The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010997	Bacillus pumilus strain SH-B11, complete genome	3860091	23727	30428	3860091	transposase,tRNA	uncultured_Mediterranean_phage(16.67%)	6	NA	NA
WP_008342028.1|23727_25002_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.1	1.7e-95
WP_008342025.1|25103_25931_+	chemotaxis sensory transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.4	7.1e-10
WP_061417609.1|26039_27395_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	50.3	1.2e-126
WP_024719578.1|27767_28427_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	33.2	1.1e-21
WP_017366700.1|28423_29047_-	AAA family ATPase	NA	A0A1G5SAJ8	Enterococcus_phage	28.8	2.0e-12
WP_035391604.1|29126_30428_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2P1CIG4	Microbacterium_phage	34.8	1.4e-07
>prophage 2
NZ_CP010997	Bacillus pumilus strain SH-B11, complete genome	3860091	670631	680527	3860091		Synechococcus_phage(50.0%)	9	NA	NA
WP_061418190.1|670631_671927_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	26.9	6.5e-18
WP_008355756.1|671999_672722_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	43.7	2.4e-46
WP_061418193.1|672714_672969_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FKD5	Synechococcus_phage	33.3	1.2e-05
WP_008344292.1|672965_673649_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_008344291.1|673632_675864_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.0	2.9e-159
WP_039168587.1|675839_677270_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	1.0e-51
WP_061418196.1|677366_678407_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	43.5	2.6e-65
WP_008344288.1|678403_678973_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.5	2.9e-31
WP_008344287.1|678988_680527_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.8	4.8e-76
>prophage 3
NZ_CP010997	Bacillus pumilus strain SH-B11, complete genome	3860091	1188080	1228633	3860091	transposase,coat,tRNA	Planktothrix_phage(12.5%)	46	NA	NA
WP_008348488.1|1188080_1189076_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_007499024.1|1189830_1191468_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_007499022.1|1191584_1192529_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017360167.1|1192532_1193450_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_089374143.1|1193453_1194542_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	4.8e-14
WP_007499016.1|1194543_1195461_+	ATP-binding cassette domain-containing protein	NA	M1IB70	Acanthocystis_turfacea_Chlorella_virus	26.1	2.1e-07
WP_058337480.1|1195566_1195854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041507459.1|1195990_1196569_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003211421.1|1196762_1197158_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_007499010.1|1197198_1197864_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	37.5	1.9e-29
WP_008348474.1|1198128_1198794_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_008348473.1|1198879_1200400_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_045034755.1|1200561_1201722_+	competence protein	NA	NA	NA	NA	NA
WP_155720708.1|1201759_1203763_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	25.7	1.1e-59
WP_008348466.1|1204049_1204223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007499002.1|1204520_1205432_-	DsbA family protein	NA	NA	NA	NA	NA
WP_007499001.1|1205428_1205827_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
WP_008348461.1|1206104_1206869_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	68.1	1.1e-36
WP_061418688.1|1206894_1207470_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_061418691.1|1207687_1208053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061418694.1|1208086_1208716_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_008355343.1|1208781_1209582_+	NAD kinase	NA	NA	NA	NA	NA
WP_081105409.1|1209590_1210493_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_017359667.1|1210533_1211277_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	S4TT53	Salmonella_phage	23.6	3.9e-07
WP_041507457.1|1211437_1213285_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017367022.1|1213526_1214237_+	thiaminase II	NA	NA	NA	NA	NA
WP_041507456.1|1214211_1214829_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_045034682.1|1214812_1215925_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_017367025.1|1215921_1216125_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_007498979.1|1216129_1216897_+	thiazole synthase	NA	NA	NA	NA	NA
WP_061418697.1|1216893_1217907_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_047945548.1|1217924_1218731_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003211867.1|1218880_1219657_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_061418700.1|1219770_1220346_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_008348434.1|1220383_1220827_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_008348432.1|1221039_1221531_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_008348431.1|1221678_1222164_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_035392394.1|1222252_1222588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041092031.1|1222632_1223019_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_045035236.1|1223196_1223547_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_008348420.1|1223831_1224053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008348419.1|1224137_1224275_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_008348417.1|1224411_1224669_+	sporulation protein	NA	NA	NA	NA	NA
