The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014536	Salmonella enterica subsp. enterica serovar Typhimurium strain SO3 isolate SOHS 02-68 chromosome, complete genome	4912959	364952	408402	4912959	coat,terminase,portal,integrase,protease,lysis	Salmonella_phage(47.62%)	64	355722:355738	416993:417009
355722:355738	attL	GATATTGAAATTCGCGT	NA	NA	NA	NA
WP_001043675.1|364952_366005_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
WP_001285275.1|366287_367391_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_061360658.1|367402_368653_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	9.5e-99
WP_000051900.1|368858_370022_-|integrase	site-specific integrase	integrase	A0A075B8E2	Enterobacteria_phage	99.7	2.4e-229
WP_000016640.1|370251_370887_-	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	99.5	1.3e-120
WP_001277764.1|370987_371167_-	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	100.0	1.9e-29
WP_000208022.1|371263_372217_-	DUF550 domain-containing protein	NA	A0A075B8H2	Enterobacteria_phage	100.0	1.9e-171
WP_024152293.1|372220_372409_-	hypothetical protein	NA	A0A075B8E3	Enterobacteria_phage	100.0	2.7e-26
WP_023170976.1|372411_373005_-	ead/Ea22-like family protein	NA	A0A2H4A316	Salmonella_phage	99.5	7.9e-104
WP_015975202.1|373001_373361_-	Eaf protein	NA	T1SA95	Salmonella_phage	100.0	4.0e-66
WP_015975203.1|373469_373967_-	hypothetical protein	NA	A0A0N6WGF1	Salmonella_phage	99.4	2.3e-88
WP_001214434.1|373954_374125_-	DUF2737 family protein	NA	A0A0N7CAQ8	Salmonella_phage	100.0	3.5e-25
WP_015975204.1|374135_374429_-	DUF2856 family protein	NA	A0A0N7CAQ6	Salmonella_phage	100.0	1.9e-50
WP_000031375.1|374759_375377_-	ERF family protein	NA	A0A0N7CFJ3	Salmonella_phage	100.0	3.3e-105
WP_001163402.1|375373_375517_-	hypothetical protein	NA	A0A075B8I9	Enterobacteria_phage	100.0	3.2e-19
WP_000158027.1|375506_375695_-	DUF5444 family protein	NA	A0A075B8F9	Enterobacteria_phage	100.0	1.4e-30
WP_000582314.1|375675_375834_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A075B8H4	Enterobacteria_phage	100.0	4.0e-23
WP_000776964.1|375919_376231_-	superinfection exclusion protein	NA	A0A075B8E5	Enterobacteria_phage	100.0	1.1e-48
WP_001737461.1|376378_376582_-	DUF551 domain-containing protein	NA	A0A0N7CAQ5	Salmonella_phage	100.0	1.7e-34
WP_000651935.1|376581_376818_-	hypothetical protein	NA	A0A075B8J0	Enterobacteria_phage	100.0	4.3e-37
WP_000213983.1|376854_377049_-	hypothetical protein	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
WP_001682202.1|377263_377842_+	superinfection exclusion protein B	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_000216175.1|377862_378165_-	hypothetical protein	NA	B8K1E6	Salmonella_phage	98.0	1.1e-48
WP_001095984.1|378518_379169_-	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_000276884.1|379249_379435_+	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_000424167.1|379541_379820_+	transcriptional regulator	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_001125981.1|379854_380001_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000067075.1|379993_380809_+	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001248406.1|380805_382182_+	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000736921.1|382255_382693_+	recombination protein NinB	NA	A8CGE3	Salmonella_phage	100.0	1.3e-79
WP_000679702.1|382689_382863_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113772.1|382829_383006_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_001531428.1|383008_383341_+	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000950959.1|383333_383510_+	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001129733.1|383502_384114_+	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_000036317.1|384110_384335_+	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
WP_000149925.1|384331_384535_+	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
WP_000219131.1|384515_384695_+	hypothetical protein	NA	A0A1U8QR34	Salmonella_phage	100.0	1.4e-24
WP_001235453.1|384691_385315_+	antitermination protein	NA	A0A075B8H9	Enterobacteria_phage	100.0	2.3e-114
WP_000286100.1|385753_385957_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_000074137.1|385934_386432_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	97.0	6.0e-89
WP_001531485.1|386520_386958_+|lysis	lysis protein	lysis	O80289	Bacteriophage	99.3	9.1e-73
WP_001177703.1|387170_387857_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	99.6	4.7e-124
WP_000807785.1|388159_388402_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_001278047.1|388403_388583_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	91.5	3.0e-22
WP_000729925.1|388606_389095_+	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_000417849.1|389072_390572_+|terminase	terminase	terminase	A0A192Y824	Salmonella_phage	99.8	1.4e-306
WP_000774656.1|390571_392749_+|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.9	0.0e+00
WP_000433852.1|392762_393674_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_001196938.1|393673_394966_+|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	100.0	3.2e-243
WP_000684729.1|395004_395214_+	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_001166098.1|395197_395698_+	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_001122424.1|395657_397076_+	Packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_000774927.1|397079_397781_+	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
WP_000627697.1|397780_398236_+	DUF2824 family protein	NA	A0A192Y6V9	Salmonella_phage	100.0	5.2e-87
WP_000964902.1|398238_398931_+	hypothetical protein	NA	G5DA80	Enterobacteria_phage	98.7	1.2e-108
WP_061364105.1|398940_400236_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	84.2	3.5e-181
WP_001029838.1|400235_402233_+	hypothetical protein	NA	Q716G2	Shigella_phage	94.9	0.0e+00
WP_000749288.1|402323_402809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000287064.1|403211_403466_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	63.3	4.4e-19
WP_000129930.1|403601_405605_+	endorhamnosidase	NA	A0A2H4FWI0	Salmonella_phage	99.9	0.0e+00
WP_000671495.1|405663_407121_-	hypothetical protein	NA	A0A192Y7W8	Salmonella_phage	100.0	4.5e-241
WP_000703640.1|407110_408043_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|408039_408402_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
416993:417009	attR	GATATTGAAATTCGCGT	NA	NA	NA	NA
>prophage 2
NZ_CP014536	Salmonella enterica subsp. enterica serovar Typhimurium strain SO3 isolate SOHS 02-68 chromosome, complete genome	4912959	1015551	1022565	4912959	transposase,protease	Dickeya_phage(16.67%)	6	NA	NA
WP_001201749.1|1015551_1016670_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|1016666_1018613_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|1018742_1018964_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1019287_1019608_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1019638_1021915_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1022106_1022565_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 3
NZ_CP014536	Salmonella enterica subsp. enterica serovar Typhimurium strain SO3 isolate SOHS 02-68 chromosome, complete genome	4912959	1072807	1171615	4912959	tail,terminase,portal,integrase,protease,tRNA,holin,lysis	Salmonella_phage(42.86%)	99	1075716:1075735	1147503:1147522
