The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014497	Escherichia coli strain ZH193 chromosome, complete genome	5046610	817120	867536	5046610	terminase,head,portal,capsid,transposase,integrase,lysis,tail	Enterobacteria_phage(56.9%)	61	809956:809972	859449:859465
809956:809972	attL	CGGAAGATGGCAGCGTG	NA	NA	NA	NA
WP_000080195.1|817120_818734_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_001091562.1|819039_820323_-	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_000533643.1|820457_821528_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_001303849.1|821505_821724_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|821763_821931_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_023149341.1|822019_822301_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	97.8	1.1e-50
WP_023149340.1|822503_823055_-	ead/Ea22-like family protein	NA	K7P6T4	Enterobacteria_phage	82.1	1.2e-58
WP_000763363.1|823051_823273_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_001492860.1|823371_823587_-	hypothetical protein	NA	M1FPM2	Enterobacteria_phage	100.0	1.5e-33
WP_000581109.1|823594_824347_-	hypothetical protein	NA	M1FN76	Enterobacteria_phage	100.0	6.4e-151
WP_000682303.1|824343_824502_-	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	100.0	3.1e-23
WP_001591578.1|824498_825179_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	3.9e-131
WP_000100847.1|825175_825961_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995433.1|825966_826263_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_023148105.1|826338_826629_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_000866321.1|827020_827398_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000380252.1|827375_828437_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000712396.1|828517_829210_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.3	2.5e-109
WP_000184665.1|829320_829548_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182881.1|829578_830118_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_061132366.1|830204_831134_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.7	5.6e-112
WP_059337096.1|831130_831832_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.0	2.5e-125
WP_023149240.1|831949_833923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072130790.1|834556_834658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774774.1|834654_835110_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	1.3e-58
WP_000224907.1|835109_835280_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001774775.1|835272_835563_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	3.0e-48
WP_001356994.1|835559_835922_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	9.5e-60
WP_023149314.1|835918_836059_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	65.1	4.7e-07
WP_001204791.1|836144_836528_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737263.1|836716_837799_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_000839596.1|838387_838603_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_023149315.1|838602_839100_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	2.1e-89
WP_024175646.1|839316_839523_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	91.2	4.2e-28
WP_001139682.1|839551_839704_+	hypothetical protein	NA	Q716B2	Shigella_phage	100.0	2.1e-21
WP_001059339.1|839906_840431_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.2	4.5e-87
WP_001663509.1|841979_842213_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000453620.1|842601_843147_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_001027261.1|843121_845047_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198149.1|845043_845250_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001295977.1|845246_846848_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000123268.1|846828_848148_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295978.1|848157_848490_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063238.1|848545_849571_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	4.7e-189
WP_077874890.1|849612_850011_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	96.2	4.2e-61
WP_000785282.1|850022_850376_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|850387_850966_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_001358133.1|850962_851358_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	1.1e-69
WP_001295979.1|851365_852106_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000479203.1|852121_852544_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_000459457.1|852525_852960_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840216.1|852952_855514_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000847375.1|855510_855840_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_001152626.1|855839_856538_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_061132352.1|856543_857287_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	1.1e-147
WP_000090895.1|857223_857856_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	5.5e-95
WP_032254733.1|857916_861414_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.2	0.0e+00
859449:859465	attR	CACGCTGCCATCTTCCG	NA	NA	NA	NA
WP_001460792.1|861484_862084_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	3.7e-109
WP_071785654.1|862148_865547_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_023149355.1|865546_866131_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.3	1.1e-102
WP_000586339.1|866204_867536_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
>prophage 2
NZ_CP014497	Escherichia coli strain ZH193 chromosome, complete genome	5046610	981287	1091079	5046610	terminase,head,capsid,portal,protease,transposase,integrase,tRNA,plate,tail,holin	Enterobacteria_phage(41.67%)	131	1076677:1076692	1095998:1096013
WP_000520781.1|981287_981608_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_061132353.1|981638_983915_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.4	9.6e-166
WP_001040187.1|984599_984818_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241674.1|985102_985807_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202204.1|985848_987570_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001043561.1|987570_989337_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001385255.1|989459_990425_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_000228473.1|990968_991463_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077041.1|991597_995704_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|995862_996474_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|996484_997828_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|997918_999211_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000078916.1|999516_999657_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488106.1|999848_1000109_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132830.1|1000149_1001259_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005447.1|1001416_1002601_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000290462.1|1002600_1003113_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651577.1|1003168_1003543_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000333503.1|1003551_1003707_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000853410.1|1003693_1006501_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
WP_000979945.1|1006513_1007002_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905061.1|1007030_1007630_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_023363133.1|1007857_1008643_+	hypothetical protein	NA	Q858V4	Yersinia_virus	76.6	1.1e-108
WP_001554335.1|1008644_1009172_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
WP_000972134.1|1009200_1009734_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
WP_021538277.1|1009736_1011722_-|tail	phage tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	86.0	3.2e-173
WP_000071703.1|1011724_1012255_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_001111954.1|1012247_1013144_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_000213444.1|1013147_1013498_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
WP_001271941.1|1013494_1014076_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.3e-102
WP_000356366.1|1014072_1014708_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_000921127.1|1014700_1015168_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000202148.1|1015191_1017069_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