WP_061418703.1|1224685_1226995_-	ATP-dependent helicase	NA	G3MA40	Bacillus_virus	34.3	6.3e-80
WP_008348414.1|1227121_1227379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100325805.1|1227482_1228633_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	60.4	3.0e-38
>prophage 4
NZ_CP010997	Bacillus pumilus strain SH-B11, complete genome	3860091	1359384	1434865	3860091	tail,holin,terminase,portal,transposase,head,integrase,capsid,protease	Bacillus_phage(22.5%)	81	1396699:1396734	1432382:1432417
WP_061418800.1|1359384_1361490_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	41.7	1.8e-129
WP_058337417.1|1361735_1362779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008348090.1|1363054_1363711_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	59.4	3.3e-66
WP_039169139.1|1363711_1364152_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_024719652.1|1364144_1364876_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	48.4	3.3e-59
WP_003211403.1|1364891_1365389_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	74.8	1.1e-55
WP_061418803.1|1365647_1365866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003211747.1|1365990_1366179_-	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_056704847.1|1366346_1366541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045035134.1|1366847_1367501_+	peptidoglycan-binding protein LysM	NA	A0A141HRV8	Bacillus_phage	53.2	2.8e-25
WP_041507392.1|1367614_1368931_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_045035136.1|1368985_1369474_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_061418806.1|1369768_1371688_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.2	3.5e-108
WP_061418809.1|1371792_1372887_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_045035139.1|1373179_1374169_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_017359435.1|1374224_1375079_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_024719659.1|1375281_1377381_+	PTS glucose transporter subunit IICBA	NA	A0A2I7SAJ6	Vibrio_phage	43.7	2.6e-08
WP_045035140.1|1377474_1377741_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_008348058.1|1377740_1379459_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_008361179.1|1379572_1379800_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_007498710.1|1379880_1380909_+	spore photoproduct lyase	NA	NA	NA	NA	NA
WP_061418812.1|1381024_1382986_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.8	8.4e-09
WP_045035141.1|1383062_1383848_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_061418815.1|1383861_1384734_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007498701.1|1384849_1385647_-	hypothetical protein	NA	A0A0E3T7R5	Bacillus_phage	63.8	3.2e-39
WP_045035143.1|1385983_1388110_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_061418818.1|1388266_1390093_+	PAS domain-containing sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.8	9.2e-10
WP_061418821.1|1390119_1391292_-	aminotransferase A	NA	NA	NA	NA	NA
WP_056704830.1|1391586_1392471_+	cation transporter	NA	NA	NA	NA	NA
WP_155720694.1|1392534_1392690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039169112.1|1392987_1393527_+	RDD family protein	NA	NA	NA	NA	NA
WP_045035147.1|1393613_1394963_+	MFS transporter	NA	NA	NA	NA	NA
WP_024719666.1|1395036_1395945_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	35.6	7.0e-51
WP_008356877.1|1396183_1396645_-	hypothetical protein	NA	NA	NA	NA	NA
1396699:1396734	attL	TTATTAGTAAATTGCAAATAGACTTATTGTAAAAAG	NA	NA	NA	NA
WP_047947392.1|1396810_1397968_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	28.0	6.2e-28
WP_081105412.1|1398012_1398495_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2I7SC21	Paenibacillus_phage	57.0	5.4e-42
WP_061418827.1|1398501_1398861_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CZS1	Paenibacillus_phage	55.6	8.7e-13
WP_061418830.1|1398977_1399217_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CZL1	Paenibacillus_phage	72.1	2.2e-20
WP_061418833.1|1399297_1399570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061418836.1|1399718_1400369_+	DNA-binding protein	NA	A0A288WFT2	Bacillus_phage	39.1	1.8e-32
WP_061418839.1|1400338_1400776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061418842.1|1400917_1401433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061418846.1|1401567_1402329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061418849.1|1402493_1402895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047947400.1|1402905_1403676_+	hypothetical protein	NA	A0A2P1JTY8	Anoxybacillus_phage	40.7	2.2e-45
WP_061418852.1|1403668_1404028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061418855.1|1404024_1405353_+	replicative DNA helicase	NA	W8EEZ1	Geobacillus_phage	54.4	4.5e-131
WP_061418862.1|1405652_1405856_+	hypothetical protein	NA	A0A1L2JY31	Aeribacillus_phage	36.4	6.4e-05
WP_061418865.1|1405952_1406144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061418868.1|1406160_1406595_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	46.3	1.0e-31
