The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014129	Pantoea vagans strain FDAARGOS_160 chromosome, complete genome	4050121	1086030	1094808	4050121		Streptococcus_phage(28.57%)	8	NA	NA
WP_061061705.1|1086030_1087143_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	5.6e-111
WP_010255198.1|1087381_1088485_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	1.7e-59
WP_061061706.1|1088495_1089749_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.1	4.3e-91
WP_061061707.1|1090110_1090842_+	chromophore lyase	NA	A0A2I6PIE7	Escherichia_phage	37.5	6.4e-47
WP_061061709.1|1091747_1092215_+	glycoside hydrolase family protein	NA	H9C148	Vibrio_phage	44.7	8.9e-26
WP_061061710.1|1092211_1092559_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	45.6	5.4e-20
WP_061061711.1|1092555_1092849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061061712.1|1093053_1094808_+	amylovoran biosynthesis protein AmsF	NA	A0A1S6L3G8	Erwinia_phage	46.4	2.1e-152
>prophage 2
NZ_CP014129	Pantoea vagans strain FDAARGOS_160 chromosome, complete genome	4050121	1157524	1211901	4050121	coat,terminase,tRNA,plate,integrase,tail,protease	uncultured_Caudovirales_phage(22.22%)	87	1157455:1157475	1204147:1204167
1157455:1157475	attL	CATCGGACTGTTTCTCCGATG	NA	NA	NA	NA
WP_061061749.1|1157524_1158568_-|integrase	site-specific integrase	integrase	K7PKD7	Enterobacteria_phage	35.5	4.4e-57
WP_071888711.1|1158880_1159201_-	DUF5406 family protein	NA	B0ZSH8	Halomonas_phage	51.8	9.7e-24
WP_061061751.1|1159257_1159632_-	hypothetical protein	NA	A0A173GC52	Salmonella_phage	38.3	3.9e-08
WP_061061752.1|1159628_1159847_-	hypothetical protein	NA	A0A2H4IYB3	uncultured_Caudovirales_phage	87.1	7.3e-31
WP_105399947.1|1159904_1160399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061061754.1|1160395_1160638_-	DNA polymerase III subunit theta	NA	A0A2H4J4A9	uncultured_Caudovirales_phage	88.8	2.8e-31
WP_061061755.1|1160668_1160980_-	hypothetical protein	NA	A0A0S3UG40	Pseudomonas_phage	39.1	1.5e-05
WP_061061756.1|1161062_1161437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061061757.1|1161433_1161952_-	hypothetical protein	NA	A0A291L9X9	Bordetella_phage	46.5	5.3e-11
WP_061061758.1|1161948_1162671_-	hypothetical protein	NA	A0A2I2L6M3	Escherichia_phage	58.6	5.6e-11
WP_061061759.1|1162720_1163029_-	hypothetical protein	NA	A0A2H4JCD0	uncultured_Caudovirales_phage	87.3	4.9e-41
WP_061061760.1|1163056_1163533_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	82.7	7.1e-55
WP_061061761.1|1163533_1164148_-	ERF family protein	NA	A0A1W6JP21	Morganella_phage	66.0	4.7e-67
WP_192951267.1|1164134_1164293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061061762.1|1164282_1164480_-	DUF5444 family protein	NA	A0A075B8F9	Enterobacteria_phage	69.2	3.1e-20
WP_105399948.1|1164476_1164620_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_192951268.1|1164771_1164948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061061763.1|1164967_1165231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061061764.1|1165344_1165836_-	hypothetical protein	NA	A0A2H4J4Q4	uncultured_Caudovirales_phage	52.5	1.9e-39
WP_192951269.1|1165886_1166045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061061765.1|1166051_1166291_-	hypothetical protein	NA	A0A2H4J657	uncultured_Caudovirales_phage	46.0	6.6e-09
WP_061061766.1|1166738_1167428_-	helix-turn-helix transcriptional regulator	NA	F1C5C2	Cronobacter_phage	90.0	1.2e-111
WP_058956766.1|1167526_1167754_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	50.0	3.0e-11
WP_061061767.1|1167870_1168140_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	64.0	4.6e-19
WP_061061768.1|1168175_1168877_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_061061769.1|1168876_1169755_+	hypothetical protein	NA	G8C7U5	Escherichia_phage	68.1	1.2e-100
WP_061061770.1|1169757_1170609_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	62.7	6.2e-94
WP_061061771.1|1170605_1170830_+	hypothetical protein	NA	A0A2H4J1E7	uncultured_Caudovirales_phage	81.4	5.4e-21
WP_192951270.1|1170826_1171093_+	DUF3850 domain-containing protein	NA	R9TML3	Aeromonas_phage	66.7	2.0e-22
WP_061061773.1|1171073_1171430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061063676.1|1171440_1171728_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	64.0	1.7e-27
WP_061061774.1|1171724_1171922_+	hypothetical protein	NA	A0A2H4J4C7	uncultured_Caudovirales_phage	42.9	3.2e-09
WP_061061775.1|1171893_1172328_+	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	92.9	7.1e-70
