The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012199	Sphingopyxis granuli strain TFA chromosome, complete genome	4679853	920672	934168	4679853	portal,head,transposase,protease,tail,capsid	Caulobacter_phage(14.29%)	20	NA	NA
WP_067180923.1|920672_921635_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_148650792.1|921773_922610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172709609.1|922876_923020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148650793.1|923016_923226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067180931.1|923426_924044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067180934.1|924315_925650_+	DNA-packaging protein	NA	A0A0K1LMR9	Caulobacter_phage	38.0	3.9e-66
WP_067180935.1|925817_926924_+|portal	phage portal protein	portal	A0A0K1LLE7	Bacillus_phage	33.7	1.7e-43
WP_067180938.1|926937_927246_+	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	50.0	2.6e-10
WP_082737413.1|927290_927695_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JAI0	uncultured_Caudovirales_phage	35.8	2.7e-10
WP_082737065.1|927700_928840_+|capsid	phage major capsid protein	capsid	Q8W627	Enterobacteria_phage	49.3	3.8e-86
WP_067180940.1|929001_930747_+|tail	tail fiber domain-containing protein	tail	A0A218KRF6	Acinetobacter_phage	26.8	8.8e-10
WP_172709610.1|930743_930902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067180943.1|930918_931200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067180946.1|931196_931742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172709611.1|931741_932152_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_067112904.1|932238_932577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067112902.1|932623_933031_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_067180952.1|933027_933342_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_082737415.1|933426_933600_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_067180958.1|933592_934168_+|tail	tail tape measure protein	tail	A0A1B1P750	Rhodovulum_phage	31.2	5.7e-06
>prophage 2
NZ_CP012199	Sphingopyxis granuli strain TFA chromosome, complete genome	4679853	1836732	1918591	4679853	integrase,transposase,tRNA	Stx2-converting_phage(21.05%)	79	1884650:1884709	1888288:1888373
WP_067182539.1|1836732_1838013_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.1	4.5e-88
WP_148650965.1|1838491_1839298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067106274.1|1839979_1840441_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_067106277.1|1840534_1840927_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_076074740.1|1840977_1841136_-	YdcH family protein	NA	NA	NA	NA	NA
WP_067106279.1|1841262_1841460_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_067106309.1|1841554_1841995_+	DUF1465 family protein	NA	NA	NA	NA	NA
WP_067182542.1|1842079_1842541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067182545.1|1842562_1843642_-	DUF2332 domain-containing protein	NA	NA	NA	NA	NA
WP_067186983.1|1843680_1844355_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_067182546.1|1844355_1845660_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_067106287.1|1845656_1846109_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_067182548.1|1846220_1847153_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_067182549.1|1847332_1849435_+	sodium-translocating pyrophosphatase	NA	NA	NA	NA	NA
WP_067182551.1|1849596_1850409_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_067106297.1|1850725_1851256_+	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_067182552.1|1851340_1852081_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_067108408.1|1852337_1853258_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_067108324.1|1853456_1854053_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_067182555.1|1854084_1854618_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.2	6.8e-22
WP_067108330.1|1854782_1855334_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_067108332.1|1855338_1856382_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_067108335.1|1856489_1857206_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_067182558.1|1857207_1857849_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	E9KZD2	Cassava_brown_streak_virus	40.3	7.4e-07
WP_067182561.1|1857907_1858423_+	DUF2239 family protein	NA	NA	NA	NA	NA
WP_067182565.1|1858454_1859600_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_067182567.1|1859645_1860536_+	tyrosine recombinase XerC	NA	A0A1I9SC88	Mycobacterium_phage	33.2	3.8e-09
WP_067182568.1|1860543_1861152_-	DedA family protein	NA	NA	NA	NA	NA
WP_067182570.1|1861206_1862157_-	glutathione synthase	NA	NA	NA	NA	NA
WP_067182572.1|1862200_1862551_-	YraN family protein	NA	NA	NA	NA	NA
WP_067182573.1|1862547_1863408_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_067108411.1|1863418_1864606_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_067182575.1|1864786_1865323_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	38.2	9.9e-13
WP_067186984.1|1865338_1866040_-	NRDE family protein	NA	NA	NA	NA	NA
