The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	0	4925	2285232		Aurantimonas_phage(50.0%)	5	NA	NA
WP_004194536.1|454_1828_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_004194538.1|1981_3118_+	DNA polymerase III subunit beta	NA	A0A0A8IL17	Aurantimonas_phage	24.5	5.3e-24
WP_004194540.1|3361_4243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194541.1|4252_4456_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_004194339.1|4559_4925_+	helix-turn-helix transcriptional regulator	NA	A0A0A7RUJ5	Clostridium_phage	48.4	1.6e-06
>prophage 2
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	12453	16264	2285232	tRNA,protease	Acanthocystis_turfacea_chlorella_virus(33.33%)	3	NA	NA
WP_004194320.1|12453_13722_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A7K9Y8	Acanthocystis_turfacea_chlorella_virus	24.6	4.1e-09
WP_004194316.1|13729_14272_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	27.6	8.5e-12
WP_004194314.1|14293_16264_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0BXI2	Ostreococcus_lucimarinus_virus	40.8	7.4e-106
>prophage 3
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	24207	25560	2285232		Streptococcus_phage(100.0%)	1	NA	NA
WP_004194110.1|24207_25560_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	34.6	1.6e-75
>prophage 4
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	35925	48003	2285232	tRNA	Oenococcus_phage(25.0%)	10	NA	NA
WP_004194070.1|35925_36315_+	VOC family protein	NA	V5UQY3	Oenococcus_phage	51.6	1.1e-32
WP_004194068.1|36311_36887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194066.1|37050_37824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194064.1|37820_38252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194062.1|38427_41079_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	41.3	2.9e-153
WP_004194058.1|41165_42428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194056.1|42512_45386_+	DEAD/DEAH box helicase	NA	A0A0A1ENT0	Lactobacillus_phage	28.2	3.1e-28
WP_004194051.1|45409_45802_-	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_013730202.1|45876_46926_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_014636819.1|47010_48003_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.9	3.4e-51
>prophage 5
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	57578	63389	2285232		Wolbachia_phage(50.0%)	5	NA	NA
WP_004194473.1|57578_59516_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.9	3.8e-70
WP_004194470.1|59554_60145_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_004194469.1|60398_60968_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_004194467.1|61004_62186_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_011922545.1|62237_63389_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	62.9	1.4e-120
>prophage 6
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	82023	83280	2285232	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_002936184.1|82023_83280_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	73.6	3.4e-173
>prophage 7
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	93671	95999	2285232		Staphylococcus_phage(50.0%)	2	NA	NA
WP_002935338.1|93671_94928_+	CHAP domain-containing protein	NA	M4I0L3	Staphylococcus_phage	39.8	5.0e-07
WP_002935337.1|95030_95999_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	34.8	2.0e-43
>prophage 8
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	99395	110175	2285232		Synechococcus_phage(25.0%)	8	NA	NA
WP_002935328.1|99395_100103_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SE76	Cyanophage	42.6	8.1e-47
WP_002935327.1|100115_103835_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.4	1.0e-39
WP_002935326.1|103837_105292_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	7.2e-58
WP_002935325.1|105347_106370_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	41.1	3.9e-58
WP_002935324.1|106366_106918_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.5	2.1e-26
WP_002935323.1|106927_108475_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.0	8.5e-73
WP_002935322.1|108539_109370_+	DNA adenine methylase	NA	A0A1S5PRR3	Streptococcus_phage	59.3	7.7e-89
WP_032499218.1|109359_110175_+	site-specific DNA-methyltransferase	NA	A0A1W6JJW1	Lactococcus_phage	33.5	1.1e-26
>prophage 9
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	113392	139188	2285232	protease,transposase	Bacillus_phage(18.18%)	24	NA	NA
WP_002935317.1|113392_113881_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.4	1.9e-18
WP_002935314.1|113867_114953_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_002935313.1|114939_115863_+	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_002935312.1|115897_117190_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.2	2.2e-18
WP_002935311.1|117698_118523_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.8	2.6e-20
WP_002935310.1|118515_119250_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002935309.1|119584_120313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935308.1|120322_120901_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_053866406.1|120915_121344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935305.1|121336_122209_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.8	3.0e-27
WP_002935304.1|122214_122985_+	membrane protein	NA	NA	NA	NA	NA
WP_002935303.1|122987_124700_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.8	3.5e-59
WP_002935301.1|124801_124975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935300.1|125269_126271_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	6.8e-07
WP_002935299.1|126270_127017_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002935298.1|127018_127657_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_002935296.1|127903_128821_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162096930.1|129229_130522_-|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	99.8	8.8e-225
WP_013730659.1|131385_132129_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	2.5e-30
WP_002939131.1|132434_134606_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	65.5	1.7e-281
WP_009910991.1|134834_136181_+	5'-nucleotidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002939125.1|136182_136677_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002939123.1|136863_137421_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	57.8	6.0e-53
WP_002939120.1|137901_139188_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	44.7	1.0e-92
>prophage 10
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	145412	151668	2285232	transposase	Streptococcus_phage(50.0%)	2	NA	NA
WP_002936184.1|145412_146669_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	73.6	3.4e-173
WP_024394201.1|149466_151668_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.2	1.0e-10
>prophage 11
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	155051	162059	2285232	tRNA	Planktothrix_phage(33.33%)	5	NA	NA
WP_009910969.1|155051_155822_+	metal ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	5.4e-12
WP_013730648.1|155814_156675_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_013730647.1|156667_157507_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_013730646.1|157562_159455_+	endopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.7	8.2e-70
WP_002938575.1|159557_162059_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	64.9	0.0e+00
>prophage 12
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	173384	174131	2285232		Planktothrix_phage(100.0%)	1	NA	NA
WP_013730643.1|173384_174131_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.0	2.6e-35
>prophage 13
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	195871	196600	2285232		Enterococcus_phage(100.0%)	1	NA	NA
WP_013730636.1|195871_196600_+	serine/threonine protein phosphatase	NA	A0A0C5JZB3	Enterococcus_phage	32.1	2.3e-28
>prophage 14
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	200703	207365	2285232		Bacillus_phage(75.0%)	6	NA	NA
WP_004298345.1|200703_201603_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.2	1.6e-76
WP_004298347.1|201648_202665_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_004298348.1|202886_203336_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004298350.1|203328_205035_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	4.4e-38
WP_053866393.1|205035_206820_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	5.8e-41
WP_004298354.1|206921_207365_+	dUTP diphosphatase	NA	Q332E8	Clostridium_botulinum_C_phage	48.0	1.3e-31
>prophage 15
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	232893	291440	2285232	tRNA,protease,transposase	Streptococcus_phage(28.57%)	47	NA	NA
WP_161802282.1|232893_234186_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	92.8	7.3e-211
WP_024394285.1|234580_236158_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	32.1	1.4e-19
WP_024394284.1|236192_237785_+	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	25.9	2.1e-10
WP_161802282.1|237938_239231_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	92.8	7.3e-211
WP_002938446.1|239665_240541_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_002938443.1|240555_241215_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002938442.1|241207_241840_+	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_002938441.1|241840_243079_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_002938440.1|243068_244010_+	3'-5' exoribonuclease YhaM family protein	NA	NA	NA	NA	NA
WP_002938439.1|244009_244876_+	phosphotransferase	NA	NA	NA	NA	NA
WP_002938438.1|244977_245790_+	pur operon repressor	NA	A0A1V0SKE5	Klosneuvirus	24.7	1.4e-05
WP_002938437.1|245884_246754_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002938433.1|247026_249246_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.3	1.9e-41
WP_002938432.1|249238_249706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002938418.1|249702_251106_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002938413.1|251246_251555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002938408.1|252011_252329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002938407.1|252334_253234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002938405.1|253396_254272_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_002938404.1|254273_255242_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	69.4	7.2e-46
WP_024394249.1|255394_257608_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_002940258.1|257641_257794_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002940255.1|257803_257980_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002940254.1|258089_258629_+	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	28.2	3.5e-10
WP_061286097.1|258772_263857_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_061286099.1|263961_265245_+|transposase	IS4-like element ISSsu2 family transposase	transposase	NA	NA	NA	NA
WP_002936184.1|265249_266506_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	73.6	3.4e-173
WP_002937818.1|267165_267942_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002937816.1|268137_269178_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_002937813.1|269333_270035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002937812.1|270034_270373_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
WP_002937810.1|270642_271101_+	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002937803.1|271104_273558_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	39.9	9.8e-124
WP_002937801.1|273676_274168_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A291I9M1	Lactobacillus_phage	39.4	1.5e-23
WP_002937798.1|274365_274749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002937793.1|274768_275002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002937789.1|274998_275241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002937787.1|275354_276359_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_053866407.1|276351_277218_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_002937783.1|280970_283202_-	bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB	NA	NA	NA	NA	NA
WP_002937782.1|283566_284859_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	36.2	2.8e-69
WP_013730587.1|284968_285292_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_013730586.1|285405_286161_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.3	2.8e-21
WP_002938748.1|286170_286977_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002938752.1|286986_288246_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002938755.1|288529_290392_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002938756.1|290729_291440_-	aquaporin family protein	NA	M1HBN0	Acanthocystis_turfacea_Chlorella_virus	34.9	1.0e-28
>prophage 16
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	295212	299604	2285232		Clostridium_phage(100.0%)	1	NA	NA
WP_002938764.1|295212_299604_+	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	31.2	7.6e-18
>prophage 17
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	303961	305524	2285232		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_002938397.1|303961_305524_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.9	2.3e-09
>prophage 18
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	309492	318347	2285232	transposase	Synechococcus_phage(25.0%)	8	NA	NA
WP_002938371.1|309492_310107_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.7	1.0e-13
WP_002938367.1|310236_311400_+	MFS transporter	NA	NA	NA	NA	NA
WP_009910851.1|311614_312064_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002938364.1|312054_312783_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_105152558.1|312865_314216_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.8	3.3e-65
WP_002938355.1|314628_315138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002938352.1|315560_316838_+	uracil transporter	NA	Q9KX94	Enterobacteria_phage	37.7	3.0e-60
WP_161802282.1|317054_318347_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	92.8	7.3e-211
>prophage 19
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	321442	322084	2285232		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002938850.1|321442_322084_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.1	2.7e-33
>prophage 20
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	326778	330609	2285232	tRNA	Catovirus(50.0%)	4	NA	NA
WP_002938843.1|326778_328122_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	35.8	6.5e-53
WP_002938842.1|328114_328513_+	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_002938840.1|328514_329369_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002938838.1|329478_330609_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.6	3.6e-20
>prophage 21
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	336615	337908	2285232	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_162096930.1|336615_337908_-|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	99.8	8.8e-225
>prophage 22
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	341421	342855	2285232		Gordonia_phage(100.0%)	1	NA	NA
WP_002937373.1|341421_342855_+	putative DNA binding domain-containing protein	NA	A0A1B3AYT3	Gordonia_phage	36.6	6.2e-70
>prophage 23
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	353775	355479	2285232		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_002937421.1|353775_355479_+	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	32.4	4.2e-65
>prophage 24
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	358644	360712	2285232		Klosneuvirus(50.0%)	3	NA	NA
WP_002937414.1|358644_359547_+	SPFH domain-containing protein	NA	A0A1V0SL90	Klosneuvirus	32.7	7.2e-32
WP_009910800.1|359632_359842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024389055.1|359968_360712_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	2.5e-30
>prophage 25
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	365731	369012	2285232		Cedratvirus(50.0%)	3	NA	NA
WP_002938165.1|365731_366505_+	Fe-S cluster assembly ATPase SufC	NA	A0A1M7XV31	Cedratvirus	26.5	2.8e-08
