The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014013	Bordetella bronchiseptica strain FDAARGOS_176 chromosome, complete genome	5339230	2067923	2114008	5339230	tail,terminase,capsid,head,integrase,protease,portal	Burkholderia_phage(19.23%)	56	2075917:2075936	2115603:2115622
WP_033447056.1|2067923_2068571_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_010926218.1|2068656_2069562_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_033447671.1|2069579_2070701_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_003809958.1|2070788_2071415_-	fimbrial protein	NA	NA	NA	NA	NA
WP_033446615.1|2071664_2071874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926219.1|2072145_2073333_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_010926220.1|2073329_2075927_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	22.4	2.2e-20
2075917:2075936	attL	TGCTGCATCATGGGAGTATG	NA	NA	NA	NA
WP_033451925.1|2075983_2076973_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J8E5	uncultured_Caudovirales_phage	54.7	2.5e-94
WP_010926222.1|2076950_2077163_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_010926223.1|2077319_2077967_-	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	42.3	3.8e-35
WP_010926225.1|2078078_2078255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926228.1|2079989_2081924_-	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	46.8	1.3e-163
WP_010926229.1|2081925_2082411_-	class I SAM-dependent methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	63.6	1.6e-57
WP_010926231.1|2082750_2082978_-	hypothetical protein	NA	A0A125RNQ4	Pseudomonas_phage	49.2	1.4e-13
WP_010926232.1|2082974_2083496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926233.1|2083492_2084137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926234.1|2084133_2084958_-	ParB N-terminal domain-containing protein	NA	C7BGF1	Burkholderia_phage	65.8	6.5e-88
WP_010926235.1|2084978_2085350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926236.1|2085360_2085597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146090591.1|2085906_2086266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926238.1|2086570_2087254_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_080561918.1|2087339_2087552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926239.1|2087655_2088186_+	hypothetical protein	NA	B7SYH6	Stenotrophomonas_phage	38.9	4.1e-27
WP_049803241.1|2088185_2088488_+	hypothetical protein	NA	Q6V7S5	Burkholderia_virus	38.8	2.0e-07
WP_010926241.1|2088480_2088783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926242.1|2088779_2089274_+	DUF1364 family protein	NA	NA	NA	NA	NA
WP_010926244.1|2090468_2090948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926245.1|2090944_2091313_+	hypothetical protein	NA	A0A0P0I8E8	Acinetobacter_phage	48.1	7.5e-20
WP_146090592.1|2091327_2091810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926247.1|2091810_2092494_+	hypothetical protein	NA	Q3HR05	Burkholderia_phage	45.1	1.5e-29
WP_010926248.1|2092750_2093029_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	60.4	1.3e-08
WP_010926249.1|2093015_2093282_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_080561919.1|2093481_2094261_+	HNH endonuclease	NA	A0A2D1GPH3	Lactobacillus_phage	32.7	9.0e-15
WP_010926251.1|2094366_2094786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926252.1|2094763_2096533_+|terminase	terminase large subunit	terminase	A0A0U4B0M7	Pseudomonas_phage	74.2	5.9e-264
WP_010926253.1|2096529_2097825_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	59.5	1.1e-134
WP_010926254.1|2097836_2098712_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	60.2	4.5e-79
WP_010926255.1|2098716_2099916_+|capsid	phage major capsid protein	capsid	A0A2H4PI18	Pseudomonas_phage	56.1	2.2e-113
