The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014031	Hafnia paralvei strain FDAARGOS_158 chromosome, complete genome	4513714	2732701	2813974	4513714	tRNA,holin,tail,terminase,integrase,portal,plate,protease	Vibrio_phage(19.61%)	84	2716220:2716234	2750649:2750663
2716220:2716234	attL	CGGTAATCACACCAT	NA	NA	NA	NA
WP_061059828.1|2732701_2733883_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GN00	Marinobacter_phage	30.9	1.2e-31
WP_061059829.1|2733883_2734102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061059830.1|2734156_2734774_-	3'-5' exoribonuclease	NA	A0A0H4IPM9	Stenotrophomonas_phage	32.8	4.8e-19
WP_061059831.1|2734929_2735124_-	hypothetical protein	NA	A0A1B0VN94	Pseudomonas_phage	71.8	3.3e-11
WP_105375265.1|2735123_2735600_-	hypothetical protein	NA	H2BDF1	Pseudomonas_virus	58.0	3.9e-13
WP_105375266.1|2735604_2736261_-	hypothetical protein	NA	A0A076G7C3	Sinorhizobium_phage	37.9	7.8e-28
WP_061059833.1|2736250_2736724_-	hypothetical protein	NA	A0A2H4J7V6	uncultured_Caudovirales_phage	40.0	5.8e-17
WP_167390519.1|2737033_2737186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174705396.1|2737483_2738143_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	66.8	3.4e-79
WP_061059835.1|2738237_2738441_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	70.2	6.6e-18
WP_061059836.1|2738465_2738999_+	hypothetical protein	NA	A0A0P0ZE62	Stx2-converting_phage	33.3	1.4e-14
WP_061059837.1|2739179_2739359_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_061059838.1|2739355_2740312_+	conserved phage C-terminal domain-containing protein	NA	U5P0A0	Shigella_phage	73.7	2.0e-32
WP_061059839.1|2740308_2740581_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_061059840.1|2740583_2741237_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	71.9	3.1e-93
WP_061059841.1|2741233_2741986_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	86.0	2.8e-130
WP_061059842.1|2741993_2742371_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	62.7	2.0e-36
WP_094189196.1|2742367_2743372_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	44.9	2.3e-79
WP_061059844.1|2743392_2744088_+	hypothetical protein	NA	A0A1W6JP37	Morganella_phage	37.8	1.2e-39
WP_061059845.1|2745174_2745348_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	63.2	1.2e-12
WP_061059846.1|2745398_2745806_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	61.4	2.6e-37
WP_061059847.1|2745898_2746723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046450008.1|2746948_2747281_+|holin	phage holin, lambda family	holin	Q2A0C6	Sodalis_phage	42.2	3.7e-18
WP_061059848.1|2747290_2747905_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	83.8	9.4e-92
WP_061059849.1|2747901_2748444_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	43.9	2.0e-29
WP_004092442.1|2749214_2749709_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	65.2	3.2e-50
WP_061059851.1|2749708_2751838_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	71.7	6.0e-295
2750649:2750663	attR	ATGGTGTGATTACCG	NA	NA	NA	NA
WP_046360410.1|2751834_2752050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061059852.1|2752058_2753597_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	53.1	5.9e-151
WP_061059853.1|2753544_2755593_+|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	54.9	6.1e-196
WP_061059854.1|2755670_2756021_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	40.5	5.1e-10
WP_061059855.1|2756020_2756380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061059856.1|2756381_2757041_+	hypothetical protein	NA	R9TR34	Vibrio_phage	33.8	6.2e-17
WP_061059857.1|2757050_2757590_+	hypothetical protein	NA	R9TNK0	Vibrio_phage	29.5	3.7e-15
WP_105375267.1|2757582_2758197_+|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	39.4	7.9e-14
WP_061059858.1|2758233_2759697_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	42.8	8.0e-73
WP_004092422.1|2759696_2760203_+|tail	phage major tail tube protein	tail	Q75QK9	Wolbachia_phage	31.8	4.5e-15
WP_061059859.1|2760260_2760557_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_061059860.1|2760659_2762435_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	28.1	7.1e-23
WP_061059861.1|2762434_2762911_+|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	37.1	4.5e-17
WP_061059862.1|2762885_2763101_+|tail	tail protein X	tail	R9TR63	Vibrio_phage	50.0	5.3e-10
WP_061059863.1|2763104_2764220_+	late control protein D	NA	R9TNM7	Vibrio_phage	34.1	4.9e-38
WP_004092416.1|2764253_2764604_+	GPW/gp25 family protein	NA	D4HTV2	Vibrio_phage	51.4	2.8e-24
WP_105375268.1|2764587_2765502_+|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	46.4	4.1e-67
WP_061059864.1|2765494_2766046_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	43.3	4.1e-30
WP_105375269.1|2766038_2767607_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	39.3	1.0e-65
WP_061059865.1|2767606_2768194_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	46.0	1.1e-44
WP_061059866.1|2768253_2769189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061059867.1|2769525_2769903_+	hypothetical protein	NA	Q6UAV9	Klebsiella_phage	50.4	2.2e-27
WP_061059868.1|2769942_2770203_-	DinI-like family protein	NA	NA	NA	NA	NA