WP_002938159.1|366521_367784_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_024390431.1|367788_369012_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.4	7.3e-104
>prophage 26
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	375098	377041	2285232		Planktothrix_phage(50.0%)	2	NA	NA
WP_002938146.1|375098_376097_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	5.9e-19
WP_002938145.1|376099_377041_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.9	3.0e-20
>prophage 27
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	385355	386566	2285232		Mycobacterium_phage(50.0%)	2	NA	NA
WP_002939203.1|385355_385769_-	HIT family protein	NA	B5LJ12	Mycobacterium_phage	29.7	2.6e-05
WP_002939204.1|385831_386566_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.6	1.1e-27
>prophage 28
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	391650	394473	2285232		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_004194727.1|391650_394473_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	22.6	2.4e-17
>prophage 29
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	411859	413341	2285232		Pandoravirus(100.0%)	1	NA	NA
WP_002937750.1|411859_413341_+	family 1 glycosylhydrolase	NA	A0A0B5JD41	Pandoravirus	24.6	3.3e-26
>prophage 30
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	423185	436838	2285232		Lactococcus_phage(33.33%)	15	NA	NA
WP_002937724.1|423185_423788_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	38.2	2.1e-27
WP_002937720.1|423799_424417_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	43.7	2.9e-32
WP_002937719.1|424413_425853_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_013730534.1|425936_426926_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_002942403.1|427097_427388_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_002942409.1|427399_427894_+	single-stranded DNA-binding protein	NA	A0A2H4J1H8	uncultured_Caudovirales_phage	72.5	4.5e-60
WP_002939250.1|427926_428166_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_002939249.1|428400_429057_-	DUF1129 family protein	NA	NA	NA	NA	NA
WP_002939248.1|429072_430017_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002939245.1|430358_433184_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.1	1.4e-304
WP_013730532.1|433282_434344_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	30.6	7.0e-18
WP_002942436.1|434407_434965_+	elongation factor P	NA	NA	NA	NA	NA
WP_002938280.1|434992_435385_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002938276.1|435374_435794_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_002938271.1|435872_436838_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.9	4.7e-21
>prophage 31
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	449813	453562	2285232	transposase	Streptococcus_phage(50.0%)	3	NA	NA
WP_002936184.1|449813_451070_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	73.6	3.4e-173
WP_002938246.1|451388_452744_-	aspartate kinase	NA	NA	NA	NA	NA
WP_009910719.1|452920_453562_+	HAD family phosphatase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.7	2.6e-07
>prophage 32
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	458631	459366	2285232		Bacillus_phage(100.0%)	1	NA	NA
WP_002938885.1|458631_459366_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	W8CYX9	Bacillus_phage	39.8	4.5e-08
>prophage 33
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	468088	469381	2285232	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_161802282.1|468088_469381_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	92.8	7.3e-211
>prophage 34
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	475106	479306	2285232	tRNA	Brochothrix_phage(33.33%)	4	NA	NA
WP_004194690.1|475106_475775_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	26.6	2.0e-10
WP_112493960.1|475951_476347_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_002938961.1|476391_477981_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	51.3	4.9e-132
WP_002938957.1|478031_479306_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.6	2.0e-91
>prophage 35
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	484096	485557	2285232		Moraxella_phage(100.0%)	1	NA	NA
WP_024390847.1|484096_485557_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.1	8.4e-38
>prophage 36
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	489574	490867	2285232	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_161802282.1|489574_490867_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	92.8	7.3e-211
>prophage 37
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	494230	495295	2285232		Planktothrix_phage(100.0%)	1	NA	NA
WP_002939276.1|494230_495295_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.9	1.4e-29
>prophage 38
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	519632	525007	2285232	transposase	Bacillus_phage(66.67%)	3	NA	NA
WP_002936184.1|519632_520889_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	73.6	3.4e-173
WP_002937982.1|521540_523268_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.9	2.4e-39
WP_002937979.1|523267_525007_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	5.4e-44
>prophage 39
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	532613	540057	2285232		Bacillus_virus(25.0%)	8	NA	NA
WP_009910298.1|532613_533441_+	DNA-formamidopyrimidine glycosylase	NA	G3MA33	Bacillus_virus	33.9	2.4e-26
WP_002935763.1|533433_534036_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_002935765.1|534022_535228_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_012775228.1|535227_535377_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002935768.1|535423_535657_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_002935770.1|536087_538457_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.8	6.0e-94
WP_002935771.1|538459_538927_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	55.7	4.7e-43
WP_024390437.1|539013_540057_-	Zn-dependent alcohol dehydrogenase	NA	K7Z7U2	Megavirus	21.7	3.0e-05
>prophage 40
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	543207	547442	2285232		uncultured_virus(50.0%)	4	NA	NA
WP_002935780.1|543207_545658_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.0	3.9e-96
WP_002935783.1|545736_546222_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_002935785.1|546316_546652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935794.1|546740_547442_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.8	1.2e-37
>prophage 41
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	551275	560819	2285232	tRNA,transposase	Streptococcus_phage(33.33%)	7	NA	NA
WP_002935801.1|551275_552448_-|transposase	IS110 family transposase	transposase	A0A1X9I5G9	Streptococcus_phage	95.9	2.1e-31
WP_009910275.1|552722_554048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053866419.1|554123_556760_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	33.0	1.9e-56
WP_009910268.1|556746_557529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935805.1|557648_558086_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_002935807.1|558380_559223_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_002935810.1|559676_560819_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.3	3.5e-84
>prophage 42
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	569622	580633	2285232	tRNA,transposase	Bacillus_phage(28.57%)	10	NA	NA
WP_002935825.1|569622_571575_+|tRNA	threonine--tRNA ligase	tRNA	A0A1V0SKZ9	Klosneuvirus	34.6	2.3e-67
WP_002935828.1|571646_572306_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002935835.1|572320_573019_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002935837.1|573033_573873_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002935839.1|573883_574645_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	5.0e-34
WP_002935840.1|574838_575543_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.8	8.1e-39
WP_002935841.1|575535_576885_+	cell wall metabolism sensor histidine kinase VicK	NA	W8CYF6	Bacillus_phage	34.5	2.1e-35
WP_002935843.1|576891_577695_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.6	3.6e-35
WP_002935596.1|578736_579939_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	92.8	6.8e-211
WP_002935846.1|580177_580633_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	31.9	2.6e-14
>prophage 43
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	586111	595985	2285232	transposase	Streptococcus_phage(40.0%)	7	NA	NA
WP_002935856.1|586111_586780_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	9.1e-32
WP_002935858.1|587148_588510_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002935860.1|588600_589299_+	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_002935861.1|589329_591666_-	cation-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	23.3	7.3e-36
WP_002935863.1|591902_593447_+	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	28.3	2.2e-36
WP_053338620.1|593746_595051_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	72.1	3.2e-166
WP_002935869.1|595181_595985_-	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	41.2	9.0e-26
>prophage 44
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	603868	606232	2285232		Mycobacterium_phage(100.0%)	1	NA	NA
WP_002935886.1|603868_606232_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	52.0	7.8e-86
>prophage 45
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	616025	620490	2285232	transposase	Erwinia_phage(33.33%)	3	NA	NA
WP_002938591.1|616025_617048_+	PhoH family protein	NA	W8D063	Erwinia_phage	48.6	3.3e-49
WP_161802282.1|617719_619012_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	92.8	7.3e-211
WP_024394246.1|619341_620490_-	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	33.3	8.0e-44
>prophage 46
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	631765	649045	2285232	tRNA	Escherichia_phage(33.33%)	16	NA	NA
WP_002937139.1|631765_633979_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.3	1.4e-76
WP_002937137.1|633957_635088_+	DUF3114 domain-containing protein	NA	NA	NA	NA	NA
WP_002937136.1|635141_635654_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.6	1.2e-31
WP_002937134.1|635757_636699_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_002937132.1|636708_637383_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	43.4	1.8e-11
WP_002937128.1|637384_638068_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_002937125.1|638057_638852_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_002937123.1|639027_639852_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_002937121.1|639949_640819_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	62.2	3.0e-99
WP_002937119.1|640818_641412_+	dTDP-4-dehydrorhamnose 3,5-epimerase family protein	NA	H9NC63	Sphingomonas_phage	33.1	5.1e-10
WP_002937118.1|641411_641897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002937117.1|642084_643131_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	44.5	1.3e-69
WP_002937114.1|643185_644037_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.4	2.1e-25
WP_002937113.1|644053_645094_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_061286106.1|645131_648539_+	GBS Bsp-like repeat-containing protein	NA	M4ZRP4	Bacillus_phage	33.5	4.8e-20
WP_074390297.1|648616_649045_+	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	42.1	3.4e-16
>prophage 47
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	654751	655966	2285232		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002937100.1|654751_655966_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	1.4e-09
>prophage 48
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	661321	662302	2285232		Catovirus(100.0%)	1	NA	NA
WP_002937088.1|661321_662302_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	31.1	1.6e-05
>prophage 49
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	669809	670331	2285232		Agrobacterium_phage(100.0%)	1	NA	NA
WP_032497583.1|669809_670331_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.1	9.0e-11
>prophage 50
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	674087	682346	2285232	transposase	Streptococcus_phage(83.33%)	7	NA	NA
WP_004194722.1|674087_676262_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	60.3	1.1e-230
WP_004194720.1|676377_677541_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	64.7	2.1e-140
WP_004194719.1|677537_678212_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	64.6	7.7e-79
WP_004194717.1|678215_679382_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	34.9	3.5e-39
WP_004194716.1|679389_680493_+	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002938966.1|680502_680841_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	100.0	1.9e-54
WP_002935153.1|681143_682346_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	93.8	3.2e-213
>prophage 51
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	686299	686932	2285232		Bacillus_virus(100.0%)	1	NA	NA
WP_002935147.1|686299_686932_+	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	33.8	2.0e-20
>prophage 52
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	701942	706448	2285232	transposase	Streptococcus_phage(100.0%)	3	NA	NA
WP_044686434.1|701942_703301_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	98.0	2.9e-250
WP_002938616.1|703859_704972_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	96.5	2.3e-213
WP_002936070.1|705191_706448_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	73.6	4.5e-173
>prophage 53
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	709542	716727	2285232	tRNA	Streptococcus_phage(60.0%)	8	NA	NA
WP_013730302.1|709542_710889_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.4	4.8e-56
WP_002938604.1|711160_711388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011922754.1|711377_711647_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5S8E8	Streptococcus_phage	51.2	1.8e-18
WP_002937278.1|712052_713372_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_002937263.1|713555_713933_+	RidA family protein	NA	NA	NA	NA	NA
WP_002937261.1|713954_714842_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.0	3.9e-06
WP_002937257.1|714838_715813_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	78.1	1.8e-145
WP_002937252.1|715809_716727_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	68.0	1.8e-110
>prophage 54
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	734099	735392	2285232	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_162492403.1|734099_735392_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	92.5	4.7e-210
>prophage 55
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	738421	739381	2285232		Cronobacter_phage(100.0%)	1	NA	NA
WP_002937228.1|738421_739381_+	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	37.1	5.3e-49
>prophage 56
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	746435	749209	2285232		Tupanvirus(50.0%)	2	NA	NA
WP_002937207.1|746435_747971_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	26.6	5.7e-37
WP_002937200.1|747967_749209_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	29.3	6.0e-21
>prophage 57
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	755739	758506	2285232		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_002937183.1|755739_756765_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.3	1.2e-14
WP_002937175.1|756778_757708_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014636900.1|757720_758506_-	ABC transporter ATP-binding protein	NA	M1I1A6	Acanthocystis_turfacea_Chlorella_virus	23.7	2.7e-06
>prophage 58
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	761708	830507	2285232	protease,transposase,holin	Streptococcus_phage(76.0%)	58	NA	NA
WP_002935350.1|761708_763946_+	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	94.0	1.4e-97
WP_002935351.1|763947_764091_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002935353.1|764269_764926_+	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	99.1	2.1e-113
WP_002935354.1|765019_765847_+	hypothetical protein	NA	M1PFV6	Streptococcus_phage	97.8	6.6e-133
WP_002935355.1|765852_767124_+	toxic anion resistance protein	NA	M1PLC8	Streptococcus_phage	100.0	1.7e-212