WP_000780577.1|1017207_1017603_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000072341.1|1017599_1017992_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_001342221.1|1017988_1018312_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864901.1|1018314_1018515_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063100.1|1018514_1019009_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000632309.1|1019110_1019911_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_001055083.1|1019956_1021009_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_001262655.1|1021032_1021869_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_000613780.1|1022023_1023775_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087814.1|1023774_1024821_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000236495.1|1024835_1025360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|1026083_1026581_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000193205.1|1026620_1027463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211282.1|1027546_1027861_-	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000686485.1|1027865_1028825_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_000123489.1|1028901_1031724_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
WP_000599382.1|1031730_1032096_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_023142408.1|1032092_1032710_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	42.0	1.5e-09
WP_000104290.1|1032721_1033021_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_000153700.1|1033017_1033284_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|1033280_1033484_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543036.1|1033507_1033918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021715.1|1034011_1034125_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000514277.1|1034121_1034364_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159455.1|1034375_1034654_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000776267.1|1034664_1035015_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_001287828.1|1035152_1035344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856387.1|1035350_1035773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204236.1|1035777_1036299_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001368591.1|1036403_1036745_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_000023739.1|1036814_1037807_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_000850306.1|1038106_1040551_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|1040561_1041179_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534666.1|1041180_1042044_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000165876.1|1042079_1042706_-	hydrolase	NA	NA	NA	NA	NA
WP_000109283.1|1043019_1044168_+	MFS transporter	NA	NA	NA	NA	NA
WP_000111043.1|1044264_1045005_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|1045196_1047479_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_001295917.1|1047533_1048391_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_000194832.1|1048796_1050557_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642852.1|1050686_1051379_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057158.1|1051577_1052666_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000445240.1|1052736_1054020_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000904922.1|1054275_1054848_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_063269479.1|1054907_1055432_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	48.6	1.8e-35
WP_000072165.1|1055431_1056046_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_023142129.1|1056052_1056514_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_023363137.1|1056524_1057772_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	43.7	2.0e-40
WP_000138756.1|1057774_1058353_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001219098.1|1058345_1059449_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000859111.1|1059439_1059787_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_000148266.1|1059841_1060438_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000808007.1|1060434_1061589_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_012602373.1|1061576_1061792_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|1061788_1062673_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_000016538.1|1062672_1065624_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_001202894.1|1065699_1065858_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|1065781_1066117_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|1066214_1066496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034294.1|1066498_1067020_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000729834.1|1067019_1068447_-|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_012602372.1|1068436_1068691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|1068687_1069152_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|1069151_1069598_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|1069599_1069938_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|1069947_1070901_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|1070915_1072031_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135514.1|1072245_1072704_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117548.1|1072706_1073528_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000090684.1|1073508_1075005_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_001295924.1|1075004_1076537_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.2e-185
WP_000124060.1|1076596_1077142_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
1076677:1076692	attL	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
WP_000227701.1|1077141_1077453_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175099.1|1077452_1077779_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000264665.1|1077775_1078426_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_001104440.1|1078409_1079150_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000793146.1|1079152_1079503_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_000194951.1|1079633_1080362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972294.1|1080337_1080742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069611.1|1080740_1080956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783854.1|1081146_1081911_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_000031013.1|1082027_1082384_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000123378.1|1082477_1082666_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047759.1|1082718_1083027_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000533817.1|1083037_1083958_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_001095645.1|1083957_1084275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000186588.1|1084290_1086060_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_000960679.1|1086070_1087237_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000843446.1|1087239_1087509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|1087536_1088067_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000632576.1|1088355_1088628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|1088637_1088934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763554.1|1088948_1089164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|1089160_1089844_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000631813.1|1089840_1090071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206212.1|1090060_1090267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001170114.1|1090268_1090718_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_001281701.1|1090689_1091079_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
1095998:1096013	attR	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
>prophage 3
NZ_CP014497	Escherichia coli strain ZH193 chromosome, complete genome	5046610	1303180	1348889	5046610	terminase,head,portal,capsid,tail,integrase,lysis,tRNA,holin	Enterobacteria_phage(56.0%)	58	1301498:1301512	1330092:1330106
