The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014348	Escherichia coli str. K-12 substr. MG1655 strain JW5437-1 chromosome, complete genome	4657541	4653	14763	4657541	lysis,transposase	Enterobacteria_phage(63.64%)	14	NA	NA
WP_000453566.1|4653_5199_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001421937.1|5587_5782_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|5946_6153_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079503.1|6438_6849_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_000738500.1|7139_7433_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|7523_7706_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|7922_8420_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000839596.1|8419_8635_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737282.1|9207_10275_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_010723085.1|10279_11296_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001177086.1|11545_12454_+	glutamate/aspartate ABC transporter substrate-binding protein GltI	NA	NA	NA	NA	NA
WP_000020941.1|12623_13364_+	glutamate/aspartate ABC transporter permease GltJ	NA	NA	NA	NA	NA
WP_000272824.1|13363_14038_+	glutamate/aspartate ABC transporter permease GltK	NA	NA	NA	NA	NA
WP_000631384.1|14037_14763_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 2
NZ_CP014348	Escherichia coli str. K-12 substr. MG1655 strain JW5437-1 chromosome, complete genome	4657541	90115	134478	4657541	lysis,protease,integrase,transposase	Enterobacteria_phage(54.17%)	47	113190:113236	134492:134538
WP_001300563.1|90115_91228_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956455.1|91304_91457_-	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001130654.1|91909_93028_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682509.1|93093_93342_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360951.1|93406_93775_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351487.1|93868_94522_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153148.1|94629_95877_+	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000786319.1|95957_97334_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000573945.1|97435_100579_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000717157.1|100590_101814_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709870.1|101829_102162_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074234.1|102319_103693_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770953.1|103849_104533_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253839.1|104522_105965_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
WP_000383932.1|106114_108352_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662357.1|108338_111311_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224604.1|111311_112202_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177471.1|112384_113146_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
113190:113236	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201845.1|113659_114613_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|114862_115612_-	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_026089880.1|116514_117141_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000453566.1|117913_118459_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001421937.1|118847_119042_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|119206_119413_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079503.1|119698_120109_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_000738500.1|120399_120693_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|120783_120966_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|121182_121680_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000839596.1|121679_121895_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737282.1|122467_123535_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_010723085.1|123539_124556_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001204791.1|124953_125337_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971055.1|125422_125563_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|125559_125922_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774486.1|125918_126209_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_000224915.1|126201_126372_-	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001054340.1|126371_126827_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_001303586.1|126823_126925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|127041_127839_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001306955.1|127848_128400_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|128864_130391_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001372443.1|130448_130598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070439.1|130645_130978_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_085947771.1|131288_132451_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000145909.1|132513_132609_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000672150.1|132931_133195_+	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_001350488.1|133314_134478_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
134492:134538	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 3
NZ_CP014348	Escherichia coli str. K-12 substr. MG1655 strain JW5437-1 chromosome, complete genome	4657541	367907	425303	4657541	integrase,holin,transposase	Acinetobacter_phage(25.0%)	49	359335:359351	421663:421679
359335:359351	attL	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_000131044.1|367907_369941_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|370069_370657_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|370670_372143_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|372156_373827_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|374039_374708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|374950_375646_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|375638_377066_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|377076_377796_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|378322_379177_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046307.1|379402_380728_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|380836_381073_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|381084_381678_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_085947771.1|382950_384113_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000662258.1|386161_386263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|386626_386890_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|386889_387030_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|387064_387292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|388115_388658_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|388732_389320_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|389377_390046_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|390071_392597_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001310578.1|392586_394230_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|394198_394909_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|395221_395551_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|395798_396413_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070700.1|396830_397520_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|397516_398473_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667026.1|398469_400668_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121359.1|400677_401634_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111342.1|401612_402023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|402307_403708_+|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_000224818.1|403824_404265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|404261_404486_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072039.1|404604_405459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214248.1|405485_406184_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000860996.1|406455_407082_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000388269.1|407172_407904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001281825.1|409098_410103_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_001121657.1|410241_411000_+	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_000406871.1|411004_412615_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_000192863.1|412626_414009_-	MFS transporter	NA	NA	NA	NA	NA