WP_010926256.1|2099965_2100199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926257.1|2100201_2100531_+|head,tail	phage gp6-like head-tail connector protein	head,tail	H2BDB3	Pseudomonas_virus	57.8	3.5e-21
WP_033452542.1|2100530_2100905_+|head,tail	head-tail adaptor protein	head,tail	H2BDB4	Pseudomonas_virus	50.8	2.0e-28
WP_155272940.1|2100970_2101126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926260.1|2101122_2101608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926261.1|2101607_2101979_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_010926262.1|2102041_2102539_+	hypothetical protein	NA	A0A2H4J511	uncultured_Caudovirales_phage	32.2	7.8e-12
WP_010926263.1|2102548_2102881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146090594.1|2103329_2103680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033452353.1|2103738_2106720_+|tail	phage tail tape measure protein	tail	A0A2H4J7J3	uncultured_Caudovirales_phage	31.9	2.0e-25
WP_010926267.1|2106721_2107069_+	hypothetical protein	NA	Q2NPH3	Xanthomonas_virus	33.3	2.5e-09
WP_010926268.1|2107070_2107547_+	DUF1833 family protein	NA	I7GYA2	Xanthomonas_virus	25.9	1.1e-10
WP_010926269.1|2107546_2107933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104442497.1|2108067_2111766_+	hypothetical protein	NA	A5A3R1	Burkholderia_phage	24.9	9.5e-46
WP_010926271.1|2111770_2112547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926272.1|2112543_2112933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033452351.1|2113019_2113463_+	hypothetical protein	NA	A0A0U5LBV3	unidentified_phage	40.0	4.3e-14
WP_010926274.1|2113459_2114008_+	hypothetical protein	NA	I6NSS1	Burkholderia_phage	53.4	9.1e-30
2115603:2115622	attR	TGCTGCATCATGGGAGTATG	NA	NA	NA	NA
>prophage 2
NZ_CP014013	Bordetella bronchiseptica strain FDAARGOS_176 chromosome, complete genome	5339230	2646774	2681291	5339230	terminase,integrase,tail	Pseudomonas_phage(17.24%)	47	2645883:2645898	2655764:2655779
2645883:2645898	attL	TGGCGATCGGACAGCT	NA	NA	NA	NA
WP_010926402.1|2646774_2647764_+|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	44.4	2.0e-75
WP_010926403.1|2647760_2647961_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010926405.1|2648073_2648739_-	hypothetical protein	NA	H2BDG4	Pseudomonas_virus	47.6	8.7e-51
WP_010926407.1|2650000_2650420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926408.1|2650508_2651156_-	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	41.4	1.2e-31
WP_010926409.1|2651152_2652139_-	recombinase RecT	NA	H9C0R8	Aeromonas_phage	57.8	4.0e-68
WP_010926410.1|2652142_2652325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926411.1|2652321_2652699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926412.1|2652701_2652911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926413.1|2652930_2653398_-	hypothetical protein	NA	Q3HQX1	Burkholderia_phage	70.5	8.0e-43
WP_010926414.1|2653433_2653676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004566311.1|2653872_2654895_-	P63C domain-containing protein	NA	Q8HA04	Enterobacteria_phage	51.9	3.9e-74
WP_010926415.1|2655033_2655663_-	S24 family peptidase	NA	NA	NA	NA	NA
WP_023853179.1|2656217_2656469_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
2655764:2655779	attR	AGCTGTCCGATCGCCA	NA	NA	NA	NA
WP_161781422.1|2656461_2657151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926418.1|2657168_2657423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926419.1|2657508_2657673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926420.1|2657760_2658069_+	DNA-binding protein	NA	A0A1S5NNI6	Burkholderia_phage	47.8	3.9e-14
WP_010926421.1|2658071_2658479_+	recombination protein NinB	NA	A0A0H5AUD0	Pseudomonas_phage	62.4	2.6e-29
WP_010926422.1|2658478_2658928_+	HNH endonuclease	NA	A0A2I7RKD9	Vibrio_phage	39.2	1.7e-21
WP_010926423.1|2658924_2659341_+	DUF1364 family protein	NA	A4JX58	Burkholderia_virus	42.9	1.4e-14