WP_002935357.1|767160_768027_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	99.7	4.6e-153
WP_002935358.1|768201_768840_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	98.6	2.6e-113
WP_002935359.1|768836_769721_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	98.3	3.6e-153
WP_002935361.1|769740_770058_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	100.0	3.1e-54
WP_002935362.1|770059_770923_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	99.7	2.1e-158
WP_002935363.1|771322_772414_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	98.6	1.5e-204
WP_002935364.1|772413_772971_+	GNAT family acetyltransferase	NA	M1PSC3	Streptococcus_phage	98.4	4.5e-93
WP_002935365.1|773344_774526_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	99.7	2.7e-220
WP_002935366.1|774528_775035_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	97.0	1.2e-92
WP_002935368.1|775018_775372_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	100.0	1.9e-60
WP_002935369.1|775388_776288_-	cation transporter	NA	M1Q1N9	Streptococcus_phage	98.0	2.8e-161
WP_002935370.1|776587_777415_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	99.6	8.3e-152
WP_002935371.1|777570_779232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935372.1|779391_780780_+	amino acid permease	NA	NA	NA	NA	NA
WP_002935373.1|780902_781784_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_002935375.1|781976_782813_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_002935376.1|782830_783706_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002935377.1|783828_784440_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_061286113.1|787397_789320_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_029694137.1|789596_790475_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_002935387.1|790799_791546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935389.1|792397_794116_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	99.0	0.0e+00
WP_002935390.1|794206_794776_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_002935392.1|794762_795311_-	phosphopantothenoylcysteine decarboxylase	NA	A0A068EHP1	Penguinpox_virus	37.8	2.8e-23
WP_022540619.1|795303_795999_-	phosphopantothenate--cysteine ligase	NA	NA	NA	NA	NA
WP_002935394.1|796502_798173_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_002935395.1|798216_799026_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002935400.1|800800_801652_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002935402.1|801809_802427_+	DUF5052 family protein	NA	A0A2K9VCV0	Lactobacillus_phage	51.5	3.8e-48
WP_002935404.1|802427_802937_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_002935405.1|802926_803580_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_002935406.1|803590_803878_+	DUF1905 domain-containing protein	NA	NA	NA	NA	NA
WP_002935416.1|804174_804951_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_002935421.1|805082_805826_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002935426.1|805838_806813_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002935429.1|807001_807325_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002935430.1|807357_807663_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002935431.1|807675_808977_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002935432.1|809128_811573_+	glycyl radical protein	NA	A0A2H4YEI2	Aeromonas_phage	47.2	4.9e-06
WP_002935438.1|811587_812256_+	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	31.0	1.5e-21
WP_002935440.1|812287_813244_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002935441.1|813364_814459_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_002935442.1|814627_815704_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002935444.1|815776_816712_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_087013902.1|817312_818664_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.8	9.7e-65
WP_002935451.1|818742_820533_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	100.0	0.0e+00
WP_002935455.1|820699_821038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935458.1|821222_822590_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002935459.1|822879_825159_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.1	5.5e-129
WP_002935460.1|825600_826356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935463.1|827535_828300_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002935464.1|828542_828794_+|holin	holin	holin	NA	NA	NA	NA
WP_002935596.1|829304_830507_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	92.8	6.8e-211
>prophage 59
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	833870	834614	2285232		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002935470.1|833870_834614_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.3e-26
>prophage 60
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	847426	858088	2285232		Bacillus_virus(100.0%)	7	NA	NA
WP_002935480.1|847426_851080_+	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	23.6	5.5e-22
WP_024394247.1|851089_851734_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_053866396.1|851876_853826_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.7	3.5e-124
WP_002935485.1|853849_854452_+	Fic family protein	NA	NA	NA	NA	NA
WP_002935487.1|854484_854979_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_002935488.1|854981_855434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009909731.1|855634_858088_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	32.3	2.0e-92
>prophage 61
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	869513	871914	2285232	transposase	Streptococcus_phage(50.0%)	2	NA	NA
WP_161802282.1|869513_870806_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	92.8	7.3e-211
WP_002939454.1|870999_871914_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	29.5	8.1e-07
>prophage 62
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	875137	877388	2285232		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_002939139.1|875137_876061_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	31.0	6.7e-25
WP_002939138.1|876308_877388_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	37.0	3.0e-61
>prophage 63
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	883584	887099	2285232		Bacillus_phage(100.0%)	2	NA	NA
WP_013730350.1|883584_885321_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	1.6e-35
WP_002938582.1|885329_887099_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	5.5e-60
>prophage 64
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	890589	895063	2285232	transposase	Mycoplasma_phage(66.67%)	4	NA	NA
WP_002938590.1|890589_891792_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	93.8	2.5e-213
WP_002938670.1|892177_893086_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_002938664.1|893124_894279_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	40.7	4.0e-35
WP_002938659.1|894262_895063_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	23.5	1.3e-11
>prophage 65
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	906185	911005	2285232	tRNA	Bacillus_virus(50.0%)	5	NA	NA
WP_012775084.1|906185_907169_+	GMP reductase	NA	G3MBI2	Bacillus_virus	75.1	9.6e-139
WP_014636922.1|907238_908588_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_002934950.1|908685_909204_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002934953.1|909193_909919_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002934954.1|909949_911005_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X6WGT4	Pacmanvirus	25.1	1.1e-10
>prophage 66
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	916813	939365	2285232	tRNA,protease,transposase	Bacillus_phage(23.08%)	23	NA	NA
WP_002934964.1|916813_918025_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	47.1	2.2e-39
WP_002934965.1|918017_919886_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.3	2.7e-57
WP_002934966.1|919886_920222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002934967.1|920317_921277_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002934968.1|921403_921682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002934969.1|921693_921996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002934970.1|922048_922888_+	thymidylate synthase	NA	U5J9N5	Bacillus_phage	55.7	3.0e-88
WP_002934971.1|923225_923738_+	dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	35.4	1.4e-19
WP_002934974.1|923935_925162_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.2	1.2e-133
WP_002934975.1|925217_925805_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_002934976.1|925827_926241_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	44.4	1.5e-24
WP_002934977.1|926336_928169_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.4	4.4e-20
WP_002934978.1|928218_928401_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_002934980.1|928535_929843_+	excalibur calcium-binding domain-containing protein	NA	NA	NA	NA	NA
WP_161802282.1|930335_931628_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	92.8	7.3e-211
WP_002934983.1|931851_932433_+	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	53.5	2.1e-48
WP_002934984.1|932713_933793_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_002934985.1|933792_934626_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_009909811.1|934612_935221_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	31.5	2.9e-16
WP_002934988.1|935672_936932_+	serine hydroxymethyltransferase	NA	A0A240F2Y9	Aeromonas_phage	54.5	7.3e-99
WP_002934989.1|936931_937906_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_002934990.1|937906_938506_+	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	40.4	5.7e-25
WP_002934991.1|938606_939365_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	21.5	8.2e-05
>prophage 67
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	942447	946903	2285232		Acidithiobacillus_phage(50.0%)	3	NA	NA
WP_002934996.1|942447_944145_+	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	29.5	3.4e-22
WP_002934997.1|944141_945191_+	5-methylcytosine-specific restriction endonuclease system specificity protein McrC	NA	NA	NA	NA	NA
WP_002934999.1|945352_946903_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.6	1.4e-19
>prophage 68
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	952258	953329	2285232		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_002935006.1|952258_953329_+	tyrosine recombinase XerS	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.7	5.2e-05
>prophage 69
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	956624	959926	2285232		Streptococcus_phage(50.0%)	4	NA	NA
WP_002935012.1|956624_956882_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5SCV8	Streptococcus_phage	48.7	7.8e-16
WP_002935014.1|956871_957111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002935016.1|957202_959173_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_002935019.1|959173_959926_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	6.9e-28
>prophage 70
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	965572	976088	2285232	tRNA,integrase	Bacillus_phage(40.0%)	12	967919:967933	982743:982757
WP_002935037.1|965572_966409_-	AraC family transcriptional regulator	NA	D0R0F8	Streptococcus_phage	52.1	7.3e-79
WP_002935038.1|966485_967820_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
967919:967933	attL	GGCTAGAAAAGACAA	NA	NA	NA	NA
WP_002935039.1|968015_968765_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_002935040.1|968949_970149_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	28.3	7.1e-27
WP_001258320.1|970171_970399_-	DUF3173 family protein	NA	NA	NA	NA	NA
WP_002935042.1|970676_970901_-	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	39.3	3.4e-07
WP_002935043.1|971066_971801_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002935044.1|971784_972549_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002935046.1|972550_973459_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	46.9	8.6e-41
WP_002935048.1|974695_974851_-	type A2 lantipeptide	NA	NA	NA	NA	NA
WP_002935049.1|974879_975035_-	type A2 lantipeptide	NA	NA	NA	NA	NA
WP_002935052.1|975389_976088_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.9	4.9e-28
982743:982757	attR	GGCTAGAAAAGACAA	NA	NA	NA	NA
>prophage 71
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	980496	989803	2285232		Bacillus_phage(40.0%)	11	NA	NA
WP_053866460.1|980496_983004_-	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	44.2	1.7e-09
WP_002935066.1|983039_983807_-	zeta toxin family protein	NA	NA	NA	NA	NA
WP_002935067.1|983806_984283_-	helix-turn-helix transcriptional regulator	NA	X2CXD8	Lactobacillus_phage	34.8	3.6e-06
WP_002935069.1|984352_984643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002935071.1|984692_985082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002935073.1|985078_985306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002935075.1|985359_986436_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_001820670.1|986498_988355_-	recombinase family protein	NA	Q2XVV3	Bacillus_phage	25.9	1.0e-24
WP_001820669.1|988409_988601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001206986.1|988672_988903_-	hypothetical protein	NA	A0A223LEC3	Bacillus_phage	48.5	3.2e-13
WP_000743700.1|988948_989803_-	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	30.2	1.7e-06
>prophage 72
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	994559	1008110	2285232		Streptococcus_phage(50.0%)	9	NA	NA
WP_002779755.1|994559_994733_-	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	100.0	4.6e-28
WP_000691758.1|994784_996704_-	tetracycline resistance ribosomal protection protein Tet(O)	NA	A0A1B0RXH7	Streptococcus_phage	98.9	0.0e+00
WP_001129922.1|997075_997450_-	TnpV protein	NA	D0R0F4	Streptococcus_phage	96.8	6.6e-64
WP_002935082.1|997389_998121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002935084.1|998216_998507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024401832.1|998520_998820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024401833.1|998890_1000234_-	hypothetical protein	NA	H2DE57	Erwinia_phage	32.0	2.8e-56
WP_024402041.1|1000371_1002150_-	reverse transcriptase/maturase family protein	NA	A0A0U4J920	Pseudomonas_phage	28.3	4.4e-25
WP_061286114.1|1002647_1008110_-	DEAD/DEAH box helicase family protein	NA	A0A248SL14	Klebsiella_phage	31.7	3.5e-153
>prophage 73
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1026232	1039475	2285232		Streptococcus_phage(33.33%)	14	NA	NA
WP_053866446.1|1026232_1027588_-	DNA (cytosine-5-)-methyltransferase	NA	A0A141E1L1	Streptococcus_phage	56.3	4.7e-128
WP_024401260.1|1027736_1028555_-	replication initiator protein A	NA	A0A286QNA4	Streptococcus_phage	35.5	4.9e-11
WP_032499127.1|1028557_1028725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002936483.1|1028925_1029291_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002936486.1|1029356_1029851_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_013730365.1|1030427_1032521_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	36.5	2.4e-102
WP_002936492.1|1032613_1033456_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	43.8	1.5e-31
WP_009909865.1|1033999_1034260_-	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_002936495.1|1034388_1034712_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_053866445.1|1034708_1036409_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.3	6.3e-13
WP_002936497.1|1036464_1037016_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_053866444.1|1037005_1037656_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_002936500.1|1037688_1038699_-	YdcF family protein	NA	NA	NA	NA	NA
WP_002936501.1|1038695_1039475_-	ribonuclease HII	NA	R4THQ2	Phaeocystis_globosa_virus	38.3	4.5e-22
>prophage 74
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1045207	1047538	2285232		Beluga_whale_alphaherpesvirus(33.33%)	3	NA	NA
WP_002936509.1|1045207_1045861_-	uracil-DNA glycosylase	NA	A0A286RUF9	Beluga_whale_alphaherpesvirus	45.4	1.0e-35