WP_001154025.1|1072807_1073611_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1073603_1074926_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1074906_1075611_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572725.1|1075610_1080077_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1075716:1075735	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925871.1|1080421_1082263_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1082522_1083071_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1083098_1083746_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_023261971.1|1083807_1084998_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1085182_1086274_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1086880_1088281_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1088481_1088943_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1089259_1090474_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000191399.1|1092232_1093435_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1093629_1094922_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1094966_1095215_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1095255_1095495_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1095537_1096695_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017133.1|1096657_1099543_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|1099669_1099969_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1099990_1100149_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_014343821.1|1100141_1100402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1100451_1100862_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_061360675.1|1100981_1101221_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	48.6	2.2e-12
WP_001574095.1|1101186_1101561_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_061360676.1|1101645_1102629_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.7	9.6e-163
WP_000800010.1|1102631_1103381_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1103391_1103739_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_061360677.1|1103735_1104047_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	95.8	3.6e-31
WP_014343823.1|1104124_1104415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1104706_1104940_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1105051_1105273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1105355_1105958_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001096552.1|1106166_1106778_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1106774_1106921_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1106910_1107708_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001534733.1|1108264_1108390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1108525_1108975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1109335_1110022_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1110297_1110627_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_014343824.1|1110610_1111063_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	96.6	5.1e-79
WP_001541990.1|1111080_1111560_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1111767_1112301_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1112257_1114396_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1114392_1114599_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009207.1|1114595_1116143_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_010989008.1|1116066_1118148_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1118238_1118562_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1118554_1118854_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1118834_1119401_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1119397_1119799_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1119810_1120560_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1120605_1121004_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1121000_1121330_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|1121409_1124397_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|1124393_1124726_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1124824_1125322_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1125438_1125972_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1126061_1126757_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1126766_1127504_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1127401_1128106_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000033416.1|1128177_1131528_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.5	0.0e+00
WP_000178849.1|1131566_1131809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144679.1|1131862_1134301_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000143167.1|1134300_1134882_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001533476.1|1135357_1136326_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000334547.1|1136973_1137600_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1137668_1137968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1137952_1138639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1138909_1139101_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1139527_1142140_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1142347_1143358_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1143523_1144066_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1144062_1145172_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086486.1|1145270_1147379_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1147391_1149299_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1147503:1147522	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1149313_1150567_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1150571_1152212_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1152208_1152772_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1153027_1153195_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1153294_1153813_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156453.1|1153881_1155642_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1155827_1156280_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1156351_1157404_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1157760_1158270_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1158486_1159092_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1159078_1161232_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1161250_1161697_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1161820_1163875_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1163910_1164369_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1164463_1165126_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1165299_1165713_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1165757_1166075_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1166132_1167344_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1167558_1168107_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1168132_1168912_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1168960_1169242_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1169238_1169568_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1169654_1170314_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1170934_1171615_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP014536	Salmonella enterica subsp. enterica serovar Typhimurium strain SO3 isolate SOHS 02-68 chromosome, complete genome	4912959	2029231	2108575	4912959	head,tail,plate,portal,terminase,capsid,integrase,protease,transposase,lysis,holin	Salmonella_phage(85.07%)	103	2035769:2035784	2110198:2110213