WP_004566303.1|2659340_2660165_+	hypothetical protein	NA	R9TJW3	Synechococcus_phage	45.3	1.9e-07
WP_004566302.1|2660161_2660533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004566301.1|2660529_2661471_+	AAA family ATPase	NA	A0A0U4B0G9	Pseudomonas_phage	36.5	8.5e-52
WP_004566300.1|2661467_2662151_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	50.0	4.9e-33
WP_004566298.1|2662347_2662788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004566297.1|2663105_2663477_+	DNA-binding protein	NA	A0A090DCM3	Clostridium_phage	36.7	6.2e-06
WP_004566296.1|2663463_2664741_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	64.2	9.2e-150
WP_004566295.1|2664743_2666162_+	DUF4055 domain-containing protein	NA	R9TF43	Synechococcus_phage	41.5	1.2e-97
WP_004566294.1|2666190_2667243_+	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	50.8	6.3e-96
WP_033448595.1|2667248_2667491_+	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	51.9	1.9e-16
WP_004566293.1|2667613_2668216_+	hypothetical protein	NA	R9TF81	Synechococcus_phage	44.3	5.5e-28
WP_003813425.1|2669219_2669477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004566291.1|2669539_2670022_+	hypothetical protein	NA	A0A2H4JE38	uncultured_Caudovirales_phage	38.5	2.6e-12
WP_004566290.1|2670023_2670224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004566289.1|2670223_2670619_+	hypothetical protein	NA	A0A2D2W284	Stenotrophomonas_phage	35.0	7.8e-07
WP_004566288.1|2670615_2671014_+	HK97 gp10 family phage protein	NA	S4SIM9	Salmonella_phage	44.9	2.1e-23
WP_004566287.1|2671010_2671433_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_004566286.1|2671440_2671941_+	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	45.1	7.5e-31
WP_157835999.1|2672041_2672197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003813414.1|2672195_2672711_+|tail	phage tail protein	tail	A0A1S5R1H0	Pseudomonas_phage	38.3	1.2e-23
WP_010926424.1|2672723_2673053_+|tail	phage tail assembly chaperone	tail	A0A2H4J121	uncultured_Caudovirales_phage	43.1	3.8e-15
WP_010926425.1|2673386_2675987_+|tail	phage tail tape measure protein	tail	A0A1V0E821	Vibrio_phage	36.4	4.5e-103
WP_010926426.1|2675996_2676356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033448593.1|2676422_2676956_+	DUF1833 family protein	NA	A0A0B5A6T7	Achromobacter_phage	56.5	1.2e-47
WP_004566282.1|2676952_2677342_+	C40 family peptidase	NA	A0A0G3EYJ9	Achromobacter_phage	49.2	3.3e-34
WP_004566281.1|2677334_2681291_+	DUF1983 domain-containing protein	NA	A0A0B5A1N2	Achromobacter_phage	41.1	1.2e-219
>prophage 3
NZ_CP014013	Bordetella bronchiseptica strain FDAARGOS_176 chromosome, complete genome	5339230	3532601	3540661	5339230	tRNA	uncultured_Mediterranean_phage(28.57%)	9	NA	NA
WP_010926718.1|3532601_3533480_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	49.5	4.6e-15
WP_010928874.1|3533497_3534277_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.9	4.8e-32
WP_003811017.1|3534261_3535020_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.2	6.2e-69
WP_023852762.1|3535157_3535793_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003811013.1|3535837_3536878_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	51.6	9.3e-92
WP_003811011.1|3537012_3538305_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.0	1.7e-66
WP_003811009.1|3538510_3539536_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010926719.1|3539671_3540055_+	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	25.8	8.1e-09
WP_003811006.1|3540073_3540661_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	46.8	2.1e-16
>prophage 4
NZ_CP014013	Bordetella bronchiseptica strain FDAARGOS_176 chromosome, complete genome	5339230	4042743	4060748	5339230	terminase,tail	Pseudomonas_phage(21.05%)	26	NA	NA
WP_004566282.1|4042743_4043133_-	C40 family peptidase	NA	A0A0G3EYJ9	Achromobacter_phage	49.2	3.3e-34