WP_013730366.1|1045870_1046797_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	49.3	1.1e-75
WP_013730367.1|1046905_1047538_-	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	34.1	4.0e-05
>prophage 75
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1050791	1051697	2285232		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_014637013.1|1050791_1051697_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.0	1.2e-05
>prophage 76
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1071786	1121519	2285232	transposase,integrase	Leptospira_phage(20.0%)	41	1076372:1076387	1128055:1128070
WP_002935170.1|1071786_1072527_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.1	4.5e-32
WP_002935171.1|1072582_1073074_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002935173.1|1073373_1074906_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	23.2	8.8e-30
1076372:1076387	attL	GTTATTCAAGAAAAAT	NA	NA	NA	NA
WP_014635984.1|1076616_1076757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094122540.1|1077033_1077881_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	26.6	1.5e-07
WP_079739435.1|1077929_1078520_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	28.0	8.6e-10
WP_002935179.1|1078704_1079514_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002935182.1|1081301_1081487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935183.1|1081467_1081818_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002935185.1|1082028_1082781_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_145888480.1|1084457_1085304_+|transposase	IS630-like element ISSsu3 family transposase	transposase	S5VXX4	Leptospira_phage	25.4	1.1e-08
WP_061286118.1|1085876_1087643_-	L-fucose isomerase	NA	NA	NA	NA	NA
WP_002935195.1|1088642_1090934_-	glycoside hydrolase family 95 protein	NA	NA	NA	NA	NA
WP_002935197.1|1090991_1091792_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_002935201.1|1091788_1092562_-	PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_002935202.1|1092584_1093055_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_014637023.1|1093045_1093477_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002935205.1|1093469_1093910_-	RbsD/FucU family protein	NA	NA	NA	NA	NA
WP_002935206.1|1093921_1094560_-	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_002935207.1|1094670_1096074_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_002935208.1|1096250_1097015_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002935210.1|1097995_1098949_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.2	1.1e-38
WP_002935211.1|1099185_1100190_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_002935214.1|1101590_1102484_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_002935218.1|1102550_1103957_-	6-phospho-beta-galactosidase	NA	NA	NA	NA	NA
WP_002935220.1|1105875_1106193_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002935221.1|1106224_1107058_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002935222.1|1107245_1108223_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002935223.1|1108224_1109157_-	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
WP_002935224.1|1109166_1109682_-	galactose-6-phosphate isomerase subunit LacB	NA	NA	NA	NA	NA
WP_002935225.1|1109708_1110131_-	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
WP_053866428.1|1110284_1111052_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_009909915.1|1111330_1112086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935231.1|1112454_1113486_+|integrase	tyrosine-type recombinase/integrase	integrase	E3W8I1	Leuconostoc_phage	27.3	5.9e-30
WP_002935232.1|1113711_1114254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002935233.1|1114273_1114744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002935234.1|1114875_1115676_+	helix-turn-helix transcriptional regulator	NA	E8ZD74	Streptococcus_phage	50.9	2.6e-65
WP_013730386.1|1116338_1117499_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_029694144.1|1117677_1118070_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_002935237.1|1118053_1119796_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.0	3.2e-52
WP_002935238.1|1119782_1121519_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	1.8e-39
1128055:1128070	attR	GTTATTCAAGAAAAAT	NA	NA	NA	NA
>prophage 77
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1125676	1127780	2285232		Tupanvirus(50.0%)	2	NA	NA
WP_013730387.1|1125676_1126654_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	34.1	9.2e-41
WP_002935247.1|1126664_1127780_+	cysteine desulfurase	NA	A0A141ZJV0	Faustovirus	28.4	2.2e-30
>prophage 78
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1131346	1133791	2285232		Bacillus_virus(100.0%)	1	NA	NA
WP_002935255.1|1131346_1133791_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.7	6.6e-104
>prophage 79
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1139464	1144674	2285232		Staphylococcus_phage(50.0%)	5	NA	NA
WP_002935272.1|1139464_1141000_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	5.7e-21
WP_002935274.1|1141194_1142262_-	BMP family protein	NA	NA	NA	NA	NA
WP_002935275.1|1142342_1142732_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_002935276.1|1142718_1143381_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_002935277.1|1143396_1144674_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	53.3	2.5e-115
>prophage 80
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1148411	1155076	2285232	transposase	Bacillus_phage(40.0%)	7	NA	NA
WP_002935290.1|1148411_1149791_-	HAMP domain-containing histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	32.4	9.1e-10
WP_009909965.1|1149783_1150455_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	2.8e-25
WP_002935294.1|1150648_1151029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162096930.1|1151323_1152616_+|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	99.8	8.8e-225
WP_002937611.1|1152817_1153474_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_002937614.1|1153502_1154261_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	5.9e-19
WP_002937615.1|1154272_1155076_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.6	2.8e-11
>prophage 81
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1160721	1161468	2285232		Streptomyces_phage(100.0%)	1	NA	NA
WP_002937637.1|1160721_1161468_-	potassium channel family protein	NA	A0A2L1IVV9	Streptomyces_phage	34.5	3.9e-07
>prophage 82
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1182876	1183440	2285232		Pneumococcus_phage(100.0%)	1	NA	NA
WP_002938082.1|1182876_1183440_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	52.2	3.0e-44
>prophage 83
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1189832	1190876	2285232	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_002938060.1|1189832_1190876_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	32.0	2.8e-27
>prophage 84
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1200568	1202368	2285232		Vaccinia_virus(100.0%)	1	NA	NA
WP_002938035.1|1200568_1202368_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	45.3	5.0e-141
>prophage 85
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1214264	1220831	2285232		Catovirus(33.33%)	6	NA	NA
WP_002936023.1|1214264_1215308_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	26.9	3.2e-15
WP_002936024.1|1215318_1217277_-	NAD-dependent DNA ligase LigA	NA	A0A1W6DX16	Sphingobium_phage	35.1	4.0e-96
WP_002936026.1|1217399_1217546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002936027.1|1217547_1218453_+	permease	NA	NA	NA	NA	NA
WP_002936028.1|1218449_1219265_+	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_002936030.1|1219343_1220831_+	glucose-6-phosphate dehydrogenase	NA	E3SJC5	Synechococcus_phage	36.3	5.8e-71
>prophage 86
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1228649	1229336	2285232		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_002936041.1|1228649_1229336_-	ribonuclease III	NA	A0A167RGU4	Powai_lake_megavirus	31.4	1.9e-24
>prophage 87
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1242323	1245823	2285232		Enterococcus_phage(66.67%)	3	NA	NA
WP_002936054.1|1242323_1242542_+	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	43.8	1.7e-11
WP_002936055.1|1242574_1244734_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	61.5	9.2e-259
WP_002936057.1|1244863_1245823_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	67.9	1.1e-126
>prophage 88
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1249441	1274568	2285232	tRNA,protease,transposase	Streptococcus_phage(66.67%)	25	NA	NA
WP_002935134.1|1249441_1250731_-|transposase	IS4-like element ISSsu2 family transposase	transposase	NA	NA	NA	NA
WP_161802282.1|1251234_1252527_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	92.8	7.3e-211
WP_013730412.1|1252729_1256224_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_002936070.1|1256462_1257719_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	73.6	4.5e-173
WP_002936072.1|1257734_1258052_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_002936073.1|1258058_1258874_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_002936077.1|1258860_1259637_-	PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_002936080.1|1259656_1260148_-	PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB	NA	NA	NA	NA	NA
WP_053866435.1|1260157_1261348_-	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_002936085.1|1261359_1261794_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_022540650.1|1262079_1262721_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_002936090.1|1262731_1263733_-	sugar kinase	NA	NA	NA	NA	NA
WP_002936092.1|1263749_1264391_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_002936093.1|1264442_1265258_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002936094.1|1266168_1267263_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_002936095.1|1267370_1268045_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002936096.1|1268054_1268372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012775187.1|1268381_1269071_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_009910094.1|1269096_1269303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013730414.1|1269324_1270083_-	DUF3169 family protein	NA	NA	NA	NA	NA
WP_009910096.1|1270079_1270295_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013730415.1|1270307_1270874_-	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_002938096.1|1271024_1271219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002938097.1|1271422_1271875_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_002938098.1|1271949_1274568_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.5	1.5e-61
>prophage 89
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1281497	1289620	2285232	tRNA	Pandoravirus(50.0%)	7	NA	NA
WP_074390814.1|1281497_1283555_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	31.1	5.8e-85
WP_002938116.1|1283654_1284248_+	DUF1361 domain-containing protein	NA	NA	NA	NA	NA
WP_002938119.1|1284548_1285586_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	34.3	2.2e-45
WP_002938121.1|1285595_1286621_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	35.2	3.2e-44
WP_002938123.1|1286666_1287536_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002938125.1|1287548_1288616_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_002938126.1|1288819_1289620_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.8	9.0e-10
>prophage 90
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1296809	1311287	2285232	transposase	Streptococcus_phage(66.67%)	15	NA	NA
WP_014637053.1|1296809_1297442_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.3	3.9e-32
WP_014637054.1|1297451_1298093_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014637055.1|1298246_1300058_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	37.6	9.5e-100
WP_053866436.1|1300489_1301839_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_053866437.1|1302012_1302228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053866438.1|1302274_1303072_-	AAA family ATPase	NA	A0A1V0DZZ0	Clostridioides_phage	33.1	2.0e-17
WP_079739431.1|1303158_1304436_-	zeta toxin family protein	NA	NA	NA	NA	NA
WP_000301765.1|1304437_1304710_-	antitoxin	NA	A0A1X9I6E5	Streptococcus_phage	100.0	5.0e-05
WP_000527318.1|1304726_1304936_-	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	98.6	1.4e-31
WP_002334978.1|1305034_1305931_-	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	97.2	9.0e-152
WP_074390291.1|1306019_1306304_-	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	A0A1X9I6W8	Streptococcus_phage	97.7	1.4e-42
WP_012477196.1|1306449_1307187_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	98.0	2.2e-132
WP_001809736.1|1307311_1307407_-	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_053866439.1|1308175_1308493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161802282.1|1309994_1311287_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	92.8	7.3e-211
>prophage 91
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1316086	1317814	2285232		Streptococcus_phage(100.0%)	1	NA	NA
WP_061286134.1|1316086_1317814_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	32.3	1.1e-41
>prophage 92
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1323532	1327637	2285232	transposase	Staphylococcus_phage(50.0%)	2	NA	NA
WP_061286137.1|1323532_1326124_-	CHAP domain-containing protein	NA	Q4Z9D9	Staphylococcus_phage	39.0	1.0e-06
WP_145888480.1|1326790_1327637_+|transposase	IS630-like element ISSsu3 family transposase	transposase	S5VXX4	Leptospira_phage	25.4	1.1e-08
>prophage 93
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1332221	1334792	2285232	transposase	Streptococcus_virus(50.0%)	3	NA	NA
WP_053866477.1|1332221_1333085_-	replication initiator protein A	NA	Q9MCM7	Streptococcus_virus	39.4	5.0e-14
WP_053866472.1|1333097_1333259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061286142.1|1333535_1334792_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	56.1	3.7e-127
>prophage 94
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1344297	1359309	2285232		Streptomyces_phage(16.67%)	11	NA	NA
WP_002935534.1|1344297_1347408_-	DNA polymerase III subunit alpha	NA	A0A1C9LWZ5	Streptomyces_phage	29.3	3.2e-119
WP_002935537.1|1347565_1347940_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002935539.1|1347932_1348640_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	2.1e-18
WP_002935541.1|1348656_1349439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935542.1|1349482_1350484_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_002935545.1|1351189_1351783_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	100.0	3.8e-106
WP_002935553.1|1353896_1354220_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_002935555.1|1354604_1355723_-	RNA polymerase sigma factor RpoD	NA	M4SMP8	Cyanophage	34.1	7.3e-34
WP_002935556.1|1355725_1357516_-	DNA primase	NA	A0A1S5RFR1	Helicobacter_phage	32.7	9.2e-47
WP_002935562.1|1357697_1358063_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_002935565.1|1358295_1359309_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	49.5	1.6e-91
>prophage 95
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1364598	1366866	2285232		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_002935577.1|1364598_1366866_-	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.2	2.2e-08
>prophage 96
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1375783	1377040	2285232	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_002936184.1|1375783_1377040_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	73.6	3.4e-173
>prophage 97
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1392236	1393781	2285232		Tupanvirus(100.0%)	1	NA	NA
WP_009910410.1|1392236_1393781_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.9	3.5e-50
>prophage 98
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1400358	1551839	2285232	portal,terminase,tail,protease,transposase,holin,tRNA,capsid,integrase	Streptococcus_phage(90.55%)	185	1479477:1479529	1517910:1517962