WP_000502119.1|2029231_2029690_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659251.1|2029870_2031076_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079805.1|2031154_2032642_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000146802.1|2032898_2034302_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2034316_2034724_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2034723_2035092_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|2035163_2036648_+	alpha-amylase	NA	NA	NA	NA	NA
2035769:2035784	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2036687_2037113_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2037298_2038504_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2038500_2038734_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2038998_2039385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2039504_2039819_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2040035_2041718_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2041710_2042706_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2042698_2043406_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2043405_2044776_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2044797_2045241_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2045237_2046455_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2046559_2047027_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2047031_2048036_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2048032_2048446_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2048445_2048823_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2048822_2049560_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2049569_2049839_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2049847_2050642_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2050923_2051547_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2051585_2051834_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2051908_2052136_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2052445_2053261_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119819.1|2053239_2054952_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2055116_2055362_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2055378_2056290_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2056465_2057386_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2057374_2057845_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2057825_2059256_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2059329_2060025_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2060116_2060416_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2061065_2062262_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2062522_2062711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2062721_2062934_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2063388_2064657_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2064659_2065079_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2065205_2065367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|2065997_2066219_-	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000492926.1|2066431_2067439_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_015701331.1|2067723_2068323_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_000554737.1|2068292_2069855_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	100.0	2.6e-287
WP_001207832.1|2069841_2070429_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_014343855.1|2070431_2070953_-|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	100.0	2.9e-94
WP_014343856.1|2070987_2071533_-	phage protein	NA	Q8HAB7	Salmonella_phage	100.0	9.2e-99
WP_000605050.1|2071504_2071918_-	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001273649.1|2071922_2072456_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066636.1|2072455_2073514_-	hypothetical protein	NA	Q8HAC0	Salmonella_phage	100.0	1.3e-202
WP_000863818.1|2073510_2074851_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_000785385.1|2074884_2076813_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000588852.1|2076897_2077224_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2077220_2077577_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007991.1|2077576_2079073_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000497739.1|2079062_2079227_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779218.1|2079230_2079791_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_001135697.1|2079787_2080300_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000702408.1|2080271_2080676_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_000927378.1|2080672_2080996_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601353.1|2080998_2081199_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000257528.1|2081249_2082455_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_001193639.1|2082469_2083120_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000466254.1|2083097_2084339_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_000605609.1|2084338_2084521_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088182.1|2084532_2086266_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000929191.1|2086262_2086757_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135225.1|2086882_2087233_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_001292890.1|2087293_2087596_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_000877027.1|2087815_2088235_-	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001050825.1|2088447_2088933_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_001005901.1|2088929_2089544_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001527046.1|2089546_2089891_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_014343859.1|2090052_2090487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001527054.1|2090416_2090674_-	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_000188927.1|2090806_2091430_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_001202277.1|2091440_2092430_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	4.9e-191
WP_001061457.1|2092437_2093298_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
WP_001241579.1|2093314_2093704_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2093700_2094594_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2094593_2095076_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2095077_2095896_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2095892_2096117_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2096113_2097271_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2097267_2097822_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2097850_2098075_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2098172_2098868_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_000997190.1|2099682_2100054_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080415.1|2100111_2100939_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000008351.1|2101075_2101615_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000764235.1|2101685_2101916_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000071070.1|2101912_2102428_+	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000065095.1|2102424_2103042_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000208068.1|2103038_2103872_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_001061334.1|2103875_2104445_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2104469_2104712_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2104713_2105703_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2105994_2106792_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2107163_2107454_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2108101_2108575_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2110198:2110213	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 5