WP_061418871.1|1406675_1407266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061418874.1|1407416_1407761_+	hypothetical protein	NA	Q38579	Bacillus_phage	57.9	1.3e-26
WP_061418881.1|1408070_1408451_+	hypothetical protein	NA	H9A108	Staphylococcus_phage	38.9	1.2e-07
WP_061418884.1|1408494_1409190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061418885.1|1409404_1409893_+|terminase	phage terminase small subunit P27 family	terminase	D2JLE3	Staphylococcus_phage	32.9	5.3e-13
WP_061418888.1|1409879_1411607_+|terminase	terminase large subunit	terminase	A0A1Q1PVU8	Staphylococcus_phage	46.4	4.0e-140
WP_061418892.1|1411621_1411822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061418895.1|1411828_1413064_+|portal	phage portal protein	portal	A0A1W6JPW5	Staphylococcus_phage	37.1	4.4e-64
WP_061418898.1|1413041_1413632_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0MFL1	Staphylococcus_phage	50.3	3.7e-45
WP_061418900.1|1413686_1414868_+|capsid	phage major capsid protein	capsid	D2KRA9	Lactobacillus_phage	41.2	8.4e-73
WP_034324998.1|1414880_1415183_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_061418903.1|1415164_1415497_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_061418906.1|1415496_1415880_+	HK97 gp10 family phage protein	NA	A0A0M5M1E5	Enterococcus_phage	38.9	3.9e-11
WP_061418909.1|1415876_1416275_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_061418912.1|1416289_1416898_+	hypothetical protein	NA	A0A2H4J5N7	uncultured_Caudovirales_phage	32.5	2.0e-09
WP_061418915.1|1416972_1417296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061418918.1|1417531_1421194_+	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	40.6	1.9e-123
WP_061418921.1|1421190_1422018_+|tail	phage tail family protein	tail	A0A0B5CTY7	Listeria_phage	28.1	1.6e-14
WP_061418924.1|1422028_1423930_+	hypothetical protein	NA	D6R400	Bacillus_phage	28.6	2.8e-49
WP_061418927.1|1423971_1425876_+	hypothetical protein	NA	D7NW65	Streptomyces_phage	37.9	7.7e-84
WP_155720695.1|1425872_1426172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061418933.1|1426152_1427580_+	DUF2479 domain-containing protein	NA	M4ZRP1	Bacillus_phage	46.0	1.6e-46
WP_061418936.1|1427593_1427875_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	44.2	1.3e-16
WP_081105413.1|1427871_1428012_+	XkdX family protein	NA	NA	NA	NA	NA
WP_034324986.1|1428045_1428258_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	56.1	8.7e-13
WP_061418939.1|1428278_1428542_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	73.6	6.3e-29
WP_061418942.1|1428602_1429403_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	55.8	6.8e-66
WP_061418945.1|1429711_1430434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061418948.1|1430758_1431892_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	53.6	7.0e-109
WP_008348016.1|1432805_1433021_-	hypothetical protein	NA	NA	NA	NA	NA
1432382:1432417	attR	TTATTAGTAAATTGCAAATAGACTTATTGTAAAAAG	NA	NA	NA	NA
WP_045035328.1|1433512_1434865_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	42.4	1.9e-89
>prophage 5
NZ_CP010997	Bacillus pumilus strain SH-B11, complete genome	3860091	1768893	1775142	3860091		Bacillus_phage(66.67%)	6	NA	NA
WP_017359034.1|1768893_1769286_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	56.5	8.8e-27
WP_017359033.1|1769245_1771348_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	82.8	0.0e+00
WP_024720404.1|1771365_1772346_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	80.9	1.4e-150
WP_056704775.1|1772430_1773048_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	44.8	5.1e-45
WP_007499430.1|1773103_1773862_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N6W8I1	Bacillus_phage	53.8	8.7e-47
WP_008344008.1|1774182_1775142_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	39.6	3.9e-52
>prophage 6
NZ_CP010997	Bacillus pumilus strain SH-B11, complete genome	3860091	2121368	2129076	3860091		Ostreococcus_lucimarinus_virus(16.67%)	10	NA	NA
WP_056704669.1|2121368_2122460_-	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	27.6	1.8e-21
WP_039165734.1|2122459_2123632_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	35.2	3.4e-42
WP_008344547.1|2123708_2124485_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_061419498.1|2124629_2125076_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	41.6	4.5e-27
WP_061419500.1|2125205_2126168_-	heptaprenyl diphosphate synthase component II	NA	A0A1V0SE37	Indivirus	26.0	1.7e-07
WP_061419502.1|2126192_2126897_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_007500958.1|2126900_2127668_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_008344541.1|2127783_2128014_-	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_003215789.1|2128037_2128607_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	57.3	1.8e-49
WP_003215863.1|2128797_2129076_-	non-specific DNA-binding protein Hbs	NA	A7KV42	Bacillus_phage	74.2	5.6e-28
>prophage 7
NZ_CP010997	Bacillus pumilus strain SH-B11, complete genome	3860091	2166931	2173375	3860091		Staphylococcus_phage(50.0%)	10	NA	NA
WP_061419513.1|2166931_2168083_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	37.7	1.9e-24
WP_061419515.1|2168193_2168673_-	DUF3907 family protein	NA	NA	NA	NA	NA
WP_061419517.1|2168786_2169380_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	34.5	5.3e-15
WP_007501021.1|2169369_2170128_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	36.8	6.5e-10