WP_061061776.1|1172324_1172615_+	hypothetical protein	NA	A0A2H4JI39	uncultured_Caudovirales_phage	36.8	5.5e-10
WP_061061777.1|1172607_1172808_+	hypothetical protein	NA	A0A2H4JE12	uncultured_Caudovirales_phage	90.6	3.4e-27
WP_105399982.1|1172804_1173014_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	49.3	4.2e-12
WP_071888648.1|1173103_1173289_+	hypothetical protein	NA	A0A2H4J175	uncultured_Caudovirales_phage	67.8	9.9e-13
WP_061061779.1|1173281_1173863_+	recombination protein NinG	NA	A0A2R2Z332	Escherichia_phage	44.4	2.9e-34
WP_061061780.1|1173859_1174057_+	Lar family restriction alleviation protein	NA	M9NZE6	Enterobacteria_phage	75.4	6.6e-23
WP_061061781.1|1174168_1174990_+	antitermination protein	NA	E5AGG3	Erwinia_phage	63.2	6.7e-93
WP_061061782.1|1175269_1175683_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	39.0	1.9e-19
WP_061061783.1|1175728_1175911_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_061061784.1|1176208_1176628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061061785.1|1176624_1176861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061061786.1|1176857_1177325_+	glycoside hydrolase family protein	NA	H9C148	Vibrio_phage	41.1	2.0e-25
WP_061061787.1|1177321_1177666_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	45.0	1.8e-20
WP_061061788.1|1177662_1177959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061061789.1|1178106_1178376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061061790.1|1178653_1179181_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	62.5	2.0e-50
WP_061061791.1|1179272_1179707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061061792.1|1179729_1180299_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	75.1	2.5e-75
WP_061061793.1|1180285_1181758_+	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	84.6	1.8e-245
WP_061063677.1|1181830_1183168_+	DUF4055 domain-containing protein	NA	A0A0S2SYJ5	Pseudomonas_phage	40.4	2.2e-85
WP_061061794.1|1183288_1184041_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	49.2	8.0e-61
WP_061061795.1|1184055_1185180_+|coat	P22 coat - protein 5 family protein	coat	W6EBZ8	Rhizobium_phage	53.0	5.4e-93
WP_061061796.1|1185225_1185471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061061797.1|1185470_1185863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061061798.1|1185864_1186509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061061799.1|1186510_1187332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061061800.1|1187335_1187557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061063678.1|1187615_1189172_+|tail	phage tail protein	tail	B3GAJ6	uncultured_virus	44.4	6.1e-95
WP_061061801.1|1189218_1189650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061061802.1|1189659_1190031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061061803.1|1190212_1190650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061063679.1|1190697_1191126_-	hypothetical protein	NA	J7HXA3	Pseudomonas_phage	33.3	6.9e-09
WP_071888650.1|1191303_1191654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061061805.1|1191718_1194181_+	hypothetical protein	NA	K4NZX3	Burkholderia_phage	29.8	5.5e-42
WP_061061806.1|1194191_1195181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061061807.1|1195183_1196299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061061808.1|1196295_1196895_+|plate	baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	32.9	2.2e-08
WP_061061809.1|1196904_1197270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081093861.1|1197330_1198401_+|plate	baseplate J/gp47 family protein	plate	B3GAJ9	uncultured_virus	39.9	2.6e-49
WP_061061811.1|1198401_1199064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123809948.1|1199128_1200886_+|tail	phage tail protein	tail	A9YX14	Burkholderia_phage	37.9	1.5e-41
WP_081093823.1|1201046_1202396_-	acyltransferase	NA	G9L6E5	Escherichia_phage	24.1	7.0e-07
WP_061061815.1|1202570_1202933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061061816.1|1203449_1203689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061061817.1|1203691_1204015_+	hypothetical protein	NA	A0A2H4J4R6	uncultured_Caudovirales_phage	70.1	9.7e-40
WP_013356969.1|1204175_1205324_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.4	2.5e-90
1204147:1204167	attR	CATCGGACTGTTTCTCCGATG	NA	NA	NA	NA
WP_009091760.1|1205323_1205656_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	36.3	5.7e-11