NZ_CP014536	Salmonella enterica subsp. enterica serovar Typhimurium strain SO3 isolate SOHS 02-68 chromosome, complete genome	4912959	2194569	2205075	4912959		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2194569_2195883_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2195909_2196989_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2196993_2197767_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2197763_2198756_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2198761_2199313_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2199313_2200192_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2200239_2201139_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2201138_2202224_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2202600_2203494_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2203671_2205075_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 6
NZ_CP014536	Salmonella enterica subsp. enterica serovar Typhimurium strain SO3 isolate SOHS 02-68 chromosome, complete genome	4912959	2273383	2282554	4912959	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2273383_2275417_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2275657_2276116_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2276287_2276818_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2276874_2277342_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2277388_2278108_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2278104_2279790_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2280012_2280744_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2280803_2280911_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2280891_2281623_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2281606_2282554_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 7
NZ_CP014536	Salmonella enterica subsp. enterica serovar Typhimurium strain SO3 isolate SOHS 02-68 chromosome, complete genome	4912959	2301967	2368371	4912959	lysis,holin,tail	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|2301967_2302663_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2302816_2303701_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2303877_2304597_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2304593_2304839_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2305043_2306285_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|2306278_2307514_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2307588_2308599_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2308614_2310135_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2310268_2311267_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2311765_2312788_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2312937_2314080_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2314094_2314763_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2315092_2315950_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2315938_2316328_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2316332_2317700_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2317916_2318804_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2318836_2320159_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2320202_2322194_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2322538_2324008_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2324197_2325061_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2325181_2326231_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2326309_2327167_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2327231_2328920_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2328936_2329875_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2329874_2331005_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2331373_2332555_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2332619_2333285_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2333286_2333409_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2333796_2334051_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2334374_2334947_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2335159_2336146_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2336175_2336895_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2337308_2337881_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2338206_2339763_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2339869_2341675_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2341684_2342779_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2342778_2343804_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2343805_2345395_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2345398_2345743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2346133_2347324_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2347351_2348047_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2348198_2349959_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2350083_2350368_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2350476_2351097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2351124_2352132_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2352311_2352539_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2352570_2354331_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2354611_2355115_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2355142_2355433_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2355789_2357619_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2357672_2358116_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2358493_2359021_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2359023_2360265_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2360857_2361187_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_061360699.1|2361483_2362815_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.9	1.2e-19
WP_010989045.1|2362843_2363212_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2363226_2364216_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2364544_2366911_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2367079_2367283_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2367579_2368371_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 8
NZ_CP014536	Salmonella enterica subsp. enterica serovar Typhimurium strain SO3 isolate SOHS 02-68 chromosome, complete genome	4912959	2707362	2808825	4912959	head,tail,terminase,portal,capsid,integrase,protease,transposase,tRNA,lysis,holin	Salmonella_phage(35.59%)	106	2733506:2733521	2803914:2803929