WP_008813937.1|2770595_2772380_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_035502208.1|2772410_2772638_-	YejL family protein	NA	NA	NA	NA	NA
WP_004089548.1|2772848_2773856_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.8	3.9e-87
WP_004089547.1|2773947_2774232_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_008813935.1|2774377_2776138_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.6	1.3e-98
WP_008813934.1|2776162_2776402_-	YecH family protein	NA	NA	NA	NA	NA
WP_061059869.1|2776698_2777421_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_161800584.1|2777502_2778720_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.3	3.7e-23
WP_008813931.1|2779666_2780047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061059870.1|2780173_2781787_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	30.2	1.9e-19
WP_061059871.1|2781788_2782811_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_061059872.1|2782810_2783908_-	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_061059873.1|2783918_2785745_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_061059874.1|2785994_2787578_-	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_061059875.1|2787866_2788508_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_008813924.1|2788682_2789630_+	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_061059876.1|2789690_2791934_-	mechanosensitive channel protein	NA	NA	NA	NA	NA
WP_004089509.1|2792183_2792906_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	40.6	2.5e-35
WP_004089507.1|2792902_2793571_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_008813922.1|2793798_2794542_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_008813921.1|2794976_2795411_-	NUDIX domain-containing protein	NA	A0A1L7N1W6	Ralstonia_phage	38.6	5.2e-12
WP_061059877.1|2795671_2796805_+	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_004089482.1|2796807_2797746_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_061059878.1|2797760_2799452_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_061059879.1|2799520_2800378_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	32.2	9.9e-23
WP_061059881.1|2801289_2802378_-	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_008813916.1|2803046_2803487_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	43.0	1.4e-20
WP_061059882.1|2803805_2804669_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008813915.1|2804886_2806371_+	amino acid permease	NA	NA	NA	NA	NA
WP_008813914.1|2806604_2807759_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004089621.1|2807816_2808899_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_008813912.1|2808895_2809684_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.2	4.2e-12
WP_061059883.1|2809891_2811853_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	35.8	5.6e-13
WP_004089614.1|2811919_2813974_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.9	1.8e-54
>prophage 2
NZ_CP014031	Hafnia paralvei strain FDAARGOS_158 chromosome, complete genome	4513714	3415654	3429688	4513714	tRNA	Tupanvirus(33.33%)	14	NA	NA
WP_008813432.1|3415654_3417637_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.4	9.6e-21
WP_174705401.1|3417636_3418635_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.5	2.2e-37
WP_008813430.1|3418645_3419794_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	C7U074	Ostreococcus_tauri_virus	29.6	4.1e-24
WP_061060451.1|3420076_3420847_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2K9L407	Tupanvirus	23.6	1.4e-07
WP_174705402.1|3420856_3421882_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_008813427.1|3421917_3422115_-	protein DsrB	NA	NA	NA	NA	NA
WP_004089944.1|3422197_3422494_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	3.2e-13
WP_061060073.1|3422498_3424886_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	28.9	5.1e-08
WP_008813425.1|3424900_3425884_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.0	1.3e-34
WP_123912837.1|3426174_3426219_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004089950.1|3426517_3426874_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004089951.1|3426916_3427114_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_025801265.1|3427212_3427755_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	8.8e-17
WP_008813424.1|3427750_3429688_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.9	9.4e-130
>prophage 4
NZ_CP014031	Hafnia paralvei strain FDAARGOS_158 chromosome, complete genome	4513714	3794528	3804505	4513714		Ralstonia_phage(66.67%)	6	NA	NA
WP_174705376.1|3794528_3795401_-	hypothetical protein	NA	A0A077K9W3	Ralstonia_phage	34.9	7.3e-05
WP_061060178.1|3795400_3796273_-	hypothetical protein	NA	A0A077K9W3	Ralstonia_phage	34.9	7.3e-05
WP_174705377.1|3796272_3797136_-	hypothetical protein	NA	A0A077K9W3	Ralstonia_phage	33.1	1.4e-05
WP_094189185.1|3797149_3799288_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	26.6	6.7e-36
WP_061060182.1|3799277_3801809_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	8.8e-19
WP_061060183.1|3801802_3804505_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.4	1.1e-91
>prophage 5
NZ_CP014031	Hafnia paralvei strain FDAARGOS_158 chromosome, complete genome	4513714	3903414	3911356	4513714	tRNA	Escherichia_phage(66.67%)	6	NA	NA
