTCTATATAAGAAA	NA	NA	NA	NA
WP_062174160.1|1461735_1462236_+	universal stress protein	NA	NA	NA	NA	NA
WP_062174162.1|1462336_1463566_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_021752481.1|1463549_1464236_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.3	1.3e-30
>prophage 101
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1469000	1469648	1769679		Enterococcus_phage(100.0%)	1	NA	NA
WP_062174170.1|1469000_1469648_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	53.1	5.9e-44
>prophage 102
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1475846	1476836	1769679		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_062174185.1|1475846_1476836_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	25.6	2.6e-11
>prophage 103
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1481116	1481872	1769679		Streptococcus_phage(100.0%)	1	NA	NA
WP_106388774.1|1481116_1481872_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	33.5	1.2e-24
>prophage 104
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1494967	1495693	1769679		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_062174212.1|1494967_1495693_-	rhodanese-like domain-containing protein	NA	E4WM79	Ostreococcus_tauri_virus	45.5	2.5e-06
>prophage 105
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1498896	1507038	1769679	integrase,transposase	Streptococcus_phage(25.0%)	7	1498934:1498993	1507136:1507908
WP_062174219.1|1498896_1499781_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.3	2.3e-35
1498934:1498993	attL	AGGGAGAATTCATTAAAAACCTACTACAAATAAAAGATAAAAATATAACTATTGAGAAAA	NA	NA	NA	NA
WP_156439976.1|1499791_1500274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062174221.1|1500543_1501698_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	29.0	5.4e-24
WP_062174224.1|1501771_1503595_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.4	1.5e-137
WP_062174226.1|1503738_1504302_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_062174756.1|1504315_1505332_-	heat-inducible transcription repressor HrcA	NA	NA	NA	NA	NA
WP_062174648.1|1506054_1507038_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A8RHK4	Spiroplasma_virus	31.2	1.0e-07
1507136:1507908	attR	AGGGAGAATTCATTAAAAACCTACTACAAATAAAAGATAAAAATATAACTATTGAGAAAACACATAACGAAACTATAAAAAATAATCAAAAGTACTTTGTATTCAAAGGTACCTTAACATATAAACCCAAGAAGTGTGAATGCTGTGGTTGTCTTAATAAAGGTTATACTGTAGTTAAAAACGGCTTTAATGAACTTACTAGAATTAATCTATTAAAAATATCAGGTATCCCTGCTTATTTGGAACTAAGAAAGCAACGTTTCAAGTGTAAAACTTGTAATAAAAAATTTGTAGCTACTACTTCTTTTGTAGATAAATACTGTAGTATTTCTAAAAATGTTAAGTTTTCTATAATGAGTGATTTAGCTGATACTTTATCTTTTAAACAAATAGCCAAAATGAATAATGTATCGGTTAATACTGTTATAAGAACTCTTTATAAATGTAAATCCCATGTAGACATTCTTAACTATAATACCTTACCTGAGTATTTATGCTTTGATGAGTTAAAGTTTACTAAAGATAGTAAAAATGGTATGAGTTTTATTTTTTTAGATGCTTTAACTCATGAGATTATTGATATAGTTGATGGTAGAACTGAGTATATTTTAAATAATTATTTTTCCAGATTTTCTAAAGAGGCTAGAAGTAATGTTAAGGCTATTTGTATTGATATTTATACTCCTTATATGAAGTTGATTAGAAATAAGTTTCCTAATGCTGAAATTGTTATAGATAGGTTTCATATTATTCAAAATGTTAATAGAGAACTT	NA	NA	NA	NA
>prophage 106
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1517529	1519251	1769679		Streptococcus_phage(100.0%)	1	NA	NA
WP_062174235.1|1517529_1519251_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	42.8	5.1e-127
>prophage 107
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1526242	1532620	1769679	tRNA	Bacillus_phage(33.33%)	5	NA	NA
WP_062174253.1|1526242_1527586_+	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	27.2	2.0e-22
WP_062174255.1|1528390_1529110_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.2	8.1e-18
WP_062174257.1|1529111_1529939_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_040461226.1|1530005_1530944_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_062174258.1|1531117_1532620_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	37.2	6.1e-92
>prophage 108
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1543032	1545461	1769679		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_062174277.1|1543032_1544391_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	33.1	6.7e-66
WP_062174279.1|1544681_1545461_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	21.1	3.8e-05
>prophage 109
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1550676	1551285	1769679		Bacillus_virus(100.0%)	1	NA	NA
WP_062174288.1|1550676_1551285_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	29.5	3.7e-16
>prophage 110