WP_000940032.1|2707362_2708094_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2708212_2709016_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2709160_2710039_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2710220_2711264_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2711267_2712086_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2712096_2713110_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2713110_2714097_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2714087_2714726_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2714851_2716129_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2716123_2717263_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2717458_2718712_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883142.1|2719036_2720227_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187149.1|2720408_2721953_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|2722313_2723645_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2723727_2725872_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2725927_2727388_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2727436_2727775_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2727851_2729189_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2729185_2729950_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2729951_2731382_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
WP_000970045.1|2732031_2735919_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
2733506:2733521	attL	AACGCGGAAATCACCA	NA	NA	NA	NA
WP_001747289.1|2735940_2736174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2736174_2737719_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2737769_2738321_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2738345_2738981_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361664.1|2738984_2740346_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2740356_2741250_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2741365_2742214_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2742252_2743170_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276370.1|2743191_2744388_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2744503_2745430_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2745467_2745728_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2745839_2746220_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2746219_2746951_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2746962_2747691_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2747702_2748608_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2748604_2749285_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2749558_2750533_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2750549_2752349_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2752753_2754247_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2754731_2754869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2755581_2755746_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|2756325_2756391_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|2756453_2756666_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2756772_2757000_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2757096_2757675_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2757664_2758489_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|2758485_2760858_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|2760911_2761154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246126.1|2764609_2765257_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2765154_2765892_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2765898_2766597_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2766606_2766936_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372065.1|2766938_2770034_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_010989052.1|2770005_2770344_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2770340_2770736_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2770786_2771533_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2771540_2771942_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2772050_2773181_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2773229_2773808_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2773835_2774219_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2774229_2774589_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2774646_2775675_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2775729_2776077_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2776089_2777586_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2777575_2779156_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2779152_2779356_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2779339_2781271_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2781242_2781788_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2782074_2782476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|2782711_2783164_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984581.1|2783181_2783634_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001574216.1|2783617_2783947_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|2784222_2784909_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|2785123_2785312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2785818_2786382_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|2786654_2787332_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2787328_2787469_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|2787465_2788077_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000929791.1|2788285_2788888_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_014343878.1|2788922_2789171_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2789287_2789521_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000877757.1|2789763_2790396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000664368.1|2790503_2791202_-	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000801766.1|2791215_2791911_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000024044.1|2791907_2792792_-	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_010835408.1|2792883_2793258_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000643689.1|2793217_2793460_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_000660736.1|2793559_2793955_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_001111772.1|2794013_2794853_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000356948.1|2794845_2795232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000950426.1|2795231_2795894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917562.1|2796350_2796509_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|2796530_2796881_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000017125.1|2797007_2799935_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_077248255.1|2799897_2801055_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_001237031.1|2801097_2801337_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2801377_2801662_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|2801639_2802869_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|2803366_2803846_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2803842_2804799_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