WP_008359694.1|2170338_2170431_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_039165804.1|2170519_2171044_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_017359785.1|2171068_2171422_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_061420889.1|2171535_2172000_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	65.3	2.3e-42
WP_081105430.1|2172026_2172650_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	58.1	4.5e-57
WP_155720699.1|2172661_2173375_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	40.3	1.5e-40
>prophage 8
NZ_CP010997	Bacillus pumilus strain SH-B11, complete genome	3860091	2365351	2452518	3860091	tail,holin,plate,terminase,portal,capsid,bacteriocin,tRNA	Bacillus_phage(27.27%)	107	NA	NA
WP_017367626.1|2365351_2366710_-|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
WP_035390848.1|2366709_2367480_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_017358022.1|2367503_2368439_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_017367628.1|2368461_2369595_-	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	31.4	3.0e-27
WP_041506930.1|2369760_2371599_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.3	1.6e-139
WP_041506929.1|2371623_2372181_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_008342473.1|2372245_2373277_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_035390855.1|2373358_2374498_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_008342476.1|2374612_2376451_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.1	5.2e-21
WP_017358024.1|2376617_2376950_-	DUF3679 domain-containing protein	NA	NA	NA	NA	NA
WP_007501337.1|2376963_2378172_-	stage II sporulation protein P	NA	NA	NA	NA	NA
WP_008342483.1|2378238_2379354_-	GPR endopeptidase	NA	NA	NA	NA	NA
WP_008342485.1|2379552_2379819_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_061419611.1|2379952_2380972_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_008342491.1|2381210_2381345_+	YqzM family protein	NA	NA	NA	NA	NA
WP_061419613.1|2381384_2383712_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	31.5	6.4e-32
WP_008342495.1|2383704_2384274_-	ComE operon protein 2	NA	A0A127AWN5	Bacillus_phage	50.4	1.7e-31
WP_061419615.1|2384339_2384966_-	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_061419616.1|2385056_2385905_+	late competence protein ComER	NA	NA	NA	NA	NA
WP_061419618.1|2385952_2386696_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_061419620.1|2386692_2387049_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_041506923.1|2387061_2387625_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_024718805.1|2387614_2388184_-	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	29.4	3.7e-18
WP_008342507.1|2388197_2388488_-	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_061419622.1|2388481_2389324_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_041506921.1|2389345_2390446_-	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
WP_041507128.1|2390448_2390970_-	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
WP_003217327.1|2391332_2391473_+	sporulation histidine kinase inhibitor Sda	NA	NA	NA	NA	NA
WP_041506920.1|2391836_2392580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041506919.1|2392637_2393378_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_060781208.1|2393544_2394666_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	46.5	1.6e-84
WP_081105475.1|2394897_2395287_+	sigma-70 family RNA polymerase sigma factor	NA	U5PUF5	Bacillus_phage	37.0	3.9e-11
WP_061419624.1|2395283_2396786_-	DNA recombinase	NA	A6M972	Geobacillus_virus	28.0	1.1e-29
WP_061419626.1|2397131_2397722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061419628.1|2398229_2398916_-	hypothetical protein	NA	D2XR29	Bacillus_phage	33.8	1.5e-26
WP_061419630.1|2399049_2399889_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_061419632.1|2399969_2400158_+	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	77.4	2.0e-21
WP_061419634.1|2400238_2400871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061419636.1|2400893_2401637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061419639.1|2401886_2402408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155720701.1|2402644_2402824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061419641.1|2402930_2403743_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	75.2	1.3e-64
WP_061419642.1|2403804_2404068_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	77.0	3.3e-30
WP_034620157.1|2404080_2404293_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	56.5	1.0e-13
WP_081105476.1|2404354_2404495_-	XkdX family protein	NA	A0A2H4JD72	uncultured_Caudovirales_phage	56.8	3.6e-07
WP_061419647.1|2404494_2404869_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	43.0	6.0e-09
WP_061419649.1|2404873_2406001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061419651.1|2406018_2406402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061419653.1|2406414_2407338_-	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	29.7	1.4e-11
WP_061419655.1|2407324_2408371_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	41.5	4.7e-67
WP_061419657.1|2408363_2408792_-	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	32.5	1.9e-11
WP_061419659.1|2408791_2409073_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	40.4	3.5e-09