WP_033448593.1|4043129_4043663_-	DUF1833 family protein	NA	A0A0B5A6T7	Achromobacter_phage	56.5	1.2e-47
WP_010926426.1|4043729_4044089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926425.1|4044098_4046699_-|tail	phage tail tape measure protein	tail	A0A1V0E821	Vibrio_phage	36.4	4.5e-103
WP_003813411.1|4046726_4047017_-	DUF1799 domain-containing protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	41.9	6.3e-14
WP_010926424.1|4047034_4047364_-|tail	phage tail assembly chaperone	tail	A0A2H4J121	uncultured_Caudovirales_phage	43.1	3.8e-15
WP_003813414.1|4047376_4047892_-|tail	phage tail protein	tail	A0A1S5R1H0	Pseudomonas_phage	38.3	1.2e-23
WP_157835999.1|4047890_4048046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004566286.1|4048146_4048647_-	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	45.1	7.5e-31
WP_004566287.1|4048654_4049077_-	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_004566288.1|4049073_4049472_-	HK97 gp10 family phage protein	NA	S4SIM9	Salmonella_phage	44.9	2.1e-23
WP_004566289.1|4049468_4049864_-	hypothetical protein	NA	A0A2D2W284	Stenotrophomonas_phage	35.0	7.8e-07
WP_004566290.1|4049863_4050064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004566291.1|4050065_4050548_-	hypothetical protein	NA	A0A2H4JE38	uncultured_Caudovirales_phage	38.5	2.6e-12
WP_003813425.1|4050610_4050868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004566292.1|4050877_4051846_-	hypothetical protein	NA	R9TJ64	Synechococcus_phage	71.7	6.6e-124
WP_004566293.1|4051872_4052475_-	hypothetical protein	NA	R9TF81	Synechococcus_phage	44.3	5.5e-28
WP_033448595.1|4052598_4052841_-	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	51.9	1.9e-16
WP_004566294.1|4052846_4053899_-	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	50.8	6.3e-96
WP_004566295.1|4053927_4055346_-	DUF4055 domain-containing protein	NA	R9TF43	Synechococcus_phage	41.5	1.2e-97
WP_004566296.1|4055348_4056626_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	64.2	9.2e-150
WP_004566297.1|4056612_4056984_-	DNA-binding protein	NA	A0A090DCM3	Clostridium_phage	36.7	6.2e-06
WP_004566298.1|4057301_4057742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004566301.1|4058617_4059559_-	AAA family ATPase	NA	A0A0U4B0G9	Pseudomonas_phage	36.5	8.5e-52
WP_004566302.1|4059555_4059927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004566303.1|4059923_4060748_-	hypothetical protein	NA	R9TJW3	Synechococcus_phage	45.3	1.9e-07
>prophage 5
NZ_CP014013	Bordetella bronchiseptica strain FDAARGOS_176 chromosome, complete genome	5339230	4139944	4179656	5339230	tail,holin,capsid,plate,integrase,transposase,tRNA	Pseudomonas_phage(29.41%)	50	4130501:4130519	4185515:4185533
4130501:4130519	attL	GCCGGCGTTGTTGACCAGC	NA	NA	NA	NA
WP_010926868.1|4139944_4141300_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_162835035.1|4141359_4141683_-	DUF3325 family protein	NA	NA	NA	NA	NA
WP_003813605.1|4141690_4143325_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_033447956.1|4143321_4143603_-	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_010926869.1|4143875_4144877_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JE37	uncultured_Caudovirales_phage	31.4	1.0e-23
WP_010926870.1|4144879_4145671_-	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	76.7	1.2e-123
WP_010926871.1|4145845_4146199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104442495.1|4146452_4147253_-|tail	phage tail protein	tail	A0A0A8J8U5	Ralstonia_phage	36.9	6.2e-27
WP_010926874.1|4147249_4147828_-	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	36.5	1.3e-29
WP_033452121.1|4147824_4148892_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	44.2	2.1e-75
WP_010926876.1|4148891_4149242_-	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	63.5	9.9e-30