2803914:2803929	attR	TGGTGATTTCCGCGTT	NA	NA	NA	NA
WP_001168374.1|2804798_2805449_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2805480_2806056_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2806052_2806217_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989177.1|2806480_2808103_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2808087_2808825_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP014536	Salmonella enterica subsp. enterica serovar Typhimurium strain SO3 isolate SOHS 02-68 chromosome, complete genome	4912959	2813465	2938265	4912959	head,tail,plate,terminase,portal,capsid,integrase,transposase,tRNA,lysis	Salmonella_phage(75.0%)	109	2806968:2806983	2936413:2936428
2806968:2806983	attL	TTGATTTAATTATCTC	NA	NA	NA	NA
WP_000997368.1|2813465_2814503_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098732.1|2814706_2815126_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000183639.1|2815198_2815879_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082639.1|2815932_2818593_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949286.1|2818707_2820063_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264473.1|2820107_2820431_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807809.1|2820427_2821729_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	6.9e-44
WP_000985653.1|2821832_2822288_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_001235094.1|2828167_2830741_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_000992639.1|2830870_2831602_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|2831598_2832579_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|2832710_2833448_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|2833719_2834058_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|2834161_2834209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200080.1|2834308_2835469_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210995.1|2835429_2836338_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225189.1|2836395_2837517_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|2837526_2838597_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|2839036_2839555_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|2839547_2840768_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|2840924_2841272_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|2841312_2842080_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2842124_2842673_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2842691_2842940_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460050.1|2843253_2844615_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2844780_2845572_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_145857061.1|2845591_2846878_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_001518875.1|2847639_2848230_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2848352_2849231_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2849316_2850978_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2851126_2851465_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2851630_2851921_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2851910_2852387_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2852535_2853018_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_061364110.1|2853631_2865106_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533858.1|2865170_2866580_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196159.1|2866576_2868757_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_010989057.1|2868764_2869928_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000980500.1|2870479_2870698_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_001102269.1|2870766_2871867_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980411.1|2871863_2872349_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
WP_001677191.1|2872345_2875153_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	100.0	0.0e+00
WP_000763316.1|2875145_2875265_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001280963.1|2875279_2875582_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
WP_001207651.1|2875636_2876152_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_000046108.1|2876161_2877334_-|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	100.0	8.9e-224
WP_000974843.1|2877436_2877661_-	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000143187.1|2878530_2879106_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_001274649.1|2879105_2880959_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	100.0	0.0e+00
WP_001086804.1|2880955_2881561_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_000268332.1|2881553_2882462_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_000189373.1|2882448_2882808_-|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_001672413.1|2882804_2883383_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000958562.1|2883460_2884312_+	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_000343949.1|2884313_2884760_-	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_001039958.1|2884752_2885184_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000196199.1|2885279_2885708_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_061360710.1|2885704_2886220_-	lysozyme	NA	E5G6N1	Salmonella_phage	99.4	2.6e-95
WP_000171565.1|2886200_2886416_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868184.1|2886419_2886623_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000673537.1|2886622_2887087_-|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	100.0	9.9e-86
WP_000059173.1|2887180_2887831_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000730759.1|2887834_2888896_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	100.0	2.1e-195
WP_000216276.1|2888912_2889746_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_001098395.1|2889888_2891655_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_001542203.1|2891654_2892695_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001284991.1|2892798_2894463_-	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_001673609.1|2894776_2895454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|2895567_2895801_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154433.1|2895811_2896000_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_000017507.1|2896152_2898567_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	100.0	0.0e+00
WP_000104187.1|2898563_2899421_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	100.0	6.8e-165
WP_000752613.1|2899417_2899645_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244219.1|2899644_2899878_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
WP_000963474.1|2899945_2900287_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	100.0	1.2e-56
WP_000956190.1|2900250_2900451_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_000460848.1|2900458_2900968_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
WP_000102105.1|2901001_2901244_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000932273.1|2901365_2901998_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000218402.1|2902000_2903017_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	100.0	5.0e-199
WP_000360326.1|2903569_2904232_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	100.0	3.4e-124
WP_001542208.1|2904562_2905627_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.5	1.6e-118