WP_067182576.1|1866125_1866563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067182577.1|1866602_1868108_-	peptidase S10	NA	NA	NA	NA	NA
WP_082737441.1|1868200_1868422_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_067182578.1|1868421_1868676_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_067182581.1|1868802_1870989_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_172709637.1|1871093_1871615_+	DUF3617 domain-containing protein	NA	NA	NA	NA	NA
WP_067182585.1|1872200_1873958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003039428.1|1874230_1874467_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_067182587.1|1874636_1875899_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_067182590.1|1876064_1877003_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_067182596.1|1877101_1877854_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_067182600.1|1878009_1878573_+	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_067182615.1|1878881_1880135_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	39.8	3.6e-74
WP_067182617.1|1880360_1881020_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	48.5	6.9e-24
WP_067182619.1|1881147_1882056_+	toprim domain-containing protein	NA	A0A2I6UG20	Salinibacter_virus	39.5	2.8e-07
WP_067182621.1|1882159_1884628_+	strawberry notch family protein	NA	NA	NA	NA	NA
1884650:1884709	attL	TATTCTTTGCAGTCGCAGTTTATGTCGAGCGTGGCGGCAGGAGGCGCAGGTTTCCTTCGG	NA	NA	NA	NA
WP_067182623.1|1884766_1885771_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	33.9	1.0e-10
WP_067182626.1|1885767_1886682_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_067182629.1|1886675_1888223_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	30.6	1.9e-11
WP_067182632.1|1888279_1890124_+	strawberry notch C-terminal domain-containing protein	NA	A0A076FMQ0	Aureococcus_anophage	30.7	6.2e-14
1888288:1888373	attR	CCGAAGGAAACCTGCGCCTCCTGCCGCCACGCTCGACATAAACTGCGACTGCAAAGAATACGTGGTCGATTACCTCACCAAGAGCT	NA	NA	NA	NA
WP_067182635.1|1890179_1890593_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_082737163.1|1890589_1891309_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_067182641.1|1891475_1892993_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.2	3.3e-98
WP_067182644.1|1893024_1893381_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_067186985.1|1893377_1893815_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_067182647.1|1894273_1894843_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_067182650.1|1894948_1895785_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_079639878.1|1895781_1897296_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_067182653.1|1897524_1899066_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	45.8	5.4e-120
WP_006963110.1|1899119_1899467_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	59.8	1.9e-33
WP_052182212.1|1899463_1899820_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_067182655.1|1900116_1900563_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_067182658.1|1900559_1900916_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_067182660.1|1900947_1902465_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.6	1.4e-99
WP_067182668.1|1903359_1904877_-	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	30.2	1.5e-29
WP_172709638.1|1905148_1905904_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_067182671.1|1906073_1908338_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_067182673.1|1908383_1909676_+	MFS transporter	NA	NA	NA	NA	NA
WP_067182676.1|1909700_1910828_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_067182679.1|1910837_1911302_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_067182681.1|1911298_1912186_-	alpha/beta hydrolase	NA	A0A249XTE1	Mycobacterium_phage	37.6	1.2e-07
WP_067182684.1|1912185_1914357_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_082737167.1|1914508_1916053_-	carboxylesterase family protein	NA	S4VZJ7	Pandoravirus	35.6	1.8e-38
WP_148650832.1|1916248_1916404_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_148650833.1|1917441_1918591_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.5	6.8e-51
>prophage 3
NZ_CP012199	Sphingopyxis granuli strain TFA chromosome, complete genome	4679853	2085239	2091645	4679853		uncultured_Mediterranean_phage(100.0%)	9	NA	NA
WP_067183027.1|2085239_2086247_+	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	37.2	8.1e-16
WP_067106537.1|2086254_2087028_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	34.2	5.1e-34
WP_067183031.1|2087024_2087618_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	41.0	1.3e-34
WP_067106498.1|2087643_2087871_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	61.4	1.2e-07
WP_067183033.1|2087909_2088350_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_067183036.1|2088346_2089156_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	37.7	8.7e-37
WP_067106494.1|2089175_2089307_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_067183039.1|2089551_2091015_-	magnesium transporter	NA	NA	NA	NA	NA