WP_071888652.1|1205681_1207529_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_013356971.1|1207539_1208508_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	40.3	2.1e-45
WP_061061819.1|1208567_1209146_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_033782154.1|1209162_1209600_-	peptidoglycan-binding protein LysM	NA	G3MBQ1	Bacillus_virus	51.9	2.5e-06
WP_009091750.1|1209786_1210236_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_013356974.1|1210239_1211340_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.3	2.0e-47
WP_013356975.1|1211430_1211901_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.0	2.7e-30
>prophage 3
NZ_CP014129	Pantoea vagans strain FDAARGOS_160 chromosome, complete genome	4050121	1996305	2010155	4050121	tRNA	Tupanvirus(11.11%)	15	NA	NA
WP_061062333.1|1996305_1998234_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	1.4e-125
WP_033732471.1|1998237_1998789_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	1.7e-15
WP_004157374.1|1998888_1999086_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_003853267.1|1999130_1999487_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_106120997.1|1999609_1999654_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_013357682.1|1999801_2000785_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	37.6	2.9e-34
WP_061062334.1|2000799_2003187_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	32.0	1.2e-09
WP_003853259.1|2003191_2003494_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.3e-13
WP_061062335.1|2003673_2004657_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_061062336.1|2004707_2005253_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	37.4	7.7e-13
WP_061062337.1|2005253_2006003_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	W5SAS9	Pithovirus	26.9	8.7e-07
WP_013357687.1|2006071_2006530_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	37.5	5.5e-12
WP_061062338.1|2006824_2007571_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_061062339.1|2007650_2009102_+	YdiU family protein	NA	NA	NA	NA	NA
WP_061062340.1|2009108_2010155_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	49.7	5.5e-84
>prophage 4
NZ_CP014129	Pantoea vagans strain FDAARGOS_160 chromosome, complete genome	4050121	2454976	2508411	4050121	integrase,holin,tRNA,plate,tail,protease	Erwinia_phage(26.67%)	51	2486584:2486614	2516511:2516541
WP_061062629.1|2454976_2455675_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_061062630.1|2455719_2457636_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.2	6.3e-86
WP_061062631.1|2457885_2458623_-	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_013358089.1|2459262_2459430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061062632.1|2459772_2460132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061062633.1|2460199_2460544_+	RidA family protein	NA	NA	NA	NA	NA
WP_013358092.1|2460556_2460751_-	YoaH family protein	NA	NA	NA	NA	NA
WP_061062634.1|2460861_2462241_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	32.7	4.9e-40
WP_061062635.1|2462224_2462788_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_061062636.1|2462973_2464338_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_061062637.1|2464562_2466125_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_061062638.1|2466261_2467860_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.4	8.3e-39
WP_061062639.1|2468369_2469332_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_033733019.1|2469395_2470196_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_061062640.1|2470211_2471057_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_061062641.1|2471148_2471607_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_061062642.1|2471603_2472413_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_003852684.1|2472550_2472760_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	76.6	5.9e-22
WP_061062643.1|2473412_2474417_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_061062644.1|2474435_2474708_-	YebO family protein	NA	NA	NA	NA	NA
WP_033732884.1|2474920_2475157_+	membrane protein	NA	NA	NA	NA	NA
WP_061062645.1|2475187_2475979_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_061062646.1|2476165_2477530_+	MFS transporter	NA	NA	NA	NA	NA
WP_003852678.1|2477879_2478761_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_061062647.1|2479005_2481045_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.7	7.2e-88