WP_010926877.1|4149305_4149947_-|plate	phage baseplate assembly protein	plate	F6MIL4	Haemophilus_phage	45.6	2.5e-39
WP_010926878.1|4149936_4151040_-|tail	tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	43.3	2.1e-73
WP_010926879.1|4151023_4152283_-	DNA circularization N-terminal domain-containing protein	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	33.2	8.5e-55
WP_010926880.1|4152282_4154487_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	42.9	3.9e-87
WP_010926882.1|4154630_4155023_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_010926883.1|4155019_4155394_-	hypothetical protein	NA	A0A2H4J9F8	uncultured_Caudovirales_phage	41.6	2.4e-18
WP_010926884.1|4155409_4156837_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A2H4JFT7	uncultured_Caudovirales_phage	40.0	1.6e-73
WP_010926885.1|4156842_4157025_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_104442499.1|4157024_4157684_-	DUF1834 family protein	NA	NA	NA	NA	NA
WP_033452139.1|4157716_4158145_-	DUF1320 domain-containing protein	NA	A0A2D1GNP0	Pseudomonas_phage	35.9	3.0e-12
WP_010926888.1|4158245_4158518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926889.1|4158589_4159537_-|capsid	major capsid protein	capsid	G8GWE7	Rhodobacter_phage	47.6	5.0e-76
WP_010926890.1|4159592_4159952_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_010926891.1|4159997_4161005_-	hypothetical protein	NA	Q5ZQY0	Pseudomonas_phage	53.5	3.5e-35
WP_010926892.1|4161239_4161797_-	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	33.5	1.1e-09
WP_010926893.1|4161938_4163279_-|capsid	minor capsid protein	capsid	A0A0M4UTA3	Ralstonia_phage	40.1	1.1e-63
WP_104442500.1|4163271_4164726_-	DUF935 family protein	NA	Q5ZQY4	Pseudomonas_phage	56.2	1.6e-145
WP_010926895.1|4164806_4166489_-	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	47.7	1.2e-120
WP_010926896.1|4166488_4167040_-	DUF3486 family protein	NA	J9SH37	Pseudomonas_phage	54.3	1.6e-29
WP_010926897.1|4167043_4167343_-	hypothetical protein	NA	J9SNG3	Pseudomonas_phage	61.2	3.4e-23
WP_010926898.1|4167353_4167650_-	DUF2730 family protein	NA	J9STR5	Pseudomonas_phage	44.7	2.9e-14
WP_010926900.1|4167752_4168169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033452133.1|4168165_4168798_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	61.7	1.3e-67
WP_010926902.1|4168800_4169181_-|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	61.9	9.1e-29
WP_010926904.1|4169766_4170378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085963112.1|4170381_4170822_-	helix-turn-helix transcriptional regulator	NA	Q6QID2	Burkholderia_phage	43.4	4.8e-21
WP_010926906.1|4170923_4171148_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_033452116.1|4171308_4171785_+	hypothetical protein	NA	A0A0S4L5L2	Pseudomonas_phage	48.1	9.7e-36
WP_010926908.1|4171781_4172087_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	51.0	3.3e-21
WP_010926909.1|4172105_4172999_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	53.6	3.9e-70
WP_010926910.1|4173001_4174777_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	52.7	2.1e-176
WP_010926911.1|4174787_4175972_+	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	52.2	2.5e-101
WP_010926912.1|4175962_4176283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104442501.1|4176485_4177085_+	hypothetical protein	NA	A0A0M5MXL4	Ralstonia_phage	55.0	5.6e-49
WP_010926915.1|4177081_4177702_+	DUF3164 family protein	NA	Q6QIE4	Burkholderia_phage	58.6	3.9e-61
WP_010926916.1|4177821_4178103_+	HU family DNA-binding protein	NA	Q6QIE5	Burkholderia_phage	46.1	5.7e-12
WP_146090596.1|4178163_4178565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926918.1|4178644_4179061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926919.1|4179065_4179656_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	55.6	1.5e-30
4185515:4185533	attR	GCTGGTCAACAACGCCGGC	NA	NA	NA	NA