1301498:1301512	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_001295972.1|1303180_1304287_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1304340_1304802_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248677.1|1304811_1305465_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1305636_1306887_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|1307000_1308143_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|1308132_1308369_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|1308508_1308748_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|1308731_1309058_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|1309057_1309279_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_021533932.1|1309377_1309659_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000548516.1|1309669_1309861_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|1309833_1310016_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|1310012_1310693_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|1310689_1311475_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995418.1|1311480_1311777_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000233576.1|1311852_1312059_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000259990.1|1312654_1313410_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_001067458.1|1313448_1313679_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182900.1|1313748_1314288_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001435464.1|1314374_1315304_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	6.1e-111
WP_000788794.1|1315300_1316002_+	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_022645049.1|1316251_1320517_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000700202.1|1320553_1321597_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072147164.1|1321946_1322048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053005.1|1322044_1322500_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_000224914.1|1322499_1322670_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774479.1|1322662_1322953_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_001099488.1|1322949_1323312_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000971096.1|1323308_1323449_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001097224.1|1323445_1324135_+	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000544528.1|1324456_1324762_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180486.1|1324748_1325225_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_001228695.1|1325441_1325624_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|1325714_1326008_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|1326488_1326815_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|1327021_1327204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453620.1|1327767_1328313_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_001027261.1|1328287_1330213_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
1330092:1330106	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
WP_000198149.1|1330209_1330416_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001295977.1|1330412_1332014_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000123268.1|1331994_1333314_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295978.1|1333323_1333656_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063293.1|1333711_1334737_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_000158908.1|1334778_1335177_+	DNA packaging protein from bacteriophage origin	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000753018.1|1335188_1335542_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000985120.1|1335553_1336132_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000683150.1|1336128_1336524_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_001295979.1|1336531_1337272_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000479203.1|1337287_1337710_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_000459457.1|1337691_1338126_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840216.1|1338118_1340680_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000847375.1|1340676_1341006_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_001152626.1|1341005_1341704_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_023146277.1|1341708_1342452_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_023149564.1|1342388_1342991_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_001531667.1|1343051_1346534_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_000290538.1|1346592_1348614_+	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_000654172.1|1348610_1348889_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
>prophage 4
NZ_CP014497	Escherichia coli strain ZH193 chromosome, complete genome	5046610	1487626	1557341	5046610	terminase,portal,capsid,head,protease,transposase,integrase,tail,holin	Stx2-converting_phage(25.0%)	78	1483800:1483814	1489710:1489724
1483800:1483814	attL	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_000113700.1|1487626_1488757_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1488734_1488983_-	excisionase	NA	NA	NA	NA	NA
WP_016230610.1|1489047_1491519_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
1489710:1489724	attR	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_001090200.1|1491611_1491803_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449179.1|1491799_1491988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171951.1|1492553_1492772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|1492931_1493087_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000103687.1|1493359_1494076_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000471549.1|1494125_1494341_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693845.1|1494337_1494763_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095675.1|1494785_1495748_+	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000788950.1|1495754_1496501_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000450998.1|1496522_1497293_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151161.1|1497308_1497734_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000150294.1|1497908_1498574_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018429.1|1498754_1498967_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001329966.1|1499134_1499407_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265085.1|1499408_1500464_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_000140014.1|1500464_1500845_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001513213.1|1500841_1501663_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000917751.1|1501889_1502087_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_000024331.1|1502238_1503288_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_023142244.1|1504089_1504221_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000871291.1|1504501_1504837_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_016230612.1|1505097_1506951_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000284510.1|1507101_1507317_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|1507321_1507666_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|1507631_1507904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|1508009_1508543_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_032140280.1|1509097_1509184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|1509405_1509591_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000736382.1|1509676_1509892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095741.1|1510090_1510291_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829185.1|1510332_1510698_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000958366.1|1510988_1511552_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_001296023.1|1511548_1513210_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000173031.1|1513273_1515211_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001063099.1|1515255_1515477_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267294.1|1515422_1518008_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_000125990.1|1518004_1518331_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|1518340_1518691_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1518687_1519134_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1519130_1519475_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|1519541_1520258_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710949.1|1520272_1520647_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|1520742_1520952_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212991.1|1520999_1524242_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_000807937.1|1524234_1524576_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_001296027.1|1524575_1525274_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000194730.1|1525284_1526028_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_061089814.1|1525973_1526606_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000514710.1|1526948_1530422_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_001298859.1|1531062_1532604_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|1532618_1533365_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_071550361.1|1533826_1536733_+	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	45.9	1.1e-118