WP_061419662.1|2409069_2410137_-	hypothetical protein	NA	H7BV96	unidentified_phage	29.4	4.0e-37
WP_047946071.1|2410148_2410811_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2SUI2	Clostridium_phage	32.1	1.5e-26
WP_061419664.1|2410803_2415771_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	42.0	1.3e-42
WP_155720711.1|2415774_2415921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061419666.1|2415950_2416400_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.3e-10
WP_155720712.1|2416478_2416643_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_025092909.1|2417166_2417610_-|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	45.8	1.3e-26
WP_061419668.1|2417611_2418958_-|tail	phage tail sheath protein	tail	A0A0A7S087	Clostridium_phage	41.6	9.3e-84
WP_003213528.1|2418960_2419185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061419671.1|2419171_2419627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061419672.1|2419631_2420138_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	50.0	5.6e-42
WP_061419674.1|2420134_2420491_-	DUF3599 family protein	NA	NA	NA	NA	NA
WP_061419676.1|2420487_2420880_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_061419678.1|2420885_2421287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061419680.1|2421292_2422222_-|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	66.1	1.6e-106
WP_061419682.1|2422245_2423409_-|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	52.5	2.8e-84
WP_061419684.1|2423410_2424328_-	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	39.7	1.9e-48
WP_061419686.1|2424324_2425845_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	50.2	6.7e-139
WP_041507124.1|2425844_2427143_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	63.8	2.7e-157
WP_061419689.1|2427151_2428036_-|terminase	terminase	terminase	D2IZ90	Enterococcus_phage	36.9	2.1e-28
WP_061419691.1|2428083_2428332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409353.1|2428471_2429749_-	DNA modification methylase	NA	A0A1B0RXE5	Streptococcus_phage	40.1	9.1e-81
WP_061409355.1|2429803_2430148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008362098.1|2430239_2430422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056702476.1|2432009_2432354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061419693.1|2432468_2432852_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	52.4	2.3e-24
WP_081105434.1|2432961_2434077_+	hypothetical protein	NA	A0A0U2S621	Escherichia_phage	26.3	2.1e-33
WP_061420897.1|2434024_2434603_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	40.4	6.4e-34
WP_061420899.1|2435002_2435287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061419701.1|2435419_2436106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061419703.1|2436093_2436543_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	69.7	8.5e-50
WP_061419705.1|2436539_2436734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061419707.1|2436748_2438041_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	44.0	6.6e-95
WP_061420901.1|2438012_2438300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061419709.1|2438305_2439166_-	hypothetical protein	NA	S6BFM4	Thermus_phage	52.7	3.8e-14
WP_081105436.1|2439379_2440180_-	hypothetical protein	NA	A0A0A7RUC1	Clostridium_phage	46.3	4.2e-60
WP_061419713.1|2440139_2441060_-	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	62.2	4.7e-87
WP_061419716.1|2441167_2441389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025092874.1|2441421_2441613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155267116.1|2441802_2441973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061419720.1|2441973_2442243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034667563.1|2442245_2442497_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025092871.1|2442730_2442967_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025092870.1|2443138_2443474_+	helix-turn-helix transcriptional regulator	NA	O03970	Lactobacillus_phage	36.4	5.8e-11
WP_081105437.1|2443558_2444038_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	38.5	1.1e-23
WP_061419727.1|2444151_2444820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061419729.1|2444821_2445796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061419731.1|2445800_2446949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061419733.1|2447499_2447781_-	DUF3986 family protein	NA	NA	NA	NA	NA
WP_061419735.1|2447811_2448222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045034076.1|2448242_2448671_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_061419737.1|2449228_2450641_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_061419739.1|2450795_2451350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061419740.1|2451303_2451858_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017358050.1|2452191_2452518_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
>prophage 9
NZ_CP010997	Bacillus pumilus strain SH-B11, complete genome	3860091	2867044	2917473	3860091	tail,holin,plate,transposase,portal,terminase,capsid	Bacillus_phage(26.92%)	55	NA	NA
WP_155720692.1|2867044_2868234_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.1	9.8e-29