WP_002935669.1|1400358_1402257_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	29.7	7.7e-52
WP_002935672.1|1402307_1402673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002935675.1|1402683_1403379_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_002935676.1|1403444_1404221_-	esterase family protein	NA	NA	NA	NA	NA
WP_002935677.1|1404285_1405947_-	ribonuclease J	NA	NA	NA	NA	NA
WP_002935678.1|1406202_1406607_-	lipoprotein	NA	NA	NA	NA	NA
WP_087013902.1|1406967_1408319_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.8	9.7e-65
WP_002935680.1|1408353_1408542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002935681.1|1408724_1409483_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	5.3e-12
WP_002935682.1|1409479_1410346_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002935683.1|1410368_1411370_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002935684.1|1412126_1413551_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_002935685.1|1413565_1415407_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002935686.1|1415417_1416257_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002935687.1|1416562_1418221_+	fibronectin/fibrinogen-binding protein	NA	NA	NA	NA	NA
WP_002935688.1|1418246_1418963_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002935689.1|1418966_1420196_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_002935690.1|1420185_1421352_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002935691.1|1421487_1422492_+	lactonase family protein	NA	NA	NA	NA	NA
WP_002935693.1|1422555_1422741_+	hypothetical protein	NA	W6LMT3	Streptococcus_phage	68.9	2.3e-17
WP_002935700.1|1422773_1423415_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_002935704.1|1423666_1424974_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	100.0	8.3e-247
WP_002935706.1|1425123_1425576_+	DUF1694 domain-containing protein	NA	NA	NA	NA	NA
WP_002935708.1|1425585_1425813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002935718.1|1425803_1426931_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	58.0	5.7e-87
WP_002935722.1|1427038_1427689_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_002935723.1|1427719_1428355_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_002935725.1|1428406_1430131_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_002939427.1|1430219_1432172_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.8	2.2e-142
WP_002939430.1|1432353_1432893_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_012027447.1|1432906_1434136_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_162096930.1|1434630_1435923_+|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	99.8	8.8e-225
WP_014636072.1|1436208_1436490_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_013730454.1|1436569_1437598_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_013730455.1|1437584_1438529_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_012775265.1|1438623_1439085_+	flavodoxin	NA	NA	NA	NA	NA
WP_002940393.1|1439224_1439494_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_013730456.1|1439575_1439854_+	chorismate mutase	NA	NA	NA	NA	NA
WP_024390438.1|1439843_1441058_+	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	100.0	8.3e-225
WP_024395066.1|1441176_1441392_-	hypothetical protein	NA	A3F673	Streptococcus_phage	67.2	4.2e-15
WP_053866423.1|1441566_1442316_-	phage antirepressor KilAC domain-containing protein	NA	M1PKL6	Streptococcus_phage	90.8	5.3e-121
WP_024395064.1|1442317_1442548_-	hypothetical protein	NA	M1PF88	Streptococcus_phage	97.4	1.1e-34
WP_024395063.1|1442671_1442851_-	hypothetical protein	NA	A0A0E3U2Q1	Fusobacterium_phage	59.3	2.6e-10
WP_099779929.1|1443053_1443215_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_024395062.1|1443410_1444130_-	SH3 domain-containing protein	NA	M1PRP8	Streptococcus_phage	95.4	5.8e-133
WP_002937841.1|1444113_1444464_-|holin	phage holin	holin	A0A1X9I630	Streptococcus_phage	100.0	2.1e-56
WP_014636661.1|1444466_1444766_-	hypothetical protein	NA	A0A1S5SA32	Streptococcus_phage	100.0	7.6e-47
WP_002937844.1|1444769_1445114_-	hypothetical protein	NA	A0A1X9I644	Streptococcus_phage	100.0	8.7e-63
WP_002937846.1|1445116_1445335_-	hypothetical protein	NA	A0A1X9I6F7	Streptococcus_phage	100.0	1.5e-28
WP_002937853.1|1450607_1451303_-	adenylosuccinate synthetase	NA	M1PFK1	Streptococcus_phage	100.0	5.8e-130
WP_044768633.1|1451302_1453885_-|tail	phage tail protein	tail	M1NRZ6	Streptococcus_phage	98.3	3.5e-257
WP_044666863.1|1453874_1454258_-	DUF5361 domain-containing protein	NA	M1PS20	Streptococcus_phage	100.0	3.6e-65
WP_002937863.1|1454254_1454533_-	hypothetical protein	NA	M1PFS2	Streptococcus_phage	100.0	1.1e-42
WP_002937867.1|1454543_1455131_-	hypothetical protein	NA	M1NS84	Streptococcus_phage	100.0	5.1e-103
WP_002937874.1|1455146_1455482_-	hypothetical protein	NA	M1PFK6	Streptococcus_phage	100.0	2.2e-55
WP_002937877.1|1455478_1455718_-	hypothetical protein	NA	M1NS01	Streptococcus_phage	100.0	6.3e-36
WP_002937879.1|1455710_1456049_-	hypothetical protein	NA	M1PS26	Streptococcus_phage	100.0	2.3e-60
WP_002937880.1|1456035_1456431_-	phage Gp19/Gp15/Gp42 family protein	NA	M1Q1D8	Streptococcus_phage	100.0	4.4e-66
WP_002937881.1|1456434_1456659_-	hypothetical protein	NA	M1PL08	Streptococcus_phage	100.0	1.2e-31
WP_002937882.1|1456660_1457563_-|capsid	phage major capsid protein	capsid	M1PFL0	Streptococcus_phage	100.0	1.4e-173
WP_002937883.1|1457577_1458048_-	DUF4355 domain-containing protein	NA	M1Q1L0	Streptococcus_phage	100.0	3.5e-78
WP_002937884.1|1458130_1459546_-|terminase	terminase	terminase	M1PL91	Streptococcus_phage	100.0	1.1e-265
WP_002937901.1|1459890_1460103_-	hypothetical protein	NA	M1Q1E3	Streptococcus_phage	100.0	8.1e-35
WP_002937903.1|1460099_1461179_-	hypothetical protein	NA	M1PL14	Streptococcus_phage	100.0	5.7e-209
WP_002937907.1|1461171_1462437_-|portal	phage portal protein	portal	M1PFL4	Streptococcus_phage	100.0	7.0e-243
WP_002937910.1|1462433_1462796_-	hypothetical protein	NA	M1PRL3	Streptococcus_phage	71.7	9.0e-26
WP_002937914.1|1462874_1463222_-	HNH endonuclease	NA	M1Q1E9	Streptococcus_phage	100.0	1.5e-62
WP_002937915.1|1463318_1463753_-	DUF1492 domain-containing protein	NA	A0A1X9I5B5	Streptococcus_phage	100.0	2.0e-72
WP_002937919.1|1463829_1464081_-	hypothetical protein	NA	M1PFL8	Streptococcus_phage	100.0	1.7e-39
WP_002937922.1|1464092_1464362_-	hypothetical protein	NA	M1NS18	Streptococcus_phage	100.0	1.6e-43
WP_002937925.1|1464361_1464538_-	hypothetical protein	NA	M1PS40	Streptococcus_phage	100.0	5.7e-26
WP_002937935.1|1464537_1464771_-	hypothetical protein	NA	M1Q1F5	Streptococcus_phage	100.0	1.9e-37
WP_002937939.1|1464786_1465089_-	DUF1372 family protein	NA	M1PL25	Streptococcus_phage	100.0	9.4e-53
WP_002937943.1|1465098_1465617_-	hypothetical protein	NA	M1PFM2	Streptococcus_phage	100.0	1.7e-89
WP_002937944.1|1465613_1465946_-	hypothetical protein	NA	M1NS23	Streptococcus_phage	100.0	5.3e-57
WP_002937949.1|1466258_1466633_-	hypothetical protein	NA	M1Q1F9	Streptococcus_phage	100.0	2.8e-70
WP_002937951.1|1466660_1467122_-	single-stranded DNA-binding protein	NA	M1PL31	Streptococcus_phage	100.0	2.0e-70
WP_002937955.1|1467224_1467404_-	hypothetical protein	NA	M1NS29	Streptococcus_phage	100.0	1.9e-24
WP_002937956.1|1467393_1467720_-	hypothetical protein	NA	M1PS51	Streptococcus_phage	100.0	6.1e-58
WP_002935596.1|1468095_1469298_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	92.8	6.8e-211
WP_044769722.1|1470662_1471433_-	phage recombination protein Bet	NA	M1PFN1	Streptococcus_phage	99.2	6.2e-141
WP_004195116.1|1471429_1471609_-	hypothetical protein	NA	A0A1X9I5S5	Streptococcus_phage	100.0	2.4e-24
WP_014636677.1|1471747_1471891_-	hypothetical protein	NA	A0A1X9I5P7	Streptococcus_phage	100.0	7.1e-19
WP_004194647.1|1472428_1472794_-	hypothetical protein	NA	A0A1X9I5L0	Streptococcus_phage	100.0	5.8e-65
WP_004194648.1|1472846_1473071_-	hypothetical protein	NA	A0A1X9I5Q2	Streptococcus_phage	100.0	8.3e-30
WP_014636678.1|1473051_1473309_-	hypothetical protein	NA	A0A1X9I620	Streptococcus_phage	100.0	7.7e-40
WP_014636680.1|1473663_1474374_-	phage antirepressor KilAC domain-containing protein	NA	A0A1X9I742	Streptococcus_phage	100.0	2.6e-130
WP_014636681.1|1474427_1475117_+	DUF4145 domain-containing protein	NA	A0A1X9I6S1	Streptococcus_phage	100.0	4.0e-131
WP_004195135.1|1475212_1475434_-	hypothetical protein	NA	A0A1X9I662	Streptococcus_phage	100.0	1.3e-32
WP_004194666.1|1475469_1475655_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I675	Streptococcus_phage	100.0	1.4e-27
WP_024417669.1|1475669_1475870_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	100.0	3.1e-28
WP_029743813.1|1476130_1476436_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1X9I661	Streptococcus_phage	100.0	4.7e-52
WP_153308570.1|1476584_1476749_-	hypothetical protein	NA	A0A1X9I670	Streptococcus_phage	100.0	3.8e-16
WP_024417671.1|1476891_1477647_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I660	Streptococcus_phage	100.0	2.1e-141
WP_014636688.1|1477821_1478256_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1X9I6T4	Streptococcus_phage	100.0	2.3e-76
WP_061286144.1|1478381_1479476_+|integrase	site-specific integrase	integrase	A0A1X9I680	Streptococcus_phage	99.5	3.4e-209
1479477:1479529	attL	AAACCCTTGTGTATCAAGGGTTTTTGTTGTATTTTCATCTCCCCTGCAGGAAT	NA	NA	NA	NA
WP_024395066.1|1479611_1479827_-	hypothetical protein	NA	A3F673	Streptococcus_phage	67.2	4.2e-15
WP_053866423.1|1480001_1480751_-	phage antirepressor KilAC domain-containing protein	NA	M1PKL6	Streptococcus_phage	90.8	5.3e-121
WP_024395064.1|1480752_1480983_-	hypothetical protein	NA	M1PF88	Streptococcus_phage	97.4	1.1e-34
WP_024395063.1|1481106_1481286_-	hypothetical protein	NA	A0A0E3U2Q1	Fusobacterium_phage	59.3	2.6e-10
WP_099779929.1|1481488_1481650_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_024395062.1|1481845_1482565_-	SH3 domain-containing protein	NA	M1PRP8	Streptococcus_phage	95.4	5.8e-133
WP_002937841.1|1482548_1482899_-|holin	phage holin	holin	A0A1X9I630	Streptococcus_phage	100.0	2.1e-56
WP_014636661.1|1482901_1483201_-	hypothetical protein	NA	A0A1S5SA32	Streptococcus_phage	100.0	7.6e-47
WP_002937844.1|1483204_1483549_-	hypothetical protein	NA	A0A1X9I644	Streptococcus_phage	100.0	8.7e-63
WP_002937846.1|1483551_1483770_-	hypothetical protein	NA	A0A1X9I6F7	Streptococcus_phage	100.0	1.5e-28
WP_002937853.1|1489041_1489737_-	adenylosuccinate synthetase	NA	M1PFK1	Streptococcus_phage	100.0	5.8e-130
WP_044768633.1|1489736_1492319_-|tail	phage tail protein	tail	M1NRZ6	Streptococcus_phage	98.3	3.5e-257
WP_044666863.1|1492308_1492692_-	DUF5361 domain-containing protein	NA	M1PS20	Streptococcus_phage	100.0	3.6e-65
WP_002937863.1|1492688_1492967_-	hypothetical protein	NA	M1PFS2	Streptococcus_phage	100.0	1.1e-42
WP_002937867.1|1492977_1493565_-	hypothetical protein	NA	M1NS84	Streptococcus_phage	100.0	5.1e-103
WP_002937874.1|1493580_1493916_-	hypothetical protein	NA	M1PFK6	Streptococcus_phage	100.0	2.2e-55
WP_002937877.1|1493912_1494152_-	hypothetical protein	NA	M1NS01	Streptococcus_phage	100.0	6.3e-36
WP_002937879.1|1494144_1494483_-	hypothetical protein	NA	M1PS26	Streptococcus_phage	100.0	2.3e-60
WP_002937880.1|1494469_1494865_-	phage Gp19/Gp15/Gp42 family protein	NA	M1Q1D8	Streptococcus_phage	100.0	4.4e-66
WP_002937881.1|1494868_1495093_-	hypothetical protein	NA	M1PL08	Streptococcus_phage	100.0	1.2e-31
WP_002937882.1|1495094_1495997_-|capsid	phage major capsid protein	capsid	M1PFL0	Streptococcus_phage	100.0	1.4e-173
WP_002937883.1|1496011_1496482_-	DUF4355 domain-containing protein	NA	M1Q1L0	Streptococcus_phage	100.0	3.5e-78
WP_002937884.1|1496564_1497980_-|terminase	terminase	terminase	M1PL91	Streptococcus_phage	100.0	1.1e-265
WP_002937901.1|1498324_1498537_-	hypothetical protein	NA	M1Q1E3	Streptococcus_phage	100.0	8.1e-35
WP_002937903.1|1498533_1499613_-	hypothetical protein	NA	M1PL14	Streptococcus_phage	100.0	5.7e-209
WP_002937907.1|1499605_1500871_-|portal	phage portal protein	portal	M1PFL4	Streptococcus_phage	100.0	7.0e-243
WP_002937910.1|1500867_1501230_-	hypothetical protein	NA	M1PRL3	Streptococcus_phage	71.7	9.0e-26
WP_002937914.1|1501308_1501656_-	HNH endonuclease	NA	M1Q1E9	Streptococcus_phage	100.0	1.5e-62
WP_002937915.1|1501752_1502187_-	DUF1492 domain-containing protein	NA	A0A1X9I5B5	Streptococcus_phage	100.0	2.0e-72
WP_002937919.1|1502263_1502515_-	hypothetical protein	NA	M1PFL8	Streptococcus_phage	100.0	1.7e-39
WP_002937922.1|1502526_1502796_-	hypothetical protein	NA	M1NS18	Streptococcus_phage	100.0	1.6e-43
WP_002937925.1|1502795_1502972_-	hypothetical protein	NA	M1PS40	Streptococcus_phage	100.0	5.7e-26
WP_002937935.1|1502971_1503205_-	hypothetical protein	NA	M1Q1F5	Streptococcus_phage	100.0	1.9e-37
WP_002937939.1|1503220_1503523_-	DUF1372 family protein	NA	M1PL25	Streptococcus_phage	100.0	9.4e-53
WP_002937943.1|1503532_1504051_-	hypothetical protein	NA	M1PFM2	Streptococcus_phage	100.0	1.7e-89
WP_002937944.1|1504047_1504380_-	hypothetical protein	NA	M1NS23	Streptococcus_phage	100.0	5.3e-57
WP_002937949.1|1504692_1505067_-	hypothetical protein	NA	M1Q1F9	Streptococcus_phage	100.0	2.8e-70
WP_002937951.1|1505094_1505556_-	single-stranded DNA-binding protein	NA	M1PL31	Streptococcus_phage	100.0	2.0e-70
WP_002937955.1|1505658_1505838_-	hypothetical protein	NA	M1NS29	Streptococcus_phage	100.0	1.9e-24
WP_002937956.1|1505827_1506154_-	hypothetical protein	NA	M1PS51	Streptococcus_phage	100.0	6.1e-58
WP_002935596.1|1506529_1507732_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	92.8	6.8e-211
WP_014636674.1|1508058_1509087_-	DUF1351 domain-containing protein	NA	M1PL36	Streptococcus_phage	100.0	2.0e-134
WP_004195116.1|1509862_1510042_-	hypothetical protein	NA	A0A1X9I5S5	Streptococcus_phage	100.0	2.4e-24
WP_014636677.1|1510180_1510324_-	hypothetical protein	NA	A0A1X9I5P7	Streptococcus_phage	100.0	7.1e-19
WP_004194647.1|1510862_1511228_-	hypothetical protein	NA	A0A1X9I5L0	Streptococcus_phage	100.0	5.8e-65
WP_004194648.1|1511280_1511505_-	hypothetical protein	NA	A0A1X9I5Q2	Streptococcus_phage	100.0	8.3e-30
WP_014636678.1|1511485_1511743_-	hypothetical protein	NA	A0A1X9I620	Streptococcus_phage	100.0	7.7e-40
WP_014636680.1|1512097_1512808_-	phage antirepressor KilAC domain-containing protein	NA	A0A1X9I742	Streptococcus_phage	100.0	2.6e-130
WP_004195135.1|1513645_1513867_-	hypothetical protein	NA	A0A1X9I662	Streptococcus_phage	100.0	1.3e-32
WP_004194666.1|1513902_1514088_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I675	Streptococcus_phage	100.0	1.4e-27
WP_024417669.1|1514102_1514303_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	100.0	3.1e-28
WP_029743813.1|1514563_1514869_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1X9I661	Streptococcus_phage	100.0	4.7e-52
WP_153308570.1|1515017_1515182_-	hypothetical protein	NA	A0A1X9I670	Streptococcus_phage	100.0	3.8e-16
WP_024417671.1|1515324_1516080_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I660	Streptococcus_phage	100.0	2.1e-141
WP_014636688.1|1516254_1516689_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1X9I6T4	Streptococcus_phage	100.0	2.3e-76
WP_061286144.1|1516814_1517909_+|integrase	site-specific integrase	integrase	A0A1X9I680	Streptococcus_phage	99.5	3.4e-209
WP_023370923.1|1518215_1520240_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
1517910:1517962	attR	AAACCCTTGTGTATCAAGGGTTTTTGTTGTATTTTCATCTCCCCTGCAGGAAT	NA	NA	NA	NA
WP_024381607.1|1520501_1521107_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	55.7	7.9e-59
WP_024381608.1|1521219_1522251_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_013730461.1|1522400_1522991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002937287.1|1523098_1523854_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_002937288.1|1524224_1524935_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.7	2.6e-16
WP_002937291.1|1524934_1525699_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.3	2.8e-16