WP_001164137.1|1536748_1537276_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_000972097.1|1537306_1537840_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_022645053.1|1537841_1538627_-	hypothetical protein	NA	Q858V4	Yersinia_virus	77.8	1.3e-109
WP_001421220.1|1538854_1539037_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_000240999.1|1539235_1539904_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|1539960_1540230_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_001348267.1|1540641_1541199_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_001296031.1|1541195_1541471_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_000443082.1|1541846_1542653_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|1542652_1543846_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195273.1|1543857_1545216_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000763535.1|1545219_1546815_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194644.1|1546814_1548377_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1548468_1548513_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285702.1|1548650_1549532_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1549528_1550149_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001296033.1|1550176_1552072_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|1552284_1553160_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_023141019.1|1553365_1554352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000715.1|1554361_1554670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278898.1|1554726_1555317_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559273.1|1555313_1556072_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422062.1|1556291_1557341_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 5
NZ_CP014497	Escherichia coli strain ZH193 chromosome, complete genome	5046610	2048507	2136752	5046610	capsid,portal,tail,transposase,integrase,plate,tRNA,holin	Escherichia_phage(23.81%)	101	2094204:2094263	2136814:2136938
WP_099156422.1|2048507_2049856_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	8.7e-74
WP_000568520.1|2049965_2050976_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2050984_2051596_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072093883.1|2051734_2051800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024911.1|2051870_2052473_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2052474_2052996_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|2053030_2053771_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077249130.1|2053799_2054252_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258676.1|2054244_2056017_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891625.1|2056326_2056893_+	hydrolase	NA	NA	NA	NA	NA
WP_000639277.1|2056889_2057708_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|2057760_2058156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|2058196_2058940_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564759.1|2058936_2059908_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176764.1|2059943_2062373_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214293.1|2062397_2063498_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185734.1|2063885_2064632_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001490174.1|2064645_2065212_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|2065427_2067161_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001202076.1|2067213_2067606_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066973.1|2067605_2069684_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278946.1|2069676_2070825_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983600.1|2071013_2071658_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2071668_2072058_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|2072072_2073122_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204320.1|2073124_2073985_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001296146.1|2074275_2075937_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|2076081_2076585_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001531763.1|2076605_2078570_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795641.1|2078574_2079501_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906342.1|2079497_2080385_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2080511_2081090_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|2081092_2081443_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122413.1|2082222_2082651_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001296148.1|2082657_2084082_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001296149.1|2084056_2084857_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000987895.1|2085023_2086013_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187827.1|2086024_2087539_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000548680.1|2087608_2088598_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|2089392_2089896_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|2089973_2090225_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2090339_2090426_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237881.1|2090689_2091013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|2091184_2091682_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2091719_2091959_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797555.1|2092149_2093361_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2093411_2094077_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
2094204:2094263	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001296152.1|2094548_2094968_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_001531767.1|2096182_2096407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531768.1|2096568_2096958_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001018353.1|2096993_2098634_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_000444667.1|2098742_2099024_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000785563.1|2099036_2099549_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000117510.1|2099566_2101069_-|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000626358.1|2101065_2101455_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000829621.1|2101454_2102639_-|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000203868.1|2102631_2103258_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000633314.1|2103260_2104181_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000901289.1|2104177_2104519_-|plate	phage baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000079174.1|2104521_2105424_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000015612.1|2105404_2105941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|2105937_2106618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531773.1|2106649_2107030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105179.1|2107026_2107446_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001283997.1|2107480_2108515_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000206292.1|2108573_2108903_-	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001145892.1|2108902_2110210_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_061132359.1|2110209_2111784_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.8	3.3e-189