WP_000151261.1|414235_416203_-	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_001136613.1|416217_417126_-	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_010723086.1|417420_418575_+|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001030800.1|418668_419019_+	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_000192349.1|420601_421648_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000081352.1|421756_422689_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
421663:421679	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_001393629.1|422675_424079_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_010723085.1|424286_425303_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
>prophage 4
NZ_CP014348	Escherichia coli str. K-12 substr. MG1655 strain JW5437-1 chromosome, complete genome	4657541	2469442	2476581	4657541		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|2469442_2470081_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001393459.1|2470172_2471339_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_000848004.1|2471335_2472244_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001300386.1|2472439_2473207_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141337.1|2473257_2473914_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272928.1|2474019_2476581_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 5
NZ_CP014348	Escherichia coli str. K-12 substr. MG1655 strain JW5437-1 chromosome, complete genome	4657541	2857043	2868253	4657541	integrase,tail	Enterobacteria_phage(53.33%)	16	2853353:2853369	2870263:2870279
2853353:2853369	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001163428.1|2857043_2857244_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000206809.1|2857375_2857681_-	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001242717.1|2857680_2858043_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000008183.1|2858033_2858570_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_000081278.1|2858697_2859522_-	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000135673.1|2859587_2859950_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_001393497.1|2860672_2861167_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000066913.1|2861166_2861442_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_011443597.1|2861491_2862010_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_001106835.1|2862036_2862477_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_047792215.1|2862775_2863057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030215.1|2863091_2864423_-	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_000703651.1|2864419_2865340_-	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_000915541.1|2865336_2865699_-	bactoprenol glucosyl transferase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000958671.1|2865851_2867009_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000368140.1|2867320_2868253_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
2870263:2870279	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 6
NZ_CP014348	Escherichia coli str. K-12 substr. MG1655 strain JW5437-1 chromosome, complete genome	4657541	3218991	3227662	4657541		Enterobacteria_phage(28.57%)	8	NA	NA
WP_001116026.1|3218991_3220386_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
WP_000183060.1|3220560_3221454_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699460.1|3221826_3222912_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_001023610.1|3222911_3223811_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000783975.1|3223868_3224750_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001100981.1|3224749_3225307_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_001393538.1|3225303_3226551_+	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_000272486.1|3226558_3227662_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
>prophage 7
NZ_CP014348	Escherichia coli str. K-12 substr. MG1655 strain JW5437-1 chromosome, complete genome	4657541	3685447	3704658	4657541	lysis,tail	Enterobacteria_phage(40.91%)	34	NA	NA
WP_000379575.1|3685447_3685603_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448564.1|3685769_3686177_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|3686260_3686491_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_011443592.1|3686787_3686937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|3687373_3687706_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|3687908_3688214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|3688238_3688478_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|3688477_3688765_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|3688836_3688992_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|3689208_3689460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|3689526_3689805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001393597.1|3689806_3690856_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	5.7e-113
WP_001047135.1|3690869_3691622_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|3691899_3691989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087756.1|3692043_3692256_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|3692556_3692772_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|3693525_3693741_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|3693745_3694057_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|3694053_3694587_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|3694583_3695081_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|3695443_3695656_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|3695666_3695855_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|3695857_3695923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|3696001_3696157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|3696328_3696502_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|3696653_3697064_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|3697121_3697355_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453612.1|3697743_3698313_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001027733.1|3698263_3699226_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000885611.1|3699225_3699801_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000078177.1|3699898_3700489_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|3700805_3701039_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|3701107_3701221_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000527743.1|3703197_3704658_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
>prophage 8
