The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014028	Achromobacter xylosoxidans strain FDAARGOS_150 chromosome, complete genome	6268754	2221189	2288723	6268754	tail,tRNA	Burkholderia_virus(19.05%)	59	NA	NA
WP_006385759.1|2221189_2221960_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_006385758.1|2221959_2222901_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_006385757.1|2222911_2223112_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_006385756.1|2223362_2223680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006385755.1|2223726_2224173_+	peptidoglycan-binding protein LysM	NA	G3MBQ1	Bacillus_virus	50.7	1.2e-06
WP_020926210.1|2224351_2225758_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_006385753.1|2225864_2226707_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_020926208.1|2226708_2226975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104413533.1|2227192_2227771_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.1	1.8e-07
WP_054497343.1|2227788_2228409_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_104413534.1|2228477_2230502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104413535.1|2230690_2231650_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_006385747.1|2231757_2232789_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2H4UUK0	Bodo_saltans_virus	27.2	5.2e-26
WP_104413536.1|2232794_2234270_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_104413537.1|2234368_2235304_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104413538.1|2235433_2236792_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_104413539.1|2236788_2238135_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_104413540.1|2238131_2240054_-	type I secretion system permease/ATPase	NA	A0A2R8FG22	Brazilian_cedratvirus	32.9	3.7e-17
WP_026383872.1|2240185_2240794_-	heme acquisition protein HasAp	NA	NA	NA	NA	NA
WP_104414487.1|2240933_2244101_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_054439179.1|2244347_2245703_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_006385738.1|2245706_2245967_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_104413541.1|2246101_2247121_-	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_006385736.1|2247193_2247700_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_104413542.1|2247891_2248731_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020926192.1|2248987_2250004_+	2-dehydro-3-deoxygalactonokinase	NA	NA	NA	NA	NA
WP_024070515.1|2250000_2250654_+	2-dehydro-3-deoxy-6-phosphogalactonate aldolase	NA	NA	NA	NA	NA
WP_006391563.1|2250650_2251799_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	37.0	3.3e-58
WP_054482533.1|2251831_2253142_+	MFS transporter	NA	NA	NA	NA	NA
WP_006385730.1|2253374_2254085_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	24.5	4.8e-07
WP_054482532.1|2254081_2255470_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_104413543.1|2255480_2256941_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006385726.1|2259168_2260368_-	MFS transporter	NA	NA	NA	NA	NA
WP_104413544.1|2260805_2262695_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.4	1.2e-118
WP_104414488.1|2262896_2264300_-	DKNYY domain-containing protein	NA	NA	NA	NA	NA
WP_104413545.1|2264451_2265843_+	purine permease	NA	H9YQ34	environmental_Halophage	48.9	1.8e-26
WP_104414489.1|2266326_2266626_-	YXWGXW repeat-containing protein	NA	NA	NA	NA	NA
WP_006385707.1|2266941_2267958_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.0	5.0e-66
WP_006385706.1|2268157_2268439_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_006385705.1|2268787_2269723_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_006385704.1|2269775_2270975_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006385703.1|2271005_2271824_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	49.3	1.4e-10
WP_053497395.1|2271842_2272772_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104413546.1|2272913_2273510_-|tail	tail assembly protein	tail	C7BGD3	Burkholderia_phage	52.5	1.6e-48
WP_024070527.1|2273506_2273743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054505328.1|2273723_2274089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104414490.1|2274093_2277597_-	host specificity protein J	NA	A4JX16	Burkholderia_virus	45.4	1.7e-262
WP_006385697.1|2277722_2278328_-|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	55.7	1.0e-50
WP_006385696.1|2278324_2279104_-	C40 family peptidase	NA	Q3HQU3	Burkholderia_phage	47.3	1.5e-65
WP_054472580.1|2279106_2279835_-|tail	phage minor tail protein L	tail	A4JX13	Burkholderia_virus	56.6	1.7e-68
WP_054486041.1|2279837_2282474_-|tail	tail fiber domain-containing protein	tail	A0A1B1IX43	uncultured_Mediterranean_phage	42.9	4.7e-15
WP_054472578.1|2282479_2282818_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	48.6	6.4e-26
WP_054497359.1|2282820_2284107_-|tail	phage tail tape measure protein	tail	A0A1W6JP49	Morganella_phage	30.3	2.2e-13
WP_054439099.1|2284164_2284455_-	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	48.2	2.7e-12
WP_006385690.1|2284454_2284928_-|tail	tail protein	tail	A4JX08	Burkholderia_virus	44.4	1.4e-26
WP_006385689.1|2284933_2285401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102949899.1|2285651_2286221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104413547.1|2286595_2287213_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_104413548.1|2287265_2288723_-	DUF1254 domain-containing protein	NA	M1IA53	Paramecium_bursaria_Chlorella_virus	35.6	1.4e-64
>prophage 2
NZ_CP014028	Achromobacter xylosoxidans strain FDAARGOS_150 chromosome, complete genome	6268754	4698222	4758968	6268754	tail,protease,plate,integrase,tRNA	Burkholderia_phage(24.0%)	70	4690084:4690104	4754632:4754652
4690084:4690104	attL	TGGTGGCCGACCTGGTCGACG	NA	NA	NA	NA
WP_020924482.1|4698222_4699683_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_006388441.1|4699952_4701026_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	47.3	1.0e-77
WP_024068245.1|4701124_4702534_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_006388443.1|4702801_4704301_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_104414048.1|4704313_4705417_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_024068248.1|4705422_4706652_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_104414049.1|4706746_4708186_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_006388447.1|4708182_4708500_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_024068250.1|4708504_4709623_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_006388449.1|4709808_4710684_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_024068252.1|4710754_4711744_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_006388451.1|4711935_4712856_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	31.5	3.1e-30