WP_061062648.1|2481064_2481769_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_061062649.1|2481865_2482366_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_061062650.1|2482580_2483825_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_061062651.1|2483793_2486427_+	PqiB family protein	NA	NA	NA	NA	NA
2486584:2486614	attL	GCGCAGGGAACACGGGCAGAGGAGGAAAGCG	NA	NA	NA	NA
WP_192951243.1|2486775_2488242_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_061062653.1|2488243_2488891_-	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	48.1	3.9e-56
WP_061062654.1|2489159_2489372_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_061062655.1|2489518_2490868_-	MFS transporter	NA	NA	NA	NA	NA
WP_013358119.1|2491003_2493034_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	26.2	4.4e-21
WP_061062656.1|2493289_2493883_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_061062657.1|2493897_2495370_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_061062658.1|2495393_2497076_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.7	4.2e-57
WP_061062659.1|2497504_2497855_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_061062660.1|2497841_2498171_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_061062661.1|2498371_2499514_+	acyltransferase	NA	Q6QI96	Burkholderia_phage	31.2	6.1e-36
WP_013358126.1|2499677_2499938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061062662.1|2500054_2500240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_192951244.1|2500336_2500474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061062663.1|2500689_2501712_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.9	5.7e-25
WP_105399964.1|2502618_2503119_+|plate	baseplate J/gp47 family protein	plate	F1BUP3	Erwinia_phage	82.5	1.7e-67
WP_061062664.1|2503111_2503720_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	81.7	5.3e-95
WP_061062665.1|2503716_2504760_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	65.1	3.3e-121
WP_061062666.1|2505404_2505845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061062667.1|2505862_2506396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069026604.1|2507025_2507241_+	ogr/Delta-like zinc finger family protein	NA	F1BUT0	Erwinia_phage	77.8	7.4e-28
WP_061062669.1|2507346_2508411_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	56.0	8.0e-115
2516511:2516541	attR	GCGCAGGGAACACGGGCAGAGGAGGAAAGCG	NA	NA	NA	NA
>prophage 5
NZ_CP014129	Pantoea vagans strain FDAARGOS_160 chromosome, complete genome	4050121	3269979	3281395	4050121	integrase	Enterobacteria_phage(50.0%)	13	3266292:3266307	3280099:3280114
3266292:3266307	attL	CCGCGAGCTGTTGCAG	NA	NA	NA	NA
WP_061063146.1|3269979_3271176_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	45.5	2.1e-103
WP_071888722.1|3271192_3272059_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_061063147.1|3272055_3272664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123809966.1|3272732_3274679_-	ATP-binding protein	NA	A0A2H4J2R8	uncultured_Caudovirales_phage	38.8	1.1e-125
WP_061063149.1|3275014_3275266_-	ogr/Delta-like zinc finger family protein	NA	F1BUT0	Erwinia_phage	63.8	1.3e-15
WP_061063150.1|3275262_3275979_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	26.4	1.7e-12
WP_061063151.1|3276500_3276758_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	57.0	6.4e-18
WP_061063152.1|3276754_3277003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071888687.1|3277016_3277544_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	67.0	4.4e-29
WP_061063154.1|3277540_3277807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061063155.1|3277793_3278135_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_105399990.1|3278149_3280465_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	60.4	4.4e-259
3280099:3280114	attR	CCGCGAGCTGTTGCAG	NA	NA	NA	NA
WP_061063156.1|3280618_3281395_-	FAD-dependent thymidylate synthase	NA	A0A166Y9A6	Gordonia_phage	39.0	1.3e-29
>prophage 6
NZ_CP014129	Pantoea vagans strain FDAARGOS_160 chromosome, complete genome	4050121	3606519	3691394	4050121	portal,capsid,coat,terminase,integrase,tRNA,plate,head,tail,lysis	Salmonella_phage(57.14%)	92	3658779:3658830	3693574:3693625
WP_061063357.1|3606519_3607089_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_061063358.1|3607111_3607627_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_061063359.1|3607652_3608348_+	molecular chaperone	NA	NA	NA	NA	NA
WP_061063360.1|3608355_3610803_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_061063361.1|3610799_3611777_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_061063362.1|3611773_3613096_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.7	2.4e-60