WP_002937293.1|1525698_1526646_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002937296.1|1526648_1527536_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002937297.1|1527741_1528911_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002937299.1|1529041_1529314_-	YlbG family protein	NA	NA	NA	NA	NA
WP_002937303.1|1529440_1530031_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	56.7	1.5e-54
WP_002937309.1|1530147_1530777_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_053866414.1|1530859_1532476_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_002937311.1|1532548_1533997_-	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_002937312.1|1534066_1534897_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002937313.1|1534907_1535780_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002937314.1|1535917_1537153_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002937316.1|1537165_1539340_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_002937318.1|1539444_1540284_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002937324.1|1540315_1541476_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002937325.1|1541479_1542571_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_002937331.1|1542772_1543039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002937335.1|1543315_1543567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935801.1|1543822_1544995_+|transposase	IS110 family transposase	transposase	A0A1X9I5G9	Streptococcus_phage	95.9	2.1e-31
WP_002937337.1|1545448_1546198_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002937340.1|1546187_1546460_+	GIY-YIG nuclease family protein	NA	S5MQN3	Choristoneura_occidentalis_alphabaculovirus	41.3	3.8e-05
WP_002936208.1|1546475_1547087_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002935134.1|1547269_1548559_+|transposase	IS4-like element ISSsu2 family transposase	transposase	NA	NA	NA	NA
WP_061286146.1|1548727_1549135_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002936206.1|1549246_1549849_-	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_002936205.1|1549835_1550114_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002936204.1|1550258_1551839_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.1	5.8e-61
>prophage 99
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1558277	1623868	2285232	tRNA,protease,transposase	Streptococcus_phage(23.53%)	61	NA	NA
WP_002936184.1|1558277_1559534_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	73.6	3.4e-173
WP_002936194.1|1559846_1560317_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_002936193.1|1560313_1562458_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_002936191.1|1562662_1563592_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002936190.1|1563584_1564277_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	33.2	5.2e-30
WP_099425916.1|1564419_1565515_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_024390910.1|1565549_1566677_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_002936187.1|1566717_1567206_-	VanZ family protein	NA	NA	NA	NA	NA
WP_002936186.1|1567374_1567791_-	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_002936185.1|1567924_1568101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171840846.1|1568208_1568394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002936184.1|1568532_1569789_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	73.6	3.4e-173
WP_053866454.1|1569942_1572630_-	cation-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	28.8	6.2e-71
WP_002936182.1|1572839_1573226_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_002936180.1|1573237_1574125_-	anion permease	NA	NA	NA	NA	NA
WP_002936179.1|1574223_1575537_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	33.9	8.9e-31
WP_009909496.1|1575526_1576336_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_161802282.1|1576506_1577799_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	92.8	7.3e-211
WP_004298713.1|1578013_1578766_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_012775011.1|1578940_1580137_-	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	28.2	2.5e-32
WP_009909491.1|1580492_1581464_-	anti sigma factor C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_024390428.1|1581444_1581948_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_014636830.1|1582062_1584759_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_002938463.1|1584779_1585994_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_002938468.1|1586130_1586496_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_002938471.1|1586492_1586996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002938476.1|1587108_1587963_+	glycoside hydrolase family 25 protein	NA	A0A2K5B2A3	Erysipelothrix_phage	27.9	1.9e-10
WP_002938477.1|1588140_1588689_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_002938478.1|1588791_1589649_+	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_002938479.1|1589632_1590115_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_002938482.1|1590117_1590744_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_002938484.1|1590846_1592337_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	40.9	8.7e-91
WP_002938486.1|1592685_1593822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002938493.1|1593818_1594661_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_145888480.1|1594824_1595671_+|transposase	IS630-like element ISSsu3 family transposase	transposase	S5VXX4	Leptospira_phage	25.4	1.1e-08
WP_014636829.1|1595942_1597007_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004194760.1|1597132_1598380_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004194759.1|1598380_1599076_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.2	4.1e-35
WP_004194758.1|1599056_1600214_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004194752.1|1601387_1602737_+	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_004194751.1|1602880_1603525_-	cyclase family protein	NA	NA	NA	NA	NA
WP_004194750.1|1603730_1604270_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_004194749.1|1604281_1604497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014636828.1|1604588_1604912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015646557.1|1605124_1606411_-	U32 family peptidase	NA	Q6DW11	Phage_TP	31.2	2.7e-40
WP_002938686.1|1606708_1607638_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_002938687.1|1607798_1608113_+	DUF3270 domain-containing protein	NA	NA	NA	NA	NA
WP_002938688.1|1608134_1608545_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022540576.1|1608951_1609779_-	class C sortase	NA	NA	NA	NA	NA
WP_002938691.1|1610136_1610523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162492404.1|1610541_1611144_-	signal peptidase I	NA	NA	NA	NA	NA
WP_002938694.1|1611133_1611427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002938697.1|1612864_1613713_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	42.0	1.0e-40
WP_002938699.1|1613842_1614577_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.1	7.9e-37
WP_002938702.1|1614569_1615259_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002938704.1|1615384_1615615_-	DUF1797 family protein	NA	NA	NA	NA	NA
WP_002938706.1|1615838_1618067_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	40.4	5.6e-126
WP_002938708.1|1618252_1618714_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002938710.1|1618768_1619077_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_162096930.1|1619563_1620856_+|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	99.8	8.8e-225
WP_002938831.1|1621078_1623868_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	27.7	1.6e-90
>prophage 100
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1647030	1651560	2285232		Bacillus_virus(50.0%)	5	NA	NA
WP_004194629.1|1647030_1647810_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	26.5	1.5e-09
WP_004194627.1|1647825_1648380_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	40.8	8.9e-33
WP_004194621.1|1648510_1649155_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_061286149.1|1649262_1650723_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	41.5	3.2e-98
WP_004194617.1|1650735_1651560_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	56.4	4.1e-74
>prophage 101
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1655943	1656432	2285232		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_002939048.1|1655943_1656432_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	34.2	1.2e-17
>prophage 102
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1661372	1675722	2285232	tRNA,transposase	uncultured_Mediterranean_phage(28.57%)	18	NA	NA
WP_004194742.1|1661372_1662251_-	ABC transporter ATP-binding protein	NA	A0A2R8FFL6	Cedratvirus	29.7	4.1e-16
WP_002937360.1|1662576_1663866_+|transposase	IS4-like element ISSsu2 family transposase	transposase	NA	NA	NA	NA
WP_004194743.1|1664018_1664537_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_013730504.1|1664741_1664954_+	CsbD family protein	NA	J7KJ36	Streptococcus_phage	55.6	2.1e-11
WP_013730505.1|1665123_1665558_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_013730506.1|1665689_1666112_+	membrane protein	NA	NA	NA	NA	NA
WP_002939444.1|1666101_1667901_+	acyltransferase	NA	C6ZR20	Salmonella_phage	22.7	5.0e-16
WP_002939437.1|1668124_1668778_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_009910581.1|1668802_1669360_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_002939238.1|1669683_1670229_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_009910583.1|1670796_1671036_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	48.7	2.8e-15
WP_002939235.1|1671035_1671767_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002939233.1|1671756_1672326_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.5	5.0e-15
WP_002939230.1|1672309_1673029_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.9	2.9e-07
WP_002939226.1|1673028_1673760_-	site-specific tyrosine recombinase XerD	NA	NA	NA	NA	NA
WP_002939222.1|1673756_1674215_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002939213.1|1674211_1674739_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_002939211.1|1674711_1675722_-	nucleoside-triphosphate diphosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	31.5	4.9e-13
>prophage 103
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1689783	1696670	2285232		Yellowstone_lake_phycodnavirus(50.0%)	5	NA	NA
WP_002938331.1|1689783_1692876_-	SNF2 helicase associated domain-containing protein	NA	A0A0P0YNJ0	Yellowstone_lake_phycodnavirus	30.4	1.4e-42
WP_002938333.1|1693015_1693324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002938335.1|1693731_1695042_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_053866418.1|1695060_1695774_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_002938337.1|1695770_1696670_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	32.5	2.8e-28
>prophage 104
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1700361	1712203	2285232	transposase	Streptococcus_phage(33.33%)	12	NA	NA
WP_002942698.1|1700361_1701789_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	29.7	3.8e-43
WP_013730515.1|1701885_1702425_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_002936674.1|1702434_1703352_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	50.5	1.4e-83
WP_002936682.1|1703365_1703590_-	DUF4059 family protein	NA	NA	NA	NA	NA
WP_002936685.1|1703607_1704951_-	DEAD/DEAH box helicase	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.1	2.6e-46
WP_014637131.1|1705030_1705294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162492405.1|1705502_1706795_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	97.5	3.5e-221
WP_002936698.1|1707925_1709182_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	73.4	7.6e-173
WP_002936699.1|1709237_1709927_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_002936700.1|1709935_1710256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002936703.1|1710266_1710812_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_009910530.1|1710820_1712203_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	37.8	7.2e-31
>prophage 105
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1717868	1720393	2285232		Planktothrix_phage(33.33%)	3	NA	NA
WP_022540669.1|1717868_1718627_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.3	5.0e-26
WP_002936726.1|1718724_1719717_-	sensor histidine kinase	NA	B5LWN0	Feldmannia_species_virus	24.9	7.2e-09
WP_002936735.1|1719709_1720393_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	3.1e-27
>prophage 106
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1725300	1726032	2285232		Bacillus_virus(100.0%)	1	NA	NA
WP_002936747.1|1725300_1726032_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.6	1.6e-26
>prophage 107
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1740627	1742101	2285232		Staphylococcus_phage(50.0%)	2	NA	NA
WP_002936792.1|1740627_1741470_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.3	1.7e-51
WP_002936797.1|1741585_1742101_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	32.1	1.2e-07
>prophage 108
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1747379	1749705	2285232		Staphylococcus_phage(50.0%)	2	NA	NA
WP_002936827.1|1747379_1748570_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	66.3	9.5e-141
WP_002936829.1|1749237_1749705_-	cytidine/deoxycytidylate deaminase family protein	NA	A7KUY9	Bacillus_phage	60.0	1.4e-34
>prophage 109
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1752904	1855670	2285232	protease,transposase,holin,tRNA,integrase	Streptococcus_phage(54.84%)	88	1792074:1792133	1876161:1876244
WP_002937360.1|1752904_1754194_-|transposase	IS4-like element ISSsu2 family transposase	transposase	NA	NA	NA	NA
WP_002936841.1|1754380_1756048_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	38.2	5.4e-49
WP_014638428.1|1756047_1756545_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002940218.1|1756609_1756879_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002936217.1|1757508_1758138_-	uridine kinase	NA	A0A2K9L178	Tupanvirus	38.5	4.5e-33
WP_002936219.1|1758220_1759207_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002936220.1|1759196_1760279_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.3	1.2e-28
WP_061286153.1|1760345_1761743_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_002936224.1|1762032_1762416_-	VOC family protein	NA	NA	NA	NA	NA
WP_002936226.1|1762521_1763214_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002936238.1|1763439_1764624_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_002936240.1|1764652_1765807_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_002936241.1|1766067_1767354_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_002936242.1|1767493_1767961_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_162096930.1|1768297_1769590_-|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	99.8	8.8e-225
WP_145888480.1|1769792_1770640_-|transposase	IS630-like element ISSsu3 family transposase	transposase	S5VXX4	Leptospira_phage	25.4	1.1e-08
WP_002936184.1|1770952_1772209_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	73.6	3.4e-173
WP_002936247.1|1772301_1772577_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	67.4	1.1e-23
WP_002936249.1|1772666_1773263_-	YpmS family protein	NA	NA	NA	NA	NA
WP_002936251.1|1773234_1774068_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002936253.1|1774060_1774894_-	DegV family protein	NA	NA	NA	NA	NA
WP_002936255.1|1774987_1776649_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002936261.1|1776651_1777077_-	arginine repressor	NA	NA	NA	NA	NA
WP_002936263.1|1777069_1777891_-	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_002936266.1|1777883_1778753_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_002936269.1|1778752_1778968_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_002936271.1|1778942_1780286_-	exodeoxyribonuclease VII large subunit	NA	L7RDW5	Acanthamoeba_polyphaga_moumouvirus	32.2	1.1e-36
WP_002936272.1|1780452_1781361_+	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	34.2	1.2e-34