WP_006388452.1|4712868_4713987_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_024068253.1|4714109_4714928_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_006388454.1|4714989_4715601_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_104414050.1|4715762_4717139_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.7	2.6e-110
WP_047992310.1|4717195_4717654_+	cytochrome c	NA	NA	NA	NA	NA
WP_104414051.1|4717781_4718474_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_049050990.1|4718583_4718865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104414052.1|4719708_4720068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054496619.1|4720252_4720765_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_104414053.1|4720928_4721633_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_006388463.1|4721790_4722912_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_006388464.1|4723080_4723302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104414054.1|4723375_4725193_-	DUF4153 domain-containing protein	NA	NA	NA	NA	NA
WP_006388466.1|4725197_4725959_-	S24 family peptidase	NA	NA	NA	NA	NA
WP_006388467.1|4726268_4726526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006388468.1|4727018_4727612_+	hypothetical protein	NA	A9YX29	Burkholderia_phage	46.6	7.5e-46
WP_104414055.1|4727622_4729098_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	46.6	1.3e-107
WP_006388470.1|4729111_4729552_+	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	54.1	3.1e-36
WP_024068262.1|4729555_4730005_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	36.5	1.1e-17
WP_104414056.1|4730182_4731856_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_026384173.1|4731848_4732448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104414057.1|4732457_4732757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054437471.1|4732776_4733787_+	hypothetical protein	NA	A9YX04	Burkholderia_phage	50.3	4.8e-77
WP_104414058.1|4733821_4734565_+	hypothetical protein	NA	A9YX06	Burkholderia_phage	63.9	6.7e-84
WP_104414059.1|4734573_4734927_+	hypothetical protein	NA	A9YX11	Burkholderia_phage	66.7	4.6e-35
WP_054437229.1|4734923_4736105_+|plate	baseplate J/gp47 family protein	plate	A9YX12	Burkholderia_phage	62.6	9.8e-130
WP_049051000.1|4736106_4736772_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	60.6	1.2e-73
WP_123767403.1|4737797_4738019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104414060.1|4738278_4738629_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_104414061.1|4738631_4739654_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JE37	uncultured_Caudovirales_phage	32.3	4.8e-24
WP_164497481.1|4739809_4740301_+	hypothetical protein	NA	A0A0U5LBV3	unidentified_phage	37.2	6.3e-14
WP_070540838.1|4740290_4740821_+	hypothetical protein	NA	A0A2H4JFP9	uncultured_Caudovirales_phage	57.4	7.0e-43
WP_053499902.1|4740801_4741074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104414062.1|4741416_4742994_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_049050695.1|4743028_4743289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049050696.1|4743460_4744369_+	aromatic amino acid DMT transporter YddG	NA	NA	NA	NA	NA
WP_006388489.1|4744387_4744579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053500134.1|4744826_4745081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006388491.1|4745210_4745402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049050697.1|4745566_4746478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172965887.1|4746832_4747915_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J8E5	uncultured_Caudovirales_phage	29.8	1.5e-23
WP_104414063.1|4747889_4748177_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_104414064.1|4748173_4748887_-	hypothetical protein	NA	O03965	Myxococcus_phage	45.8	3.2e-51
WP_104414065.1|4748879_4749923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054481222.1|4749926_4750208_-	hypothetical protein	NA	K4JS57	Caulobacter_phage	34.9	4.8e-11
WP_054481219.1|4750210_4750684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104414066.1|4750683_4751436_-	hypothetical protein	NA	H2BD37	Pseudomonas_phage	42.5	1.5e-19
WP_049054998.1|4751432_4751798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054481213.1|4751923_4752538_-	3'-5' exonuclease	NA	I3PUZ1	Vibrio_phage	50.5	5.8e-49
WP_104414067.1|4752553_4754338_-	AAA family ATPase	NA	J7HXJ7	Pseudomonas_phage	37.3	4.2e-84
WP_172965938.1|4754347_4754674_-	hypothetical protein	NA	A0A1Y0SUG1	Pseudomonas_phage	59.0	7.3e-11
4754632:4754652	attR	CGTCGACCAGGTCGGCCACCA	NA	NA	NA	NA
WP_172965888.1|4755523_4756738_-	hypothetical protein	NA	J7HXB6	Pseudomonas_phage	53.7	9.3e-67
WP_104414069.1|4756740_4756962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104414070.1|4756977_4757781_-	PD-(D/E)XK nuclease family protein	NA	J7HXJ4	Pseudomonas_phage	51.0	1.7e-69
WP_104414071.1|4757795_4757984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104414072.1|4757980_4758265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104414073.1|4758261_4758471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104414074.1|4758467_4758968_-	hypothetical protein	NA	A0A0S3UG68	Pseudomonas_phage	49.7	8.6e-35
>prophage 4
NZ_CP014028	Achromobacter xylosoxidans strain FDAARGOS_150 chromosome, complete genome	6268754	5653120	5661055	6268754	tRNA	Moraxella_phage(33.33%)	9	NA	NA
WP_104414270.1|5653120_5653708_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	36.8	9.2e-20
WP_006388150.1|5653741_5654116_-	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	27.8	1.9e-10
WP_006388151.1|5654313_5655336_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_104414271.1|5655714_5656071_+	VOC family protein	NA	NA	NA	NA	NA
WP_006388153.1|5656155_5657448_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.3	5.4e-65
WP_006388154.1|5657556_5658588_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	51.6	1.4e-92
WP_104414272.1|5658657_5659299_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_020927471.1|5659487_5660246_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.6	1.5e-67
WP_006388157.1|5660290_5661055_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.2	2.3e-31