WP_001542209.1|2905640_2905808_+	hypothetical protein	NA	A0A1B5FPC6	Escherichia_phage	61.9	1.1e-07
WP_010989063.1|2905854_2906448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248794.1|2906837_2908031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161781.1|2908365_2909193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000701821.1|2909643_2909859_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001520307.1|2909894_2911964_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
WP_001520831.1|2912466_2913750_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010989064.1|2913794_2914613_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_010989065.1|2914765_2915122_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000749979.1|2915216_2915501_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
WP_000480483.1|2915613_2916135_+	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000973738.1|2916131_2916506_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_001098984.1|2916502_2917483_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_001033832.1|2917493_2918507_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000889012.1|2918801_2920004_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000776032.1|2920077_2920713_-	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_001682344.1|2920736_2921300_-	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_000811366.1|2921299_2922142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000819716.1|2922271_2923813_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000021514.1|2924035_2925715_+	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000088556.1|2926831_2927707_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_014343881.1|2927872_2929747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989066.1|2930006_2931290_-	membrane protein	NA	NA	NA	NA	NA
WP_077948569.1|2931867_2932464_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	90.8	1.0e-98
WP_000061088.1|2934207_2934846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000073810.1|2934842_2936825_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
2936413:2936428	attR	GAGATAATTAAATCAA	NA	NA	NA	NA
WP_085983317.1|2937103_2938265_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	5.2e-51
>prophage 10
NZ_CP014536	Salmonella enterica subsp. enterica serovar Typhimurium strain SO3 isolate SOHS 02-68 chromosome, complete genome	4912959	4264065	4357325	4912959	head,tail,terminase,portal,plate,capsid,integrase,protease,tRNA,holin,lysis	Salmonella_phage(54.55%)	105	4296973:4297019	4327422:4327468
WP_000560974.1|4264065_4264503_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001518251.1|4264547_4265489_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001259011.1|4265503_4265950_-	type II toxin-antitoxin system HigA family antitoxin	NA	NA	NA	NA	NA
WP_000558166.1|4265946_4266258_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_001127703.1|4266343_4267273_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001159630.1|4267490_4267802_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	NA	NA	NA	NA
WP_000362050.1|4267802_4268093_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000027730.1|4268139_4269069_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829025.1|4269065_4269701_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331361.1|4269697_4270600_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_010989087.1|4270612_4273663_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	2.7e-06
WP_001059744.1|4273857_4274694_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000710966.1|4274961_4275993_-	YiiG family protein	NA	NA	NA	NA	NA
WP_000828052.1|4276175_4277276_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_000527676.1|4277630_4277954_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_000683586.1|4277953_4278613_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010989088.1|4278695_4279262_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000619478.1|4279350_4279665_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000009249.1|4279661_4280810_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_001179685.1|4280936_4281764_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211463.1|4281906_4283166_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000143970.1|4283162_4284632_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217112.1|4284919_4285756_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000013290.1|4285908_4286757_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063541.1|4286753_4287788_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000378721.1|4288406_4289090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000566800.1|4289247_4290555_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_001091413.1|4290547_4291063_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000812819.1|4291081_4292065_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000122635.1|4292393_4293014_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	1.4e-63
WP_014343930.1|4293020_4293773_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000133444.1|4293784_4294180_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000580402.1|4294230_4295604_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_001033731.1|4295600_4296299_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_061364116.1|4296449_4296950_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4296973:4297019	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_001526255.1|4297134_4298115_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	97.9	2.4e-182
WP_001017512.1|4298184_4298478_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	100.0	4.0e-48
WP_000453532.1|4298613_4298886_+	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	100.0	5.3e-47
WP_000217670.1|4299055_4299556_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|4299619_4299844_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001526254.1|4299843_4300146_+	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	99.0	5.9e-47
WP_001113264.1|4300145_4300370_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027667.1|4300366_4300642_+	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_001526225.1|4300631_4302911_+	replication endonuclease	NA	Q858T4	Yersinia_virus	96.7	0.0e+00
WP_061360742.1|4303149_4305633_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_000517958.1|4306012_4307059_-|portal	phage portal protein	portal	S4TNX7	Salmonella_phage	99.4	4.4e-190
WP_061360743.1|4307058_4308828_-|terminase	terminase ATPase subunit family protein	terminase	S4TT96	Salmonella_phage	99.3	0.0e+00
WP_001609322.1|4308993_4309848_+|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	94.4	1.8e-149
WP_001609323.1|4309924_4310992_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.4	2.6e-198
WP_024143114.1|4310995_4311745_+|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	97.2	9.9e-128
WP_000214255.1|4311838_4312345_+|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	100.0	1.3e-91
WP_000868400.1|4312344_4312548_+|tail	tail protein X	tail	A0A0M3ULF4	Salmonella_phage	100.0	3.6e-32
WP_000134659.1|4312551_4312848_+|holin	holin	holin	S4TP56	Salmonella_phage	100.0	4.4e-47
WP_001144116.1|4312834_4313332_+	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	99.4	1.2e-92