WP_061063363.1|3613332_3613755_-	TonB system transport protein ExbD	NA	NA	NA	NA	NA
WP_192951259.1|3613761_3614484_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_061063365.1|3614833_3615805_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_061063366.1|3615854_3616361_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_061063367.1|3616375_3617662_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_061063368.1|3617794_3618994_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_033733897.1|3619160_3619823_+	DedA family protein	NA	NA	NA	NA	NA
WP_061063369.1|3619853_3620762_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_061063370.1|3620965_3621790_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	1.4e-61
WP_033733900.1|3621881_3623312_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_061063371.1|3623454_3624192_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_061063372.1|3624237_3626511_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.5	3.1e-87
WP_061063373.1|3626703_3627468_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_061063374.1|3627634_3628216_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013359050.1|3628264_3628573_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_061063375.1|3628918_3629818_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061063376.1|3629911_3631807_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.7	7.6e-92
WP_061063377.1|3631856_3632438_-	esterase YqiA	NA	NA	NA	NA	NA
WP_061063378.1|3632441_3633269_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_061063379.1|3633311_3633737_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_061063380.1|3633733_3634369_-	ADP-ribose diphosphatase	NA	NA	NA	NA	NA
WP_061063381.1|3634582_3636049_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_033733914.1|3636191_3636863_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	47.1	1.3e-41
WP_061063382.1|3636870_3638031_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.4	3.6e-84
WP_061063383.1|3638084_3638870_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_013359061.1|3639106_3639763_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.6	1.1e-42
WP_061063384.1|3640202_3640592_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_061063385.1|3640630_3642055_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.1	1.8e-37
WP_061063386.1|3642125_3644978_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_061063387.1|3645011_3646322_-	inorganic triphosphatase	NA	NA	NA	NA	NA
WP_061063388.1|3646595_3647216_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_061063771.1|3647374_3648607_+	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	44.6	1.4e-83
WP_003848438.1|3648622_3649441_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_061063389.1|3649632_3649992_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_061063390.1|3650100_3650706_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_061063391.1|3650735_3651749_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	1.7e-106
WP_001144069.1|3652026_3652242_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_061063392.1|3652360_3654106_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.6	1.4e-71
WP_013359071.1|3654602_3656444_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_061063393.1|3656518_3657037_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_061063394.1|3657033_3657618_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
3658779:3658830	attL	GACTCATAATCGCTTGGTCGCTGGTTCAAACCCAGCAGGGGCCACCAAATTT	NA	NA	NA	NA
WP_123809968.1|3658948_3659128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071888693.1|3659346_3659565_-	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	69.1	3.1e-21
WP_061063395.1|3659631_3660732_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	72.9	3.9e-149
WP_061063396.1|3660728_3661214_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	82.7	2.7e-57
WP_061063397.1|3661210_3664246_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	41.4	2.1e-128
WP_071888694.1|3664238_3664379_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	56.1	4.2e-08
WP_061063398.1|3664375_3664684_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	68.6	2.7e-31
WP_061063399.1|3664740_3665256_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	86.0	3.7e-81
WP_061063400.1|3665268_3666438_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	88.7	6.4e-198