WP_000203897.1|2111780_2112014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000168117.1|2113861_2114428_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_001531775.1|2114796_2115042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734931.1|2115101_2115296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131873.1|2115303_2115783_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000172496.1|2115782_2116055_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_001294589.1|2116054_2116438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064384.1|2116550_2117222_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_000717783.1|2117221_2117515_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000057010.1|2117511_2118108_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_001025459.1|2118185_2118365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|2118516_2119158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000536919.1|2119401_2119635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|2120033_2120522_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_001138663.1|2120531_2121137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000536231.1|2121599_2122298_-	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001237642.1|2123486_2124410_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001531776.1|2124584_2125373_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_000661082.1|2126054_2126279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|2126275_2126587_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000918616.1|2126583_2126820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214056.1|2126821_2127232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023813.1|2128674_2129430_-	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000943914.1|2129426_2129651_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_000431205.1|2129690_2130167_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000360804.1|2130225_2130456_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_001296165.1|2130554_2130968_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000388260.1|2131978_2132299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151806.1|2132329_2134546_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000100753.1|2134542_2135112_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000916334.1|2135111_2135294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833838.1|2135503_2135767_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_001531780.1|2135735_2136752_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
2136814:2136938	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 6
NZ_CP014497	Escherichia coli strain ZH193 chromosome, complete genome	5046610	2278353	2284805	5046610	transposase	Acidithiobacillus_phage(16.67%)	9	NA	NA
WP_001298859.1|2278353_2279895_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|2279909_2280656_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000846703.1|2281104_2281515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|2281735_2282554_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_001164966.1|2282553_2282799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542276.1|2282892_2283366_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001186200.1|2283381_2283858_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|2283920_2284142_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000086752.1|2284160_2284805_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
>prophage 7
NZ_CP014497	Escherichia coli strain ZH193 chromosome, complete genome	5046610	2315607	2321910	5046610		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001100793.1|2315607_2316150_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
WP_000857525.1|2316154_2317033_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001023641.1|2317090_2317990_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000699407.1|2317989_2319075_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_000183040.1|2319447_2320341_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_001116066.1|2320515_2321910_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
>prophage 8
NZ_CP014497	Escherichia coli strain ZH193 chromosome, complete genome	5046610	2416085	2425530	5046610		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292786.1|2416085_2417222_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
WP_001296230.1|2417218_2419222_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|2419346_2419808_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|2419848_2420319_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2420365_2421085_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2421081_2422767_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240408.1|2422988_2423720_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001216963.1|2423779_2423887_+	protein YohO	NA	NA	NA	NA	NA
WP_000783109.1|2423867_2424599_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569347.1|2424603_2425530_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
>prophage 9
NZ_CP014497	Escherichia coli strain ZH193 chromosome, complete genome	5046610	3002861	3010001	5046610		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|3002861_3005423_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141293.1|3005528_3006185_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_001272542.1|3006235_3007033_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	2.2e-69
WP_000847996.1|3007198_3008107_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_000590411.1|3008103_3009366_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279004.1|3009362_3010001_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 10
NZ_CP014497	Escherichia coli strain ZH193 chromosome, complete genome	5046610	3259269	3321359	5046610	integrase,transposase,tRNA,protease	Staphylococcus_phage(33.33%)	53	3260478:3260495	3320756:3320773
WP_001296354.1|3259269_3260028_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105562.1|3260457_3261378_-	agmatinase	NA	NA	NA	NA	NA
3260478:3260495	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000758881.1|3261513_3262245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|3262390_3264367_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|3264375_3264507_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001331575.1|3264642_3264858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3265161_3266316_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3266751_3268146_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001296359.1|3268222_3268720_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|3268814_3269522_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|3269601_3270333_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593274.1|3270345_3271296_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000126441.1|3271332_3271968_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|3271967_3272384_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001296360.1|3272498_3273479_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3273496_3274201_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3274218_3274785_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277229.1|3274781_3275072_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174754.1|3275079_3275673_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239963.1|3275665_3276802_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000783999.1|3277115_3278102_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577034.1|3278146_3278650_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378955.1|3278649_3279951_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745240.1|3280006_3281014_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394132.1|3281130_3282177_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3282352_3283072_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001296361.1|3283092_3283233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107566.1|3283255_3283582_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3283581_3284301_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001296362.1|3284461_3285514_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3285541_3285817_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|3285881_3286961_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001296363.1|3287162_3288419_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839781.1|3288467_3290603_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|3290995_3291703_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218869.1|3292081_3293347_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_000147017.1|3293602_3294646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774069.1|3296340_3296892_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000006213.1|3299383_3299617_+	Major pilus subunit operon regulatory protein	NA	NA	NA	NA	NA