WP_008812997.1|3903414_3904029_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.2	7.8e-30
WP_061060203.1|3904142_3905003_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.5	3.3e-26
WP_008812995.1|3905004_3905622_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	5.2e-74
WP_105375297.1|3905632_3908077_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	1.3e-216
WP_004095796.1|3908611_3909904_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.8	4.0e-92
WP_008812992.1|3910012_3911356_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.3	1.5e-78
>prophage 6
NZ_CP014031	Hafnia paralvei strain FDAARGOS_158 chromosome, complete genome	4513714	4416022	4453454	4513714	tail,terminase,integrase,portal,plate,protease	Vibrio_phage(28.12%)	45	4413809:4413837	4453556:4453584
4413809:4413837	attL	GGGTTCAAATCCCCCCAGCTCCACCAAAT	NA	NA	NA	NA
WP_061060336.1|4416022_4418989_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	34.7	3.9e-82
WP_061060337.1|4418985_4420779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061060338.1|4421363_4421909_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_070716478.1|4421927_4422443_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	39.4	5.2e-27
WP_094189190.1|4422450_4423983_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	29.0	2.5e-37
WP_061060340.1|4423975_4424527_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	43.3	3.2e-30
WP_061060341.1|4424519_4425434_-|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	46.7	1.8e-67
WP_061060342.1|4425417_4425768_-	GPW/gp25 family protein	NA	D4HTV2	Vibrio_phage	50.5	8.1e-24
WP_061060343.1|4425801_4426926_-	late control protein D	NA	R9TNM7	Vibrio_phage	35.0	3.1e-40
WP_061060344.1|4426929_4427145_-|tail	tail protein X	tail	R9TR63	Vibrio_phage	48.6	7.0e-10
WP_061060345.1|4427119_4427596_-|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	37.1	3.5e-17
WP_061060346.1|4427595_4429371_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	28.1	2.4e-23
WP_061059859.1|4429473_4429770_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_004092422.1|4429827_4430334_-|tail	phage major tail tube protein	tail	Q75QK9	Wolbachia_phage	31.8	4.5e-15
WP_061060347.1|4430333_4431797_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	42.8	1.8e-72
WP_061060348.1|4431833_4432448_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	38.6	7.9e-14
WP_061060349.1|4432440_4432980_-	hypothetical protein	NA	R9TNK0	Vibrio_phage	30.1	2.1e-15
WP_061060350.1|4432989_4433649_-	hypothetical protein	NA	R9TR34	Vibrio_phage	33.8	8.2e-17
WP_061060351.1|4433650_4434010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061060352.1|4434009_4434360_-	DUF2190 family protein	NA	S5MQJ5	Escherichia_phage	38.6	1.1e-09
WP_061060353.1|4434437_4436486_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	54.1	1.8e-195
WP_061060354.1|4436433_4437972_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	52.9	5.9e-151
WP_004092438.1|4437980_4438196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061060355.1|4438192_4440322_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	71.7	7.8e-295
WP_004092442.1|4440321_4440816_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	65.2	3.2e-50
WP_061060356.1|4441030_4441234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061060357.1|4441345_4441870_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_061060358.1|4441866_4442397_-	lysozyme	NA	A0A2R2Z343	Escherichia_phage	71.8	4.0e-67
WP_061060359.1|4442851_4443322_+	2TM domain-containing protein	NA	NA	NA	NA	NA
WP_061060360.1|4443495_4443915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061060361.1|4444055_4444463_-	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	62.1	3.0e-38
WP_061059845.1|4444513_4444687_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	63.2	1.2e-12
WP_061060362.1|4444824_4445088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061060363.1|4445198_4445894_-	hypothetical protein	NA	A0A1W6JP37	Morganella_phage	37.8	7.2e-40
WP_061060364.1|4445914_4446913_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	45.3	1.8e-79
WP_061060365.1|4446909_4447557_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	72.9	3.6e-94
WP_061060366.1|4447559_4447832_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_061060367.1|4447828_4448785_-	conserved phage C-terminal domain-containing protein	NA	U5P0A0	Shigella_phage	73.1	7.6e-32
WP_061059837.1|4448781_4448961_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_061060368.1|4449141_4449675_-	hypothetical protein	NA	A0A0P0ZE62	Stx2-converting_phage	33.3	1.4e-14
WP_071887127.1|4449699_4449927_-	helix-turn-helix transcriptional regulator	NA	K7PMD5	Enterobacterial_phage	69.1	1.3e-22
WP_061060369.1|4450036_4450690_+	LexA family transcriptional regulator	NA	K7PH71	Enterobacterial_phage	70.7	2.5e-82
WP_061060370.1|4451058_4451442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061060371.1|4451434_4452052_+	3'-5' exoribonuclease	NA	R9TPV7	Vibrio_phage	32.2	5.3e-18
WP_061060372.1|4452272_4453454_+|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	69.8	2.1e-156
4453556:4453584	attR	GGGTTCAAATCCCCCCAGCTCCACCAAAT	NA	NA	NA	NA