WP_067183041.1|2091195_2091645_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	52.2	2.2e-34
>prophage 4
NZ_CP012199	Sphingopyxis granuli strain TFA chromosome, complete genome	4679853	3102634	3162313	4679853	integrase,transposase	uncultured_Mediterranean_phage(16.67%)	51	3140946:3140963	3168863:3168880
WP_052182212.1|3102634_3102991_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_006963110.1|3102987_3103335_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	59.8	1.9e-33
WP_067182653.1|3103388_3104930_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	45.8	5.4e-120
WP_079639878.1|3105158_3106673_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_067182650.1|3106669_3107506_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_067182647.1|3107611_3108181_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_148650883.1|3111066_3112294_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	68.4	1.9e-104
WP_067187100.1|3113277_3117003_-	ATPase	NA	NA	NA	NA	NA
WP_148650884.1|3117030_3117489_-	BREX-3 system P-loop-containing protein BrxF	NA	NA	NA	NA	NA
WP_067184740.1|3117481_3118378_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_067184745.1|3118787_3119432_+	helix-turn-helix transcriptional regulator	NA	A5X9F5	Aeromonas_virus	38.2	1.9e-18
WP_082737276.1|3119443_3119869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082737459.1|3119976_3120168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067184748.1|3120167_3120365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067187101.1|3120398_3120638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067184751.1|3120710_3123647_-	conjugative relaxase	NA	NA	NA	NA	NA
WP_067184754.1|3123684_3126069_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_082737277.1|3126058_3126391_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_148650885.1|3126543_3126774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020820072.1|3126830_3127025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067184757.1|3127127_3127364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067184760.1|3127549_3127918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007688363.1|3128032_3128422_-	single-stranded DNA-binding protein	NA	A0A1P8L6D9	Staphylococcus_phage	35.5	8.5e-14
WP_067184763.1|3128725_3129154_-	hypothetical protein	NA	A0A1B1IUL8	uncultured_Mediterranean_phage	63.1	2.1e-34
WP_067184766.1|3129164_3129626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067184769.1|3129747_3130701_-	DUF2493 domain-containing protein	NA	NA	NA	NA	NA
WP_067184772.1|3131006_3131429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082737278.1|3131440_3131737_-	antirestriction protein ArdC	NA	A0A1B1IWW8	uncultured_Mediterranean_phage	42.2	6.5e-06
WP_037485796.1|3131733_3132636_-	DUF1738 domain-containing protein	NA	A0A1B1IWW8	uncultured_Mediterranean_phage	35.0	1.1e-32
WP_037485793.1|3132693_3134901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067179944.1|3134897_3136685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081796380.1|3136681_3138073_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_067184778.1|3138226_3138976_-	DUF1738 domain-containing protein	NA	A0A1V0EBY3	Caulobacter_phage	44.5	7.1e-41
WP_067184781.1|3139143_3141132_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
3140946:3140963	attL	CGCGGCGGCGGCGCTCGC	NA	NA	NA	NA
WP_067184784.1|3141480_3141777_-	DCL family protein	NA	NA	NA	NA	NA
WP_067184787.1|3141790_3144400_-	DEAD/DEAH box helicase	NA	M1HAU1	Paramecium_bursaria_Chlorella_virus	22.9	1.4e-11
WP_067184790.1|3144396_3145359_-	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_067184791.1|3145621_3146134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067184794.1|3146199_3146934_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_067184797.1|3146930_3147344_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_067184799.1|3147397_3149245_-	strawberry notch C-terminal domain-containing protein	NA	A0A076FMQ0	Aureococcus_anophage	32.2	4.8e-14
WP_067182623.1|3149294_3150299_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	33.9	1.0e-10
WP_067182626.1|3150295_3151210_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_067182629.1|3151203_3152751_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	30.6	1.9e-11
WP_009823939.1|3153307_3154312_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_009823940.1|3154308_3155664_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_007015824.1|3155660_3156893_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	27.3	2.1e-05
WP_067184802.1|3156983_3159200_-	strawberry notch family protein	NA	A0A1Y0T2N3	Pseudomonas_phage	28.2	8.6e-10
WP_067184805.1|3159241_3160171_-	toprim domain-containing protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.4	1.9e-11
WP_067184808.1|3160295_3160952_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	50.4	8.4e-22
WP_067184810.1|3161041_3162313_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	21.5	9.3e-09
3168863:3168880	attR	GCGAGCGCCGCCGCCGCG	NA	NA	NA	NA