WP_061063401.1|3666556_3667156_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	43.9	5.5e-36
WP_061063402.1|3667155_3668412_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	50.2	1.0e-121
WP_061063403.1|3668408_3669020_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	74.5	6.3e-88
WP_061063404.1|3669016_3669931_-|plate	baseplate J/gp47 family protein	plate	A0A1S6KZY6	Salmonella_phage	65.2	5.7e-101
WP_061063405.1|3669917_3670274_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	63.2	5.0e-37
WP_061063772.1|3670270_3670849_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	69.1	1.9e-70
WP_123809969.1|3670946_3671651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061063407.1|3671638_3672094_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	61.6	7.8e-43
WP_061063408.1|3672086_3672518_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	75.7	1.2e-56
WP_061063409.1|3672613_3673042_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	56.8	1.1e-33
WP_061063410.1|3673038_3673413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061063411.1|3673414_3673924_-	lysozyme	NA	E5G6N1	Salmonella_phage	76.2	1.2e-71
WP_060680980.1|3673904_3674117_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	63.2	1.4e-18
WP_061063412.1|3674120_3674324_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	83.6	1.4e-28
WP_061063413.1|3674323_3674788_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	69.5	2.1e-59
WP_061063414.1|3674887_3675532_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	72.2	6.0e-81
WP_061063415.1|3675535_3676753_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	70.7	1.0e-137
WP_061063416.1|3676797_3677655_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	58.6	9.4e-82
WP_061063417.1|3677797_3679564_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	85.2	8.2e-306
WP_061063418.1|3679563_3680607_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	78.9	4.3e-161
WP_061063419.1|3680662_3681358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061063420.1|3681377_3682442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061063421.1|3682438_3683503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_192951260.1|3683769_3684087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061063423.1|3684101_3684341_-	DinI-like family protein	NA	A0A1S6L014	Salmonella_phage	65.3	4.0e-22
WP_061063424.1|3684353_3684542_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	83.3	3.4e-21
WP_105399975.1|3684711_3687081_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	80.6	0.0e+00
WP_061063426.1|3687080_3687881_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	63.5	2.6e-89
WP_061063427.1|3687877_3688105_-	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	61.1	9.6e-18
WP_061063428.1|3688104_3688332_-	DUF2732 domain-containing protein	NA	F1BUS3	Erwinia_phage	53.3	1.6e-12
WP_061063429.1|3688401_3688740_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.9	1.6e-29
WP_071888697.1|3688703_3688892_-	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	57.9	4.7e-10
WP_061063430.1|3688895_3689405_-	phage regulatory CII family protein	NA	F1BUS6	Erwinia_phage	70.8	1.2e-60
WP_061063431.1|3689439_3689676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061063432.1|3689765_3690371_+	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	38.2	2.2e-29
WP_061063433.1|3690380_3691394_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	62.3	8.2e-117
3693574:3693625	attR	GACTCATAATCGCTTGGTCGCTGGTTCAAACCCAGCAGGGGCCACCAAATTT	NA	NA	NA	NA
>prophage 1
NZ_CP014126	Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence	90511	16603	23305	90511		Morganella_phage(50.0%)	8	NA	NA
WP_072124008.1|16603_17053_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.8	8.5e-26
WP_061060477.1|17508_18189_-	SOS response-associated peptidase family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	79.9	5.5e-109
WP_061060478.1|18326_18707_+	hypothetical protein	NA	A0A1W6JNS2	Morganella_phage	38.2	3.1e-13
WP_061060479.1|18706_19969_+	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	56.7	7.0e-134
WP_061060480.1|20043_20832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061060481.1|21443_22088_+	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	40.3	1.4e-32
WP_061060482.1|22123_22354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061060483.1|22804_23305_+	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	33.3	2.4e-13