WP_000866102.1|4313328_4313742_+|lysis	LysB family phage lysis regulatory protein	lysis	S4TRW3	Salmonella_phage	100.0	2.6e-45
WP_001394645.1|4313713_4313887_+	hypothetical protein	NA	S4TNY4	Salmonella_phage	98.2	2.8e-25
WP_061360744.1|4313849_4314317_+|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	99.4	7.2e-84
WP_050178735.1|4314309_4314759_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	94.6	1.6e-69
WP_061360745.1|4314827_4315469_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	96.2	2.5e-111
WP_061360746.1|4315465_4315813_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	98.3	9.4e-57
WP_050178738.1|4315819_4316728_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	99.3	2.8e-161
WP_050178739.1|4316720_4317251_+|tail	phage tail protein I	tail	S4TTA8	Salmonella_phage	99.4	3.5e-103
WP_061360747.1|4317261_4319373_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	86.5	4.2e-216
WP_077948573.1|4319342_4319963_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	88.2	4.2e-100
WP_001279029.1|4320131_4321319_+|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	99.5	2.9e-222
WP_001207675.1|4321334_4321853_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_001029726.1|4321915_4322251_+|tail	phage tail assembly protein	tail	S4TTB2	Salmonella_phage	100.0	1.4e-52
WP_085984508.1|4322247_4322403_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_061360749.1|4322395_4324840_+|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	99.6	0.0e+00
WP_001526252.1|4324854_4325340_+|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	99.4	6.7e-85
WP_001526245.1|4325336_4326506_+	phage late control D family protein	NA	S4TRX8	Salmonella_phage	96.9	2.3e-208
WP_000468311.1|4326583_4326802_+	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	100.0	4.7e-38
WP_061360750.1|4326852_4327260_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	98.5	5.1e-70
WP_001077318.1|4327546_4328449_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4327422:4327468	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591793.1|4328633_4329596_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758711.1|4329799_4330789_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000750761.1|4330889_4331645_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000777317.1|4331907_4333242_+	MFS transporter	NA	NA	NA	NA	NA
WP_000646499.1|4333252_4334212_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000557889.1|4334221_4335262_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_001519915.1|4335324_4336047_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000061008.1|4336144_4336309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621104.1|4336324_4336456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001173080.1|4336545_4336896_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000113085.1|4336909_4338502_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001283048.1|4338589_4339549_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001167250.1|4339804_4341340_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_000911134.1|4341333_4342377_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_000981826.1|4342373_4343375_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000090737.1|4343403_4344426_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774147.1|4344454_4345330_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_001738619.1|4345412_4345703_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001088049.1|4345712_4346477_+	epimerase	NA	NA	NA	NA	NA
WP_001216339.1|4346568_4347336_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802242.1|4347448_4348045_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155237.1|4348145_4348574_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000796300.1|4348680_4349427_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250625.1|4349523_4350534_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136809.1|4350645_4352154_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084285.1|4352174_4353020_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000051370.1|4353418_4353658_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872918.1|4353879_4354365_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139639.1|4354457_4355387_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293360.1|4355453_4356785_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000208240.1|4356794_4357325_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 11
NZ_CP014536	Salmonella enterica subsp. enterica serovar Typhimurium strain SO3 isolate SOHS 02-68 chromosome, complete genome	4912959	4476700	4494594	4912959	tail,plate	Burkholderia_phage(47.37%)	22	NA	NA
WP_061360751.1|4476700_4478446_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	5.5e-52
WP_000359500.1|4478448_4479081_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4479073_4480189_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4480179_4480539_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4480702_4482250_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4482249_4483179_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4483175_4483538_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4483865_4484588_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4484597_4485641_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4485628_4485838_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4485837_4486791_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_061360752.1|4486790_4489145_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_001185654.1|4489241_4489370_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4489329_4489647_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4489698_4490223_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4490222_4491650_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4491639_4491837_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4491833_4492289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4492448_4492763_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4492775_4493381_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4493383_4493671_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4494246_4494594_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP014537	Salmonella enterica subsp. enterica serovar Typhimurium strain SO3 isolate SOHS 02-68 plasmid pSO3_STV, complete sequence	93844	40862	50158	93844	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_001541564.1|40862_41279_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|41462_41798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001541562.1|41854_42421_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728917.1|42452_43394_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_000427676.1|43808_45014_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000064274.1|45013_45988_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.1e-84
WP_000457541.1|46069_47344_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_000925627.1|47343_47766_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000490265.1|48276_48747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|48739_49096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088645.1|49477_50158_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