WP_007500615.1|2876293_2876869_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_008344038.1|2876961_2877150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058213680.1|2877109_2877664_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_061420000.1|2877812_2878472_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_061420002.1|2878486_2879641_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_081105477.1|2879652_2880780_+	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_008344044.1|2880811_2882359_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	28.4	9.5e-08
WP_017367919.1|2882370_2882901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081105445.1|2883076_2883586_+	DinB family protein	NA	NA	NA	NA	NA
WP_061420009.1|2883626_2884835_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_024719672.1|2884862_2886332_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_045035275.1|2886538_2887096_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061420011.1|2887300_2887747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061420013.1|2887849_2888668_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	68.1	2.3e-61
WP_019743388.1|2888687_2888951_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	69.0	7.7e-27
WP_008344062.1|2888963_2889176_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	56.5	1.0e-13
WP_061420015.1|2889378_2889717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061420017.1|2889731_2890820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061420913.1|2891152_2891293_-	XkdX family protein	NA	NA	NA	NA	NA
WP_061420019.1|2891292_2891613_-	hypothetical protein	NA	O64053	Bacillus_phage	46.2	8.5e-20
WP_061420915.1|2891625_2893011_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	30.4	2.8e-27
WP_061420021.1|2893067_2894231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061420023.1|2894202_2894412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061420026.1|2894408_2894738_-|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	36.2	1.1e-09
WP_061420028.1|2894748_2895627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061420030.1|2895642_2896026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061420032.1|2896037_2896961_-	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	28.5	9.4e-11
WP_061420034.1|2896947_2897994_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.5	1.9e-68
WP_061420036.1|2897986_2898409_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_017358996.1|2898423_2898690_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	37.5	4.7e-08
WP_017367933.1|2898686_2899697_-	hypothetical protein	NA	H7BV96	unidentified_phage	28.4	1.0e-34
WP_061420038.1|2899708_2900377_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2SUI2	Clostridium_phage	29.6	2.2e-22
WP_061420040.1|2900369_2904476_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	42.3	8.3e-43
WP_008344097.1|2904531_2904669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012011040.1|2904710_2905151_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	36.8	9.9e-11
WP_072368332.1|2905302_2905392_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003213309.1|2905667_2906111_-|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	46.5	7.6e-27
WP_024719687.1|2906112_2907459_-|portal	phage portal protein	portal	A0A0A7RTT5	Clostridium_phage	40.3	1.1e-76
WP_008344108.1|2907462_2907675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041091933.1|2907661_2908117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061420042.1|2908121_2908619_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	45.0	9.1e-37
WP_017367938.1|2908615_2908972_-	DUF3599 family protein	NA	NA	NA	NA	NA
WP_024719690.1|2908968_2909352_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_008344119.1|2909365_2910289_-|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	64.3	3.3e-109
WP_061420044.1|2910311_2911400_-|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	40.7	5.2e-61
WP_061420046.1|2911435_2912893_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	53.0	1.1e-138
WP_061420048.1|2912889_2914203_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	62.0	1.2e-152
WP_008344125.1|2914199_2914847_-|terminase	terminase	terminase	A0A2P1JTW4	Anoxybacillus_phage	43.7	2.5e-42
WP_061420050.1|2915000_2915519_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J6J3	uncultured_Caudovirales_phage	46.2	4.4e-34
WP_061420053.1|2915643_2915850_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	68.5	1.2e-14
WP_024719696.1|2915846_2916251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017358978.1|2916353_2916536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061420055.1|2916696_2916936_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007500560.1|2917095_2917473_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.4	1.6e-17
>prophage 10
NZ_CP010997	Bacillus pumilus strain SH-B11, complete genome	3860091	3218554	3227558	3860091		Streptococcus_phage(33.33%)	10	NA	NA
WP_155720703.1|3218554_3219535_+	bifunctional glyoxylate/hydroxypyruvate reductase B	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	26.9	4.9e-18
WP_061420270.1|3219715_3220204_+	ribonuclease	NA	NA	NA	NA	NA
WP_061420272.1|3220255_3220999_-	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_008348124.1|3221038_3221296_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_008348125.1|3221322_3222273_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.1	4.3e-51
