The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014270	Escherichia coli K-12 strain K-12 DHB4 chromosome, complete genome	4546849	221738	272063	4546849	integrase,transposase	Streptococcus_phage(20.0%)	55	236224:236283	252816:252875
WP_000006255.1|221738_222236_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|222459_224199_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|224143_224929_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|224999_226055_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|226106_226400_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|226402_226801_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|226810_227263_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|227568_227835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|227767_228304_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|228360_229818_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|230078_230537_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|230628_231873_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|231930_232332_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|232370_233426_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|233713_234817_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|234828_236082_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
236224:236283	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|236653_236995_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|237015_237333_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|237351_237573_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|237581_238058_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|238073_238532_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|238629_238869_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|238945_239413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|239435_239879_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|239878_240106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|240509_241331_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|241422_242286_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|242614_243508_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|243928_245080_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|247426_248443_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001214248.1|248829_249528_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|249554_250409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|250527_250752_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|250748_251189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|251305_252706_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_001111342.1|252990_253401_-	hypothetical protein	NA	NA	NA	NA	NA
252816:252875	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000121359.1|253379_254336_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|254345_256544_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000643333.1|256540_257497_-	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000070700.1|257493_258183_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|258600_259215_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|259462_259792_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001350485.1|260104_260815_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001310578.1|260783_262427_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131096.1|262416_264942_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000716398.1|264967_265636_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|265693_266281_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001301257.1|266355_266898_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147279.1|267721_267949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|267983_268124_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|268123_268387_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|268750_268852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000020224.1|269966_270854_+	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_000169527.1|270900_271200_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|271196_272063_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
>prophage 2
NZ_CP014270	Escherichia coli K-12 strain K-12 DHB4 chromosome, complete genome	4546849	437798	500757	4546849	integrase,transposase,protease,lysis,tRNA,terminase	Enterobacteria_phage(50.0%)	66	483415:483461	504717:504763
WP_001295836.1|437798_438422_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|438392_439079_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|439075_441490_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|441920_446201_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|446240_446609_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|447299_447560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|448791_449886_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|449954_450881_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|451110_451593_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|451670_452486_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|452575_454357_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|454369_455146_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|455245_456124_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|456292_457747_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|457806_459168_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|459224_460526_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|460547_461693_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|461920_462706_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|462716_463952_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|463973_465023_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|465339_467007_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|467016_468276_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|468286_469102_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|469098_469992_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|470186_471254_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|471250_471760_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|471877_472600_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|472602_473097_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|473270_474656_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|474691_475213_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|475320_475533_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|475534_476401_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|476871_477414_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|477633_478326_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|478356_480960_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|480938_481979_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|481989_482505_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|482507_483140_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
483415:483461	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|483474_484638_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|484757_485021_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|485343_485439_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000169527.1|485501_485801_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|485797_486664_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001070439.1|486974_487307_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|487354_487504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|487561_489088_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|489552_490104_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|490113_490911_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|491027_491129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|491125_491581_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|491580_491751_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|491743_492034_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|492030_492393_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|492389_492530_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|492615_492999_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|493396_494413_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|494417_495485_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|496057_496273_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|496272_496770_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|496986_497169_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|497259_497553_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|497843_498254_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|498539_498746_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|498910_499105_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|499493_500039_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|500013_500757_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
504717:504763	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP014270	Escherichia coli K-12 strain K-12 DHB4 chromosome, complete genome	4546849	1301180	1341998	4546849	integrase,transposase,lysis,tail,tRNA	Escherichia_phage(45.16%)	43	1302327:1302345	1332702:1332720
WP_010723085.1|1301180_1302197_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
1302327:1302345	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000605090.1|1302469_1302727_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|1302776_1303727_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|1303878_1304631_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945011.1|1304825_1305341_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|1305351_1306878_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156451.1|1306914_1308360_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444929.1|1308359_1309670_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885458.1|1309845_1310754_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|1311083_1311647_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|1311667_1312900_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1313154_1314138_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1314615_1315989_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1316117_1317053_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1317104_1318340_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1318341_1318557_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1318635_1318845_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1318837_1319032_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1319088_1319898_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1319890_1322491_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1322592_1322868_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1322942_1323113_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1323112_1323334_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1323775_1324264_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1324260_1324416_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1324869_1325346_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1325469_1325766_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1325788_1326211_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1326223_1327081_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1327087_1327834_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1327856_1328417_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1328504_1328690_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1328886_1330344_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1330481_1330745_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1330725_1331085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019451.1|1332850_1333831_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.5e-184
1332702:1332720	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_000279097.1|1334153_1337516_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|1337515_1338091_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|1338188_1338779_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1339095_1339329_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|1339397_1339511_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|1340289_1340724_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1340864_1341998_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 4
NZ_CP014270	Escherichia coli K-12 strain K-12 DHB4 chromosome, complete genome	4546849	1534557	1579221	4546849	tail,transposase,lysis,protease	Enterobacteria_phage(30.0%)	61	NA	NA