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1555727	1560361	1769679		Staphylococcus_phage(50.0%)	3	NA	NA
WP_062174297.1|1555727_1556909_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	65.5	4.7e-140
WP_021753651.1|1557185_1557977_-	pyruvate formate lyase-activating protein	NA	NA	NA	NA	NA
WP_062174300.1|1558120_1560361_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	43.1	1.0e-172
>prophage 111
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1563482	1564370	1769679		Cedratvirus(100.0%)	1	NA	NA
WP_062174306.1|1563482_1564370_+	ABC transporter ATP-binding protein	NA	A0A2R8FFL6	Cedratvirus	34.5	6.7e-22
>prophage 112
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1567562	1570025	1769679		Erysipelothrix_phage(50.0%)	3	NA	NA
WP_062174316.1|1567562_1568129_-	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	27.3	1.9e-06
WP_062174318.1|1568356_1569040_-	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_062174320.1|1569365_1570025_-	RraA family protein	NA	E3T536	Cafeteria_roenbergensis_virus	27.9	6.9e-08
>prophage 113
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1573824	1575087	1769679		Enterobacteria_phage(100.0%)	1	NA	NA
WP_072520215.1|1573824_1575087_-	purine permease	NA	Q9KX94	Enterobacteria_phage	27.9	3.6e-29
>prophage 114
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1583364	1585414	1769679		Flavobacterium_phage(50.0%)	3	NA	NA
WP_062174345.1|1583364_1584129_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	45.0	7.0e-20
WP_003145675.1|1584443_1584593_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_062174347.1|1584760_1585414_-	fructose-6-phosphate aldolase	NA	E3SNX1	Prochlorococcus_phage	45.8	1.7e-46
>prophage 115
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1588875	1592269	1769679		Tupanvirus(50.0%)	3	NA	NA
WP_062174357.1|1588875_1590378_-	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	27.5	8.3e-33
WP_062174359.1|1590593_1591256_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_062174361.1|1591255_1592269_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	9.9e-30
>prophage 116
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1599103	1600480	1769679		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_062174368.1|1599103_1600480_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	35.5	4.8e-35
>prophage 117
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1620702	1622079	1769679	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_062173096.1|1620702_1622079_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	34.3	4.6e-54
>prophage 118
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1634598	1641963	1769679		Streptococcus_phage(33.33%)	7	NA	NA
WP_062174425.1|1634598_1635231_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.9	4.9e-35
WP_062174427.1|1635486_1636407_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_062174428.1|1636407_1637472_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_062174430.1|1637484_1638996_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	27.6	3.1e-11
WP_062174432.1|1639404_1639833_-	HIT family protein	NA	NA	NA	NA	NA
WP_062174434.1|1639844_1640669_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_062174436.1|1640847_1641963_+	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	28.8	8.9e-32
>prophage 119
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1648897	1650646	1769679		Bacillus_virus(100.0%)	1	NA	NA
WP_062174445.1|1648897_1650646_-	dihydrolipoyl dehydrogenase	NA	G3MA85	Bacillus_virus	25.1	2.0e-06
>prophage 120
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1658251	1661349	1769679		environmental_halophage(50.0%)	2	NA	NA
WP_062174456.1|1658251_1659403_-	aminotransferase class V-fold PLP-dependent enzyme	NA	Q2XUY6	environmental_halophage	31.3	1.9e-40
WP_062174458.1|1659438_1661349_-	selenocysteine-specific translation elongation factor	NA	E3T4N3	Cafeteria_roenbergensis_virus	24.8	3.7e-09
>prophage 121
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1667341	1673564	1769679	integrase,transposase	Staphylococcus_phage(33.33%)	7	1672457:1672482	1673816:1673841
WP_062174473.1|1667341_1668580_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.1	1.0e-36
WP_062174475.1|1669134_1670535_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_062174477.1|1670537_1671386_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	31.3	1.9e-10