WP_008348128.1|3222290_3223250_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	40.4	3.2e-62
WP_096881894.1|3223250_3224174_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	26.3	4.5e-05
WP_008348133.1|3224177_3224642_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_024719880.1|3224999_3225950_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.1	4.8e-87
WP_061420275.1|3226184_3227558_-	C40 family peptidase	NA	A0A0A0RVE6	Bacillus_phage	54.3	8.1e-27
>prophage 11
NZ_CP010997	Bacillus pumilus strain SH-B11, complete genome	3860091	3489163	3536900	3860091	transposase,protease,coat	Escherichia_phage(25.0%)	56	NA	NA
WP_061420518.1|3489163_3489826_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_008343530.1|3489933_3490119_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_024719439.1|3490170_3490983_-	peptidase M84	NA	NA	NA	NA	NA
WP_061420520.1|3491357_3492686_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_008343536.1|3492725_3493610_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_056704192.1|3493760_3494312_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_039165233.1|3494295_3495321_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017360083.1|3495320_3495575_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_008343543.1|3495609_3496173_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_008343545.1|3496186_3496948_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_061420523.1|3496965_3497811_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_081105463.1|3497827_3498538_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_061420526.1|3498534_3499278_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.1	1.2e-32
WP_045033903.1|3499382_3499883_-	YwgA family protein	NA	NA	NA	NA	NA
WP_056408375.1|3499913_3501215_-	HD domain-containing protein	NA	A0A1V0SGM3	Hokovirus	30.3	1.6e-24
WP_003215259.1|3501385_3501607_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_024719449.1|3501849_3502650_+	RsfA family transcriptional regulator	NA	A0A1D6X8E5	Bacillus_phage	48.0	6.0e-06
WP_008343557.1|3502685_3502919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061420529.1|3502915_3505192_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_061420532.1|3505295_3505781_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_058337049.1|3505816_3506662_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_024719452.1|3506898_3507294_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_061420535.1|3507326_3507602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061420538.1|3507667_3507940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024719455.1|3508054_3508390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061420541.1|3508404_3510111_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_019743227.1|3510195_3510522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061420544.1|3510534_3510930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008343583.1|3511246_3511525_-	YwqI/YxiC family protein	NA	NA	NA	NA	NA
WP_041507929.1|3511529_3511928_-	DUF5082 domain-containing protein	NA	NA	NA	NA	NA
WP_008343586.1|3512098_3512365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061420547.1|3512378_3513713_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_061420550.1|3513756_3514635_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_061420554.1|3514646_3515318_-	RraA family protein	NA	NA	NA	NA	NA
WP_061420556.1|3515459_3516311_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008343597.1|3516446_3517418_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_024719459.1|3517657_3518428_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_155720704.1|3518844_3519813_-	abhydrolase domain-containing 18	NA	NA	NA	NA	NA
WP_061420560.1|3519897_3520377_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_061420563.1|3520522_3521755_+	MFS transporter	NA	NA	NA	NA	NA
WP_061420566.1|3521904_3522510_+	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
WP_017368257.1|3522511_3523219_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_008343608.1|3523215_3523977_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.5	8.5e-26
WP_061420569.1|3523991_3525413_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_081105464.1|3525427_3526624_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_061420572.1|3526639_3527437_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_008343612.1|3527523_3527979_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_045033867.1|3527971_3528826_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.2	8.6e-35
WP_061420575.1|3528829_3529795_-	dTDP-glucose 4,6-dehydratase	NA	K7QJG5	Escherichia_phage	45.6	5.5e-78
WP_056408393.1|3529791_3530532_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	41.6	1.4e-44
WP_061420578.1|3530534_3531563_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_061420581.1|3531559_3532300_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_061420584.1|3532289_3533414_-|coat	spore coat protein	coat	A0A1B1IVE2	uncultured_Mediterranean_phage	29.9	4.5e-23
WP_061420586.1|3533415_3534291_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_061420588.1|3534287_3535466_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_061420592.1|3535487_3536900_-|coat	spore coat protein	coat	NA	NA	NA	NA