WP_002936277.1|1782436_1782988_-	isoprenylcysteine carboxyl methyltransferase family protein	NA	NA	NA	NA	NA
WP_002936278.1|1783375_1784764_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002936279.1|1784765_1785416_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.4	4.7e-33
WP_002936280.1|1785647_1786349_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014636745.1|1788146_1789436_-|transposase	IS4-like element ISSsu2 family transposase	transposase	NA	NA	NA	NA
WP_002936284.1|1790486_1791923_+	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
1792074:1792133	attL	TCCAATGTCATTAAGTTAACTAACCTATCACGTTTTGTGGTGGGTTAGTTTTTATGTTAC	NA	NA	NA	NA
WP_014636745.1|1792157_1793447_+|transposase	IS4-like element ISSsu2 family transposase	transposase	NA	NA	NA	NA
WP_002936291.1|1793809_1794064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079254655.1|1794464_1795073_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	43.8	2.2e-08
WP_002936301.1|1797738_1797945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002936302.1|1798061_1798349_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002936303.1|1798329_1798515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002936306.1|1799820_1801053_-	N-acylneuraminate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011922122.1|1801061_1801712_-	acetyltransferase	NA	NA	NA	NA	NA
WP_002936318.1|1801701_1802835_-	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_002936321.1|1802846_1803863_-	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
WP_002936324.1|1804384_1805791_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_053866465.1|1805799_1806768_-	lipooligosaccharide sialyltransferase	NA	NA	NA	NA	NA
WP_079739436.1|1807126_1807384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009909574.1|1808257_1808569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002936340.1|1808608_1809613_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.6	6.0e-11
WP_002936347.1|1809605_1810604_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.8	4.7e-08
WP_011922117.1|1810742_1811975_-	polymerase	NA	NA	NA	NA	NA
WP_011922116.1|1812009_1813455_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002936352.1|1813768_1814926_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002936354.1|1814929_1816099_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_002936357.1|1816137_1817517_-	sugar transferase	NA	NA	NA	NA	NA
WP_002936359.1|1817541_1818273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002936361.1|1818311_1818989_-	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	97.3	7.6e-119
WP_002936363.1|1818998_1819688_-	capsular polysaccharide biosynthesis protein CpsC	NA	A0A1X9I5E1	Streptococcus_phage	98.3	9.8e-114
WP_024394229.1|1819705_1821151_-	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	99.1	7.6e-225
WP_012775019.1|1821255_1821990_-	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	99.5	1.5e-120
WP_011922108.1|1822112_1823372_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	98.8	1.2e-239
WP_002938910.1|1823470_1824322_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	98.6	1.3e-152
WP_002938911.1|1824448_1824853_+	TetR/AcrR family transcriptional regulator	NA	A0A1X9I6A2	Streptococcus_phage	97.8	6.0e-63
WP_002938914.1|1824875_1825661_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	96.9	8.2e-133
WP_002938916.1|1825670_1826909_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	95.6	2.7e-215
WP_002938922.1|1826918_1827995_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	98.0	3.1e-191
WP_024387276.1|1828155_1830669_-	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	98.3	0.0e+00
WP_002938932.1|1830731_1831370_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	99.1	6.7e-125
WP_002935153.1|1833084_1834287_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	93.8	3.2e-213
WP_002939032.1|1834474_1835383_-	EamA family transporter	NA	NA	NA	NA	NA
WP_009909376.1|1835457_1836939_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002939036.1|1836948_1838121_-	galactokinase	NA	NA	NA	NA	NA
WP_161802282.1|1838562_1839855_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	92.8	7.3e-211
WP_044771265.1|1840024_1840876_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	24.5	1.9e-05
WP_074390696.1|1841178_1841334_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002939042.1|1841651_1843091_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_002939044.1|1843090_1844557_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_002939046.1|1844556_1844859_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_012774968.1|1845076_1845751_-	hydrolase	NA	NA	NA	NA	NA
WP_011921928.1|1845936_1846284_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_024376330.1|1848312_1848864_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	38.7	9.5e-27
WP_002937605.1|1848865_1849654_-	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_002937606.1|1850124_1851339_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_004194294.1|1851493_1851946_+	universal stress protein	NA	NA	NA	NA	NA
WP_004194296.1|1851961_1852480_-	haloacid dehalogenase	NA	A0A0H3UZF4	Geobacillus_virus	35.5	8.9e-19
WP_004194297.1|1852481_1853327_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_014636805.1|1853396_1854356_+	asparaginase	NA	NA	NA	NA	NA
WP_002936184.1|1854413_1855670_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	73.6	3.4e-173
1876161:1876244	attR	TCCAATGTCATTAAGTTAACTAACCTATCACGTTTTGTGGTGGGTTAGTTTTTATGTTACACTAAAAATAAAAGGGGAAAAGTC	NA	NA	NA	NA
>prophage 110
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1866114	1870943	2285232	transposase	Only_Syngen_Nebraska_virus(50.0%)	3	NA	NA
WP_009909339.1|1866114_1867719_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	46.6	4.4e-141
WP_011921912.1|1867911_1868493_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_087013902.1|1869591_1870943_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.8	9.7e-65
>prophage 111
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1890333	1893078	2285232		Streptococcus_phage(50.0%)	3	NA	NA
WP_002937472.1|1890333_1892202_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.9	3.1e-93
WP_013730132.1|1892336_1892861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002937476.1|1892862_1893078_+	helix-turn-helix transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	29.9	8.0e-06
>prophage 112
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1898427	1901921	2285232		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
WP_002937503.1|1898427_1899564_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	29.6	1.9e-21
WP_002937513.1|1900097_1901921_-	molecular chaperone DnaK	NA	A0A167RF67	Powai_lake_megavirus	46.6	7.3e-132
>prophage 113
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1906564	1910045	2285232		Bacillus_phage(100.0%)	2	NA	NA
WP_013730124.1|1906564_1908307_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.6	1.5e-46
WP_024390900.1|1908296_1910045_+	ABC transporter ATP-binding protein	NA	W8CYT2	Bacillus_phage	50.9	6.5e-05
>prophage 114
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1916052	1923541	2285232	transposase	Klosneuvirus(33.33%)	5	NA	NA
WP_013730121.1|1916052_1917480_-	ABC transporter ATP-binding protein	NA	A0A1V0SI78	Klosneuvirus	26.2	6.1e-17
WP_002938996.1|1917443_1918103_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_024394223.1|1918099_1918693_-	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_013730119.1|1918693_1920355_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.1	7.8e-16
WP_162096930.1|1922248_1923541_-|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	99.8	8.8e-225
>prophage 115
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1928862	1929888	2285232		Tupanvirus(100.0%)	1	NA	NA
WP_002937592.1|1928862_1929888_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	24.5	4.2e-28
>prophage 116
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1939159	1940692	2285232		Klebsiella_phage(100.0%)	1	NA	NA
WP_061286163.1|1939159_1940692_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	1.5e-77
>prophage 117
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1949382	1955314	2285232		Brazilian_cedratvirus(33.33%)	6	NA	NA
WP_002937544.1|1949382_1950366_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.6	9.3e-17
WP_002937543.1|1950358_1951138_+	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_002937541.1|1951139_1951922_+	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_002937540.1|1951971_1952799_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_002937539.1|1952810_1954043_-	CapA family protein	NA	A0A0N9SJ77	Staphylococcus_phage	30.4	1.1e-27
WP_002937537.1|1954375_1955314_-	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	45.5	4.4e-64
>prophage 118
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1961950	1962583	2285232		Bacillus_virus(100.0%)	1	NA	NA
WP_002935897.1|1961950_1962583_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.6e-20
>prophage 119
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1973410	1973725	2285232		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002935923.1|1973410_1973725_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	40.6	2.5e-16
>prophage 120
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1979661	1981995	2285232		Lactobacillus_phage(100.0%)	1	NA	NA
WP_002935942.1|1979661_1981995_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	51.8	4.9e-24
>prophage 121
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1988519	1989644	2285232		Gordonia_phage(100.0%)	1	NA	NA
WP_002935956.1|1988519_1989644_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XB61	Gordonia_phage	42.3	4.5e-15
>prophage 122
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1992647	1996117	2285232		Brevibacillus_phage(50.0%)	2	NA	NA
WP_014636769.1|1992647_1995137_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	26.8	4.1e-53
WP_002935962.1|1995175_1996117_-	HAD-IC family P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.2	4.6e-37
>prophage 123
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	1999371	2000163	2285232		Bacillus_virus(100.0%)	1	NA	NA
WP_002935969.1|1999371_2000163_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.0	4.8e-32
>prophage 124
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	2014472	2016818	2285232		Tetraselmis_virus(100.0%)	1	NA	NA
WP_002935985.1|2014472_2016818_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	33.4	7.4e-121
>prophage 125
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	2025960	2027721	2285232		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002935993.1|2025960_2027721_-	glycerophosphoryl diester phosphodiesterase membrane domain-containing protein	NA	I6XE30	Staphylococcus_phage	25.8	2.8e-11
>prophage 126
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	2036035	2041283	2285232	transposase	Staphylococcus_phage(66.67%)	5	NA	NA
WP_002939148.1|2036035_2037211_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.4	2.9e-17
WP_002939149.1|2037451_2038144_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002939155.1|2038224_2038923_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	3.5e-18
WP_061286169.1|2038932_2040402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145888480.1|2040436_2041283_+|transposase	IS630-like element ISSsu3 family transposase	transposase	S5VXX4	Leptospira_phage	25.4	1.1e-08
>prophage 127
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	2050449	2051457	2285232	tRNA	Pandoravirus(100.0%)	1	NA	NA
WP_002938526.1|2050449_2051457_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A291ATS8	Pandoravirus	36.6	2.8e-40
>prophage 128
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	2061099	2070595	2285232		Streptococcus_phage(50.0%)	8	NA	NA
WP_002938504.1|2061099_2063091_-	M13 family metallopeptidase	NA	A0A1V0SHG2	Klosneuvirus	26.5	6.2e-60
WP_002938501.1|2064072_2066154_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.7	2.2e-63
WP_002940031.1|2066595_2067066_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_002940030.1|2067082_2067496_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_013730081.1|2067727_2069350_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.8	1.3e-153
WP_002936521.1|2069361_2069643_-	co-chaperone GroES	NA	NA	NA	NA	NA
WP_002936522.1|2069840_2070086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002936524.1|2070199_2070595_-	single-stranded DNA-binding protein	NA	A1EAD1	Streptococcus_phage	45.5	8.0e-28
>prophage 129
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	2084525	2091923	2285232		Phaeocystis_globosa_virus(50.0%)	2	NA	NA
WP_009909090.1|2084525_2088173_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.7	4.8e-66
WP_002936570.1|2088350_2091923_-	DNA-directed RNA polymerase subunit beta	NA	A0A2P0VMZ3	Tetraselmis_virus	26.7	5.7e-40
>prophage 130
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	2095056	2209030	2285232	portal,terminase,tail,protease,head,transposase,holin,tRNA,capsid,integrase	Streptococcus_phage(82.86%)	113	2114676:2114735	2211675:2213177
WP_002936579.1|2095056_2096313_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.1	3.3e-75
WP_002936580.1|2096370_2096748_+	HIT family protein	NA	NA	NA	NA	NA
WP_002936581.1|2097040_2097250_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_002936585.1|2097246_2097693_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_002936590.1|2097792_2099304_-	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_002936593.1|2099313_2100126_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_002936595.1|2100118_2100823_-	metal ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	2.8e-07
WP_013730073.1|2100823_2101267_-	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_002936600.1|2102012_2102795_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_004194117.1|2109574_2110117_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_004194119.1|2110193_2110859_-	ComF family protein	NA	NA	NA	NA	NA
WP_004194121.1|2110851_2112144_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	99.1	6.3e-247
WP_004194123.1|2112200_2112833_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	97.6	1.3e-109
WP_161802282.1|2113185_2114478_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	92.8	7.3e-211
2114676:2114735	attL	CAATGTCATTAAGTTAAGCATTTAAGCAGCTAAAGAAACTATTCTCGTCTGAGCAGTTCA	NA	NA	NA	NA
WP_002937360.1|2114806_2116096_-|transposase	IS4-like element ISSsu2 family transposase	transposase	NA	NA	NA	NA
WP_004194142.1|2116203_2118198_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1V0SDC3	Indivirus	32.5	3.2e-24
WP_004194145.1|2118197_2118935_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_074390766.1|2118972_2120286_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_004194149.1|2120272_2121211_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.3	6.8e-09
WP_004194151.1|2121342_2123733_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_004194153.1|2124076_2124391_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_004194155.1|2124414_2125041_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	33.3	8.8e-21
WP_004194157.1|2125188_2126802_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_004194159.1|2126929_2127412_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_004194161.1|2127629_2129084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004194163.1|2129093_2130260_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_004194167.1|2130816_2131152_-	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_004194171.1|2131220_2131760_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_004194173.1|2131825_2132443_+	Holliday junction resolvase RecU	NA	NA	NA	NA	NA
WP_074390762.1|2132411_2134598_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_004194177.1|2134651_2135365_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_004194179.1|2135554_2135758_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	75.4	7.5e-22
WP_004194181.1|2135917_2136751_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_004194183.1|2136768_2138421_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	6.2e-21