WP_156439988.1|1671357_1671510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062174479.1|1671523_1671886_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062174481.1|1672073_1672391_-	DUF1904 family protein	NA	NA	NA	NA	NA
1672457:1672482	attL	AGAAAATATCTCCTAATTTTAGAATT	NA	NA	NA	NA
WP_062174635.1|1672580_1673564_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A8RHK4	Spiroplasma_virus	31.2	1.0e-07
WP_062174635.1|1672580_1673564_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A8RHK4	Spiroplasma_virus	31.2	1.0e-07
1673816:1673841	attR	AGAAAATATCTCCTAATTTTAGAATT	NA	NA	NA	NA
>prophage 122
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1677874	1680282	1769679		Erwinia_phage(50.0%)	2	NA	NA
WP_062174492.1|1677874_1678849_-	signal peptide peptidase SppA	NA	E5AFY0	Erwinia_phage	30.3	8.6e-15
WP_062174494.1|1678920_1680282_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	43.9	3.9e-82
>prophage 123
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1688434	1689127	1769679		Bacillus_phage(100.0%)	1	NA	NA
WP_062174509.1|1688434_1689127_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.6	7.5e-37
>prophage 124
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1696873	1700793	1769679		Streptococcus_phage(33.33%)	4	NA	NA
WP_062174519.1|1696873_1698415_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.0	1.5e-50
WP_062174521.1|1698648_1699869_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	31.2	1.1e-27
WP_021752292.1|1699968_1700217_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_062174523.1|1700241_1700793_-	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	65.7	1.0e-36
>prophage 125
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1704832	1706641	1769679		Streptococcus_phage(100.0%)	1	NA	NA
WP_062174529.1|1704832_1706641_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	48.8	9.0e-159
>prophage 126
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1710925	1711921	1769679		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_062174542.1|1710925_1711921_-	D-2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	31.7	2.2e-42
>prophage 127
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1719285	1723992	1769679		Catovirus(25.0%)	5	NA	NA
WP_062174552.1|1719285_1719912_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.9	4.1e-34
WP_062174554.1|1719911_1721183_-	U32 family peptidase	NA	Q6DW11	Phage_TP	32.3	4.0e-36
WP_062174556.1|1721408_1722335_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_062174558.1|1722355_1723015_-	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	30.6	3.2e-13
WP_062174560.1|1723248_1723992_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.6	1.4e-28
>prophage 128
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1728354	1745536	1769679	tRNA	Clostridium_phage(16.67%)	11	NA	NA
WP_062174570.1|1728354_1732698_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	37.7	7.3e-21
WP_062174572.1|1732806_1734507_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_062174574.1|1734675_1735251_+	Holliday junction resolvase RecU	NA	A0A0K2CP48	Brevibacillus_phage	38.9	7.8e-24
WP_062174576.1|1735257_1737384_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_082729141.1|1737598_1738120_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_062174579.1|1738119_1739028_-	cysteine synthase family protein	NA	C3U2M1	Lactococcus_phage	46.5	2.1e-63
WP_062174580.1|1739261_1740143_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	32.3	1.6e-07
WP_062174581.1|1740135_1740948_-	NAD kinase	NA	NA	NA	NA	NA
WP_062174582.1|1740928_1741495_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_062174583.1|1741919_1744727_-	DEAD/DEAH box helicase	NA	Q5YA94	Bacillus_phage	29.4	1.5e-27
WP_062174585.1|1744732_1745536_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	24.6	3.1e-10
>prophage 129
NZ_CP014233	Gemella sp. oral taxon 928, complete genome	1769679	1758754	1762656	1769679		Bacillus_phage(33.33%)	4	NA	NA
WP_062174607.1|1758754_1759627_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.7	7.9e-76
WP_062174609.1|1759864_1761241_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.8	1.9e-20
WP_062174611.1|1761480_1761870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062174613.1|1761984_1762656_-	HAD-IA family hydrolase	NA	M1I080	Acanthocystis_turfacea_Chlorella_virus	25.8	2.2e-09