WP_000527743.1|1534557_1536018_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|1536106_1537390_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1537994_1538108_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1538176_1538410_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1538726_1539317_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1539414_1539990_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1539989_1540952_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1540902_1541472_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1541860_1542094_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1542151_1542562_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1542713_1542887_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1543058_1543214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1543292_1543358_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1543360_1543549_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1543559_1543772_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1544134_1544632_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1544628_1545162_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1545158_1545470_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1545474_1545690_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1546443_1546659_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1546959_1547172_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1547226_1547316_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1547593_1548346_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1548359_1549409_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1549410_1549689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1549755_1550007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1550223_1550379_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1550450_1550738_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1550737_1550977_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1551001_1551307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1551509_1551842_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1552278_1552428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1552724_1552955_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1553038_1553446_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1553612_1553768_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|1553927_1554146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014639039.1|1554149_1554314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1554713_1554902_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|1554898_1555090_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_085947917.1|1556971_1558245_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001360138.1|1559168_1559279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|1559336_1560356_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|1560367_1561582_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1561787_1562114_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1562248_1562590_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1562624_1563185_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1563187_1563898_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|1564005_1564311_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041675.1|1564509_1566936_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001340362.1|1566996_1569420_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|1569430_1570048_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526503.1|1570049_1570904_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1570946_1571561_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_071592181.1|1571719_1573012_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919231.1|1572964_1573660_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225262.1|1573783_1575004_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_001019525.1|1575138_1576032_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091840.1|1576138_1577392_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743957.1|1577788_1578124_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233093.1|1578216_1578300_+	stationary phase-induced protein	NA	NA	NA	NA	NA
WP_001260865.1|1578399_1579221_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP014270	Escherichia coli K-12 strain K-12 DHB4 chromosome, complete genome	4546849	2013694	2022365	4546849		Escherichia_phage(28.57%)	8	NA	NA
WP_000272486.1|2013694_2014798_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
WP_001393538.1|2014805_2016053_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100981.1|2016049_2016607_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_000783975.1|2016606_2017488_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001023610.1|2017545_2018445_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000699460.1|2018444_2019530_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_000183060.1|2019902_2020796_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116026.1|2020970_2022365_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 6
NZ_CP014270	Escherichia coli K-12 strain K-12 DHB4 chromosome, complete genome	4546849	2368377	2379587	4546849	tail,integrase	Enterobacteria_phage(50.0%)	17	2366352:2366368	2383262:2383278
2366352:2366368	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2368377_2369310_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2369621_2370779_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2370931_2371294_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|2371290_2372211_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|2372207_2373539_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2373573_2373855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2374153_2374594_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2374620_2375139_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2375188_2375464_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2375463_2375958_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|2375954_2376323_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|2376680_2377043_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2377108_2377933_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2378060_2378597_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2378587_2378950_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2378949_2379255_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2379386_2379587_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2383262:2383278	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 7
NZ_CP014270	Escherichia coli K-12 strain K-12 DHB4 chromosome, complete genome	4546849	2760166	2767305	4546849		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2760166_2762728_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2762833_2763490_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272547.1|2763540_2764338_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_000848004.1|2764503_2765412_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2765408_2766575_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278991.1|2766666_2767305_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	3.1e-82
>prophage 1
NZ_CP014271	Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence	232954	3507	53523	232954	integrase,transposase	Streptococcus_phage(18.18%)	47	17993:18052	53633:53692
WP_000006255.1|3507_4005_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|4228_5968_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|5912_6698_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|6768_7824_+	DNA polymerase IV	NA	A0A290GHP0	Caldibacillus_phage	27.3	4.4e-12
WP_000554758.1|7875_8169_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|8171_8570_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|8579_9032_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|9337_9604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|9536_10073_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|10129_11587_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|11847_12306_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|12397_13642_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|13699_14101_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|14139_15195_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|15482_16586_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|16597_17851_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
17993:18052	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|18422_18764_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|18784_19102_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|19120_19342_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	41.7	3.7e-06
WP_000811693.1|19350_19827_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|19842_20301_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000194654.1|20398_20638_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|20714_21182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|21204_21648_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|21647_21875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065553.1|23190_24054_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|24382_25276_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|25696_26848_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|29194_30211_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|30418_31822_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|31808_32741_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|32849_33896_-	ferric ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.9	8.4e-08
WP_000015532.1|35117_35456_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|35478_35829_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|35922_37077_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|37371_38280_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_061068867.1|38294_40277_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000406871.1|41880_43491_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|43495_44254_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|44392_45397_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|46591_47323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061068868.1|47413_48058_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_085947917.1|48035_49309_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000072039.1|50371_51226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|51344_51569_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|51565_52006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|52122_53523_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
53633:53692	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP014271	Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence	232954	71717	119321	232954	integrase,transposase	Acinetobacter_phage(22.22%)	31	63751:63764	123345:123358
63751:63764	attL	AATATCACCCCAGC	NA	NA	NA	NA
WP_000169527.1|71717_72017_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|72013_72880_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001345829.1|73212_73401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000802277.1|73865_74177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312851.1|74577_74727_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083834.1|75010_75268_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001442103.1|75501_75576_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000422420.1|75954_78051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235704.1|78066_78618_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	81.8	1.7e-76
WP_001143750.1|78781_81790_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.4	0.0e+00
WP_001092154.1|82380_83442_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001351580.1|83551_83965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001351581.1|84128_84593_-	membrane protein	NA	NA	NA	NA	NA
WP_000131420.1|85713_85902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000169527.1|86808_87108_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001443048.1|87104_87971_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	3.3e-50
WP_085947917.1|89323_90597_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000286435.1|91746_92439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064753882.1|93191_96098_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000995793.1|99135_103251_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	37.1	1.6e-126
WP_072145210.1|105022_106510_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001066941.1|107266_108007_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_000361610.1|108291_109269_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_000990665.1|110108_110750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000538310.1|112864_113155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000963206.1|113144_114044_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_000698737.1|114093_116319_-	phage T7 exclusion protein	NA	NA	NA	NA	NA
WP_000952217.1|116320_117409_-	transcriptional repressor PifC	NA	NA	NA	NA	NA
WP_000813634.1|117988_118207_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|118208_118514_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016982.1|118514_119321_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
123345:123358	attR	GCTGGGGTGATATT	NA	NA	NA	NA