WP_023146305.1|3300083_3300299_+	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	85.2	1.7e-27
WP_099156432.1|3300267_3301394_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.6	2.5e-146
WP_001513409.1|3301484_3301598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001110186.1|3303431_3303692_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109147.1|3303733_3304294_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|3304333_3304762_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_000074472.1|3305479_3306673_-	MFS transporter	NA	NA	NA	NA	NA
WP_001296374.1|3306808_3308533_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287500.1|3308533_3309481_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015715.1|3309480_3311223_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|3311219_3312497_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973516.1|3312578_3314780_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_001034083.1|3315723_3319611_+|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_001254932.1|3320207_3321359_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
3320756:3320773	attR	CCTGAATATACAGCATCT	NA	NA	NA	NA
>prophage 1
NZ_CP014498	Escherichia coli strain ZH193 plasmid pZH193, complete sequence	209768	42962	93921	209768	transposase,integrase	Escherichia_phage(36.36%)	44	82275:82289	89273:89287
WP_085947770.1|42962_44332_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001276232.1|44577_45297_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845940.1|45293_45728_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000117179.1|45782_47741_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	1.3e-22
WP_001067858.1|47835_48540_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000290841.1|48636_49176_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.9	1.2e-45
WP_032143370.1|49409_49598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032153960.1|49818_50055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348621.1|50080_50644_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	1.0e-20
WP_000170714.1|50691_52053_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|52104_52335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027516.1|53369_53561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271753.1|53557_53980_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001671341.1|54026_54329_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000274437.1|55695_56130_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104873.1|56143_56365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086185.1|56365_57049_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_001348615.1|57433_58336_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000817036.1|59202_60174_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_000772446.1|60173_61340_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000852146.1|61927_62683_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000016982.1|63456_64263_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_001159868.1|64263_64569_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|64570_64789_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001553854.1|67253_70370_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
WP_001617890.1|70491_71775_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.2e-10
WP_001617892.1|71771_73328_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
WP_001190712.1|73510_73732_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216034.1|73731_74112_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001513661.1|74116_74296_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001513660.1|74323_74683_+	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513659.1|74969_75287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012372828.1|75514_76531_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
WP_001373486.1|76738_78142_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|78128_79061_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
82275:82289	attL	GGCTGCAGGTTTTTC	NA	NA	NA	NA
WP_000361610.1|82403_83381_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_001066941.1|83665_84406_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001309252.1|84526_84715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072358.1|85081_86251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322642.1|87097_87370_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001298664.1|88612_90583_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
89273:89287	attR	GAAAAACCTGCAGCC	NA	NA	NA	NA
WP_000977394.1|90589_91381_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001323403.1|92119_92899_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001310017.1|92898_93921_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
>prophage 2
NZ_CP014498	Escherichia coli strain ZH193 plasmid pZH193, complete sequence	209768	110919	152959	209768	transposase	Escherichia_phage(60.0%)	43	NA	NA
WP_001189106.1|110919_111408_+|transposase	transposase	transposase	A0A077SK28	Escherichia_phage	93.2	6.7e-24
WP_000874189.1|112312_112798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267176.1|112822_113308_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|113294_113990_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_000729218.1|113994_115125_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000964653.1|115114_116398_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|116400_117780_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|117883_118411_-	iron transporter	NA	NA	NA	NA	NA
WP_000118029.1|118451_120338_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_012372823.1|120684_121500_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000949452.1|121682_122189_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_000449408.1|122178_122337_-	copper-sensitivity suppressor C	NA	NA	NA	NA	NA
WP_001389366.1|125449_125923_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|126053_126842_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|127047_127395_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|127388_128228_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|128355_128559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|128714_129920_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|129930_130236_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|130462_131227_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|131719_132304_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|132303_133542_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|133538_134444_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|134565_135270_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_024192851.1|135294_135507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001082319.1|136689_137493_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480972.1|137492_138329_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_042005022.1|138382_138619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031606906.1|138650_139277_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|139382_140582_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_071925136.1|140613_141414_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001067858.1|141469_142174_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001389366.1|143139_143613_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|143743_144532_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|144737_145085_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000376616.1|146044_146248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|146403_147609_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|147619_147925_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|148151_148916_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|149408_149993_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|149992_151231_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|151227_152133_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|152254_152959_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