WP_170241756.1|2138527_2138851_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_004194187.1|2139107_2140091_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_004194188.1|2140301_2141222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004194190.1|2141329_2141875_-	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004194192.1|2141895_2142744_-	S-adenosyl-l-methionine hydroxide adenosyltransferase family protein	NA	NA	NA	NA	NA
WP_004194195.1|2143175_2143892_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004194196.1|2144052_2144364_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_004194198.1|2144374_2145001_+	DUF2812 domain-containing protein	NA	NA	NA	NA	NA
WP_004194200.1|2145072_2147241_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_004194203.1|2147274_2148066_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_004194205.1|2148264_2148972_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_004194208.1|2149198_2151463_-	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	44.8	3.2e-12
WP_004194210.1|2151455_2152964_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_053866426.1|2153145_2155245_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.1	1.6e-119
WP_004194216.1|2155659_2156070_-	peptide deformylase	NA	A0A2I7QLT9	Vibrio_phage	34.2	2.1e-10
WP_004194219.1|2156089_2157469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161802282.1|2157650_2158943_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	92.8	7.3e-211
WP_014636745.1|2159222_2160512_+|transposase	IS4-like element ISSsu2 family transposase	transposase	NA	NA	NA	NA
WP_004194221.1|2160652_2162176_-	Heme/copper-type cytochrome/quinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_013730059.1|2162344_2163586_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_162096930.1|2163772_2165065_+|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	99.8	8.8e-225
WP_014636660.1|2165271_2166009_-	PlySs2 family phage lysin	NA	A0A1X9I6R1	Streptococcus_phage	100.0	4.2e-139
WP_002937841.1|2165992_2166343_-|holin	phage holin	holin	A0A1X9I630	Streptococcus_phage	100.0	2.1e-56
WP_014636661.1|2166345_2166645_-	hypothetical protein	NA	A0A1S5SA32	Streptococcus_phage	100.0	7.6e-47
WP_002936845.1|2166648_2166993_-	hypothetical protein	NA	M1PS15	Streptococcus_phage	100.0	1.5e-62
WP_002936847.1|2166995_2167205_-	hypothetical protein	NA	M1Q1C6	Streptococcus_phage	100.0	8.0e-27
WP_002936851.1|2172146_2172497_-	hypothetical protein	NA	A0A1X9I607	Streptococcus_phage	100.0	1.3e-61
WP_002936852.1|2172506_2175644_-	hypothetical protein	NA	A0A1X9I5Z7	Streptococcus_phage	100.0	0.0e+00
WP_024394260.1|2175668_2176028_-	hypothetical protein	NA	A0A1X9I602	Streptococcus_phage	100.0	2.2e-61
WP_002936853.1|2176054_2176429_-	hypothetical protein	NA	A0A1X9I734	Streptococcus_phage	100.0	4.1e-66
WP_002936854.1|2176439_2176856_-|tail	tail protein	tail	A0A1X9I6R2	Streptococcus_phage	100.0	9.5e-72
WP_002936856.1|2176859_2177228_-	hypothetical protein	NA	A0A1X9I641	Streptococcus_phage	100.0	1.3e-64
WP_002936858.1|2177224_2177737_-	HK97 gp10 family phage protein	NA	A0A1X9I618	Streptococcus_phage	100.0	2.5e-90
WP_002936870.1|2178004_2178334_-|head,tail	phage head-tail connector protein	head,tail	A0A1X9I6G0	Streptococcus_phage	100.0	3.3e-51
WP_002936873.1|2178343_2178532_-	hypothetical protein	NA	A0A1X9I614	Streptococcus_phage	100.0	3.2e-27
WP_002936880.1|2178542_2179559_-	hypothetical protein	NA	A0A1X9I629	Streptococcus_phage	99.7	8.0e-189
WP_002936882.1|2179576_2180098_-	DUF4355 domain-containing protein	NA	A0A1X9I605	Streptococcus_phage	100.0	1.7e-73
WP_002936883.1|2180261_2180552_-	hypothetical protein	NA	A0A1X9I606	Streptococcus_phage	100.0	3.4e-52
WP_002936884.1|2180563_2180800_-	hypothetical protein	NA	A0A1X9I5F6	Streptococcus_phage	100.0	1.1e-35
WP_024390557.1|2181013_2181217_-	hypothetical protein	NA	A0A1X9I649	Streptococcus_phage	100.0	2.2e-34
WP_002936887.1|2181182_2182652_-|capsid	minor capsid protein	capsid	A0A1X9I626	Streptococcus_phage	100.0	3.4e-281
WP_024390877.1|2182602_2184051_-|portal	phage portal protein	portal	A0A1X9I654	Streptococcus_phage	98.8	1.5e-265
WP_002936901.1|2184063_2185485_-|terminase	phage terminase large subunit	terminase	A0A1X9I6G4	Streptococcus_phage	100.0	1.4e-279
WP_002936906.1|2186234_2186657_-	ArpU family transcriptional regulator	NA	A0A1X9I632	Streptococcus_phage	100.0	7.9e-74
WP_002936911.1|2186732_2187002_-	hypothetical protein	NA	A0A1X9I627	Streptococcus_phage	100.0	4.0e-47
WP_002936917.1|2187002_2187206_-	hypothetical protein	NA	A0A1X9I612	Streptococcus_phage	100.0	1.2e-30
WP_002936919.1|2187202_2187412_-	hypothetical protein	NA	A0A1X9I737	Streptococcus_phage	100.0	8.8e-34
WP_002936925.1|2187789_2188002_-	hypothetical protein	NA	A0A1X9I653	Streptococcus_phage	100.0	2.8e-35
WP_002936928.1|2188001_2188577_-	DUF1642 domain-containing protein	NA	A0A1X9I640	Streptococcus_phage	100.0	3.3e-107
WP_024394268.1|2188587_2189019_-	restriction endonuclease subunit S	NA	A0A1X9I666	Streptococcus_phage	100.0	5.2e-73
WP_002936936.1|2189012_2190272_-	N-6 DNA methylase	NA	A0A1X9I6H1	Streptococcus_phage	99.8	2.4e-235
WP_002936938.1|2190268_2190571_-	DUF1372 family protein	NA	A0A1X9I624	Streptococcus_phage	100.0	9.7e-50
WP_002936941.1|2190567_2190798_-	DUF3310 domain-containing protein	NA	A0A1X9I635	Streptococcus_phage	100.0	6.9e-40
WP_002936944.1|2190794_2191115_-	VRR-NUC domain-containing protein	NA	A0A1X9I642	Streptococcus_phage	100.0	2.4e-54
WP_161802265.1|2191366_2192830_-	DNA primase	NA	A0A1X9I634	Streptococcus_phage	99.8	1.5e-289
WP_002936949.1|2192894_2193701_-	bifunctional DNA primase/polymerase	NA	A0A1X9I739	Streptococcus_phage	98.1	5.8e-150
WP_002936952.1|2193705_2194176_-	DUF669 domain-containing protein	NA	A0A1X9I6S0	Streptococcus_phage	100.0	2.3e-82
WP_002936961.1|2194178_2195591_-	DEAD/DEAH box helicase	NA	A0A1X9I664	Streptococcus_phage	99.8	4.6e-275
WP_002936965.1|2195559_2196249_-	AAA family ATPase	NA	A0A1X9I651	Streptococcus_phage	99.1	9.8e-130
WP_002936969.1|2196245_2196722_-	siphovirus Gp157 family protein	NA	A0A1P8VVS5	Streptococcus_phage	44.4	1.1e-28
WP_002936972.1|2196723_2196912_-	hypothetical protein	NA	A0A1X9I6H6	Streptococcus_phage	100.0	2.6e-29
WP_044752281.1|2196908_2197253_-	hypothetical protein	NA	A0A1X9I636	Streptococcus_phage	100.0	9.1e-44
WP_153601467.1|2197385_2197535_-	hypothetical protein	NA	A0A1X9I650	Streptococcus_phage	100.0	2.0e-19
WP_002936978.1|2197524_2197773_-	hypothetical protein	NA	A0A1X9I648	Streptococcus_phage	96.3	3.8e-36
WP_002936992.1|2197813_2198068_-	hypothetical protein	NA	A0A1X9I5T3	Streptococcus_phage	100.0	7.4e-43
WP_002936994.1|2198134_2198332_-	helix-turn-helix transcriptional regulator	NA	A0A1S5S8U1	Streptococcus_phage	59.0	2.1e-13
WP_002936996.1|2198556_2198805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002937001.1|2198981_2199182_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I583	Streptococcus_phage	100.0	9.6e-30
WP_002937004.1|2199366_2199747_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I5A1	Streptococcus_phage	100.0	3.9e-64
WP_002937006.1|2199753_2200158_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1X9I5R2	Streptococcus_phage	93.7	2.1e-63
WP_002937008.1|2200154_2201051_+	Abi family protein	NA	NA	NA	NA	NA
WP_061286175.1|2201335_2202493_+|integrase	site-specific integrase	integrase	A0A1X9I5L3	Streptococcus_phage	99.2	5.5e-218
WP_004194670.1|2202701_2202854_-	hypothetical protein	NA	M1Q1N6	Streptococcus_phage	100.0	3.6e-21
WP_053866469.1|2203026_2203782_+	helix-turn-helix domain-containing protein	NA	A0A1X9I660	Streptococcus_phage	75.6	3.5e-96
WP_053866468.1|2203981_2204743_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	43.6	5.0e-42
WP_061286175.1|2204916_2206074_+|integrase	site-specific integrase	integrase	A0A1X9I5L3	Streptococcus_phage	99.2	5.5e-218
WP_002937015.1|2206303_2207230_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	100.0	9.9e-170
WP_002937017.1|2207256_2207628_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002937018.1|2207629_2209030_-	Cof-type HAD-IIB family hydrolase	NA	A0A1V0S9I2	Catovirus	43.5	2.3e-24
2211675:2213177	attR	CAATGTCATTAAGTTAAGCATTTAAGCAGCTAAAGAAACTATTCTCGTCTGAGCAGTTCATGACAAAACGGGAATAGTTTTTGTATTTAGGGCGCACAAAAAGGAGGTTTTTTATCCCTATTTTTCAACTATTATGTTACTCTATAAGTGAAGCTTACAGGTGCCTTGCTTTTTATCTTTCTTTGGAACGTTCGATTGGGTCGGATGATGGATAAATGCTTGGCAATGTAGGTTTCTAATTGGAAGGAAGTGAGTTTGTTTCTAAGAAATTTTCGACAGGCATAAACAGCGTCTGAAAAACAAATTTTATAAGTCTGTTTTAACTTTGATGTTTTAATAGCAACGTGTGAGGTTAGCCATTTACAAACATTAAAATTGATAAAGCGAGCGTAGATTTCTTGGAGAATCCCTTCCTTCTTTTTTGCATGAAAATGAGTCAGACCGATACTGTATTTTAGGTCACGAAAACTGGTCTCTATGCCCCATCTGTAGGCATAGAGCTCTTTTAATTTTTCTGGAGAATAATCGGTGTTTGTCACCAAAGTTTCAAAGAAACCTGGCTTGATTTCGAGACGCACCATTCGAAAATGAAGTTCGTAAAACTGAAGTGGGTCGCTTTTTCGGCTAGAGTTTAGTAAAAAGTCAAAGGAAGCATTATGAGGTAAAAAATGATACTGATTAGGGAAGTCTCGATACAGTTCTTTCATGTCATTGGTTTGTTTGCGACAGATGTTTAGGTCAAATGCCTTATCAAAACAAGGGGTATCAGGGAGGTTAAATCCTGATTTCATAGAATGATTCCCGTCACGAATACGAATAATATAGGACCAATTTCTTTCTTGGCAGTGAGCCATGACATTGTAGGATTCATACCCCCTATCCATTATTACCAGAGCTTGTTTGAAAGAAGAGGTCTTCATCATGTCAATAAAAGCTGCACGTTCATCAACCTCTCGATTATCTTGGATCCGTAAATCATGATATATCTCTTGTTCAAGAGTGTAGAGAGCATTGATATGAATAAGATTGTAAGGAGTGTGATGTGGTCCAGTTTGAAAAGAGGTCGTTTTATCAAAACGATTTCTTGGTAGAATCACATCACTGCCATCAACAGCCAGGATAGGGAGATTATCAGAGATTGGAATTTTAGAAGTAATATCCCTAAAAAGTGTTTTAAAAGCTTGGTGTTTAATCTGATACCGTCGTTGAACAAAGGCAGATTGAGAGACAGGCAAATCTAAATCAAGTAGCTCTTTGGCTAAGGTATTACCACCCATGGTCAGTATGGCTTGAATCATGGTTTTCATAGTTAGCTGACTTTGCCGACTAAAATCTTTTTCAGGATGAAGCACAAACTGATTGGCACTAGAAACGATGTCGTTAATACTATCAAGTAAATGAGCTTTAATCTGATCTAGCATGACTTTTCCCCTTTTATTTTTAGTGTAACATAAAAACTAACCCACCACAAAACGTGATAGGTTAGTTAACTTAATGACATTG	NA	NA	NA	NA
>prophage 131
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	2213601	2219486	2285232	tRNA	Cafeteria_roenbergensis_virus(33.33%)	4	NA	NA
WP_002937034.1|2213601_2216142_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	22.1	6.5e-38
WP_002937036.1|2216156_2216597_-	arginine repressor	NA	NA	NA	NA	NA
WP_002937037.1|2216703_2218392_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	33.1	1.2e-77
WP_002937039.1|2218571_2219486_+	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	39.5	5.8e-05
>prophage 132
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	2226681	2227665	2285232		Enterobacteria_phage(100.0%)	1	NA	NA
WP_002936122.1|2226681_2227665_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.0	4.1e-12
>prophage 133
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	2231346	2233098	2285232	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_002936129.1|2231346_2233098_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SJ84	Klosneuvirus	26.1	2.9e-13
>prophage 134
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	2237262	2241861	2285232		Lactobacillus_phage(50.0%)	5	NA	NA
WP_002936146.1|2237262_2238780_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	33.3	1.4e-51
WP_002936148.1|2238912_2239362_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
WP_002938227.1|2239428_2240040_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_002938218.1|2240250_2240502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002938217.1|2240505_2241861_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	59.0	2.0e-142
>prophage 135
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	2251175	2278815	2285232	tRNA,transposase,integrase	Streptococcus_phage(63.64%)	32	2258480:2258500	2269655:2269675
WP_009911037.1|2251175_2251730_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A096XT26	Enterococcus_phage	48.8	1.0e-28
WP_002938197.1|2251861_2252656_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_061286179.1|2252648_2253491_-	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	1.1e-13
WP_002938187.1|2253466_2254303_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	32.9	1.3e-22
WP_013730677.1|2254299_2254839_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002939074.1|2254848_2255706_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002939071.1|2255787_2257071_-	insulinase family protein	NA	NA	NA	NA	NA
WP_009911054.1|2257067_2258321_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	99.0	4.2e-232
2258480:2258500	attL	GTGTACAAAAAGGGGAACAAA	NA	NA	NA	NA
WP_002939065.1|2258852_2259257_-	ArpU family transcriptional regulator	NA	A0A1X9I5Y7	Streptococcus_phage	97.0	8.4e-65
WP_158500238.1|2259290_2259548_-	hypothetical protein	NA	A0A1X9I699	Streptococcus_phage	71.2	2.2e-18
WP_002939060.1|2259961_2260504_-	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	57.1	6.0e-50
WP_002939058.1|2260524_2260698_-	sporulation protein Cse60	NA	A0A1X9I5U0	Streptococcus_phage	63.2	1.2e-12
WP_002939056.1|2261037_2262636_-	hypothetical protein	NA	A0A1P8BM51	Lactococcus_phage	53.4	1.3e-145
WP_024394241.1|2262632_2263103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053866481.1|2263270_2263555_-	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	85.1	6.1e-38
WP_002936163.1|2263544_2263883_-	hypothetical protein	NA	A0A1X9I5Z6	Streptococcus_phage	92.4	6.2e-45
WP_002936164.1|2263879_2264029_-	hypothetical protein	NA	A0A1X9I6A8	Streptococcus_phage	89.6	6.9e-17
WP_014638857.1|2264040_2264244_-	hypothetical protein	NA	A0A1X9I5T6	Streptococcus_phage	80.6	7.2e-25
WP_002936166.1|2264231_2264633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002936167.1|2265088_2265712_-	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	30.2	7.5e-12
WP_002936168.1|2265723_2265930_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SE31	Streptococcus_phage	59.6	4.3e-09
WP_002936170.1|2265947_2266148_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002936171.1|2266351_2266858_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I723	Streptococcus_phage	68.3	1.8e-16
WP_002936172.1|2267245_2268250_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	47.7	3.9e-79
WP_002936173.1|2268479_2269652_+|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	95.4	1.3e-211
WP_002936175.1|2269789_2270173_+	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	94.5	4.6e-36
2269655:2269675	attR	GTGTACAAAAAGGGGAACAAA	NA	NA	NA	NA
WP_002936177.1|2270175_2271270_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_161802282.1|2271710_2273003_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	92.8	7.3e-211
WP_014637236.1|2273162_2274644_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.9	3.6e-97
WP_013730696.1|2274875_2275901_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013730698.1|2276255_2277128_+	YitT family protein	NA	NA	NA	NA	NA
WP_004194522.1|2277192_2278815_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.0	2.0e-48
>prophage 136
NZ_CP012911	Streptococcus suis strain NSUI060 chromosome, complete genome	2285232	2283462	2284659	2285232		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_009911075.1|2283462_2284659_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.4	8.7e-17
>prophage 1
NZ_CP012912	Streptococcus suis strain NSUI060 plasmid pNSUI060a, complete sequence	11393	2114	8485	11393	integrase	Streptococcus_phage(87.5%)	9	4849:4860	6331:6342
WP_002936168.1|2114_2321_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SE31	Streptococcus_phage	59.6	4.3e-09
WP_002936170.1|2338_2539_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002936171.1|2743_3250_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I723	Streptococcus_phage	68.3	1.8e-16
WP_002936172.1|3637_4642_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	47.7	3.9e-79
4849:4860	attL	CTTGCCTGCTGA	NA	NA	NA	NA
WP_002936173.1|4871_6044_+|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	95.4	1.3e-211
WP_002939065.1|6639_7044_-	ArpU family transcriptional regulator	NA	A0A1X9I5Y7	Streptococcus_phage	97.0	8.4e-65
6331:6342	attR	TCAGCAGGCAAG	NA	NA	NA	NA
WP_158500238.1|7077_7335_-	hypothetical protein	NA	A0A1X9I699	Streptococcus_phage	71.2	2.2e-18
WP_002939060.1|7748_8291_-	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	57.1	6.0e-50
WP_002939058.1|8311_8485_-	sporulation protein Cse60	NA	A0A1X9I5U0	Streptococcus_phage	63.2	1.2e-12