NZ_CP014348	Escherichia coli str. K-12 substr. MG1655 strain JW5437-1 chromosome, complete genome	4657541	3863601	3927547	4657541	tail,integrase,tRNA,transposase,lysis	Escherichia_phage(40.62%)	62	3906495:3906513	3936870:3936888
WP_001254932.1|3863601_3864753_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_088895425.1|3864961_3866189_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_010723099.1|3868880_3868946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001123464.1|3869049_3869640_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039887.1|3869621_3870572_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632280.1|3870672_3871986_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206197.1|3872012_3873218_-	bifunctional 3-oxoadipyl-CoA/3-oxo-5,6-dehydrosuberyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|3873217_3873640_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_186228192.1|3873629_3874595_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_001338544.1|3874609_3875056_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000969784.1|3875057_3875846_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|3875845_3876613_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206388.1|3876609_3877680_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189201.1|3877687_3878185_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072837.1|3878199_3878946_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|3878954_3879242_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191077.1|3879253_3880183_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186469.1|3880467_3882513_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535469.1|3882760_3885034_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138615.1|3885091_3886591_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067514.1|3886826_3887732_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001300734.1|3887903_3888230_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|3888237_3888423_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900941.1|3888419_3891059_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762236.1|3891266_3892256_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_001298828.1|3892366_3892789_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|3892785_3893052_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628244.1|3893325_3896850_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837921.1|3897216_3898350_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_001300461.1|3898490_3898925_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_001157926.1|3899190_3899364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795384.1|3899703_3899817_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836770.1|3899885_3900119_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_000086527.1|3900435_3901026_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001698950.1|3901123_3901699_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000279097.1|3901698_3905061_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_000019448.1|3905383_3906364_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
3906495:3906513	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000091628.1|3908129_3908489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001350510.1|3908469_3908733_-	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_001097895.1|3908870_3910328_-	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001228696.1|3910524_3910710_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_000450663.1|3910797_3911358_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_000788970.1|3911380_3912127_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000899748.1|3912133_3912991_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000693797.1|3913003_3913426_-	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000712069.1|3913448_3913745_-	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000948459.1|3913868_3914345_+	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_001169151.1|3914798_3914954_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|3914950_3915439_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|3915880_3916102_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|3916101_3916272_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|3916346_3916622_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105143.1|3916723_3919324_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000166319.1|3919316_3920126_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|3920182_3920377_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|3920369_3920579_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|3920657_3920873_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|3920874_3922110_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157406.1|3922161_3923097_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123737.1|3923225_3924599_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|3925076_3926060_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|3926314_3927547_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
3936870:3936888	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
>prophage 9
NZ_CP014348	Escherichia coli str. K-12 substr. MG1655 strain JW5437-1 chromosome, complete genome	4657541	4118851	4133231	4657541	integrase,tail,portal,plate	Shigella_phage(29.41%)	24	4116227:4116240	4134257:4134270
4116227:4116240	attL	AAAATAAGATGAAT	NA	NA	NA	NA
WP_000332303.1|4118851_4119583_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|4119803_4120208_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032082692.1|4120260_4120371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795380.1|4120606_4120651_+	protein YmgK	NA	NA	NA	NA	NA
WP_001295666.1|4120907_4121231_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_000943927.1|4121333_4121498_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_000557907.1|4121731_4122565_-	5-methylcytosine-specific endonuclease McrA	NA	NA	NA	NA	NA
WP_000905001.1|4122671_4123226_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_010723096.1|4123634_4124048_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000548498.1|4124019_4124622_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_000383574.1|4125412_4125997_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_001350503.1|4125987_4126779_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_001350502.1|4126705_4127179_-|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_000605606.1|4127178_4127361_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000104929.1|4127372_4128740_-	helix-turn-helix domain-containing protein	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_001250269.1|4128729_4128909_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515837.1|4129084_4129642_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_000649480.1|4129685_4129886_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000848748.1|4129976_4130651_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_001005353.1|4130825_4131134_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_010723095.1|4131071_4131413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011443584.1|4131529_4131841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939945.1|4131877_4132123_+	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_000741310.1|4132103_4133231_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	61.5	7.2e-122
4134257:4134270	attR	AAAATAAGATGAAT	NA	NA	NA	NA
