The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011007	Bacillus pumilus strain SH-B9 chromosome, complete genome	3787586	22157	30876	3787586	tRNA	uncultured_Mediterranean_phage(16.67%)	8	NA	NA
WP_058015904.1|22157_23432_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.4	9.0e-97
WP_058015903.1|23534_24365_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.1	3.5e-09
WP_061406465.1|24676_25336_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	33.2	1.9e-21
WP_058015901.1|25332_25956_-	deoxynucleoside kinase	NA	S5MMC6	Bacillus_phage	28.4	7.0e-18
WP_061406468.1|26035_27337_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2P1CIG4	Microbacterium_phage	34.8	1.0e-07
WP_061406471.1|27382_27937_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_058015899.1|28016_28493_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_061406474.1|29163_30876_+	DNA polymerase III subunit gamma/tau	NA	D9ZNI9	Clostridium_phage	34.9	2.3e-55
>prophage 2
NZ_CP011007	Bacillus pumilus strain SH-B9 chromosome, complete genome	3787586	544393	556129	3787586	integrase	Streptococcus_phage(37.5%)	12	541192:541205	551324:551337
541192:541205	attL	ATGAAAATGGCACT	NA	NA	NA	NA
WP_061406842.1|544393_545773_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.8	9.9e-49
WP_061406844.1|545881_547729_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_061406846.1|548737_549859_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	29.1	3.4e-31
WP_167550621.1|549874_550369_-	ImmA/IrrE family metallo-endopeptidase	NA	Q0H245	Geobacillus_phage	35.9	7.0e-13
WP_019743978.1|550393_550774_-	helix-turn-helix transcriptional regulator	NA	W8CZ48	Bacillus_phage	41.3	2.1e-09
WP_019743979.1|551048_551237_+	hypothetical protein	NA	A0A0A8WI91	Clostridium_phage	50.0	1.2e-05
WP_080563256.1|551242_551485_+	hypothetical protein	NA	NA	NA	NA	NA
551324:551337	attR	ATGAAAATGGCACT	NA	NA	NA	NA
WP_061406850.1|551543_551825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061406852.1|552180_552564_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	44.2	1.3e-14
WP_061406854.1|552724_553285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151282359.1|553692_555060_+	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	47.6	4.8e-112
WP_061410209.1|555163_556129_+	DNA relaxase NicK	NA	A0A1S5SEX3	Streptococcus_phage	40.0	1.3e-58
>prophage 3
NZ_CP011007	Bacillus pumilus strain SH-B9 chromosome, complete genome	3787586	674819	684714	3787586		Synechococcus_phage(50.0%)	9	NA	NA
WP_058015533.1|674819_676115_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	26.6	5.0e-18
WP_061406993.1|676187_676910_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	43.2	2.7e-45
WP_003214349.1|676902_677157_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FKD5	Synechococcus_phage	33.3	1.2e-05
WP_012009142.1|677153_677837_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_058015530.1|677820_680052_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.5	1.6e-157
WP_058015529.1|680027_681458_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	1.3e-51
WP_061406996.1|681553_682594_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	44.3	1.1e-65
WP_058015527.1|682590_683160_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.0	3.8e-31
WP_058015526.1|683175_684714_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.8	4.8e-76
>prophage 4
NZ_CP011007	Bacillus pumilus strain SH-B9 chromosome, complete genome	3787586	1723031	1729291	3787586		Bacillus_phage(83.33%)	6	NA	NA
WP_008360380.1|1723031_1723424_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	S5MA49	Bacillus_phage	54.2	6.1e-28
WP_058013918.1|1723383_1725486_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	83.1	0.0e+00
WP_061407887.1|1725503_1726484_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	80.8	8.4e-151
WP_061407890.1|1726568_1727186_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	44.3	2.5e-44
WP_061407893.1|1727252_1728011_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N6W8I1	Bacillus_phage	54.4	1.8e-47
WP_058013914.1|1728331_1729291_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	39.6	6.7e-52
>prophage 5
NZ_CP011007	Bacillus pumilus strain SH-B9 chromosome, complete genome	3787586	2111729	2118113	3787586		Staphylococcus_phage(50.0%)	10	NA	NA
WP_061408405.1|2111729_2112881_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	37.7	7.1e-24
WP_058014781.1|2112993_2113473_-	DUF3907 family protein	NA	NA	NA	NA	NA
WP_034661126.1|2113586_2114180_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.0	1.2e-14
WP_061408408.1|2114169_2114928_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	39.2	1.3e-10
WP_012010430.1|2115136_2115229_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_058014780.1|2115316_2115841_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003215830.1|2115865_2116219_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012010433.1|2116332_2116797_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	66.0	2.1e-43
WP_081042313.1|2116824_2117451_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	56.9	1.9e-55
WP_061408410.1|2117462_2118113_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.3	6.8e-40
>prophage 6
NZ_CP011007	Bacillus pumilus strain SH-B9 chromosome, complete genome	3787586	2462342	2548335	3787586	plate,capsid,integrase,portal,tail,terminase,tRNA,protease,coat,holin,head	Bacillus_phage(40.0%)	92	2535651:2535668	2550713:2550730
WP_061408835.1|2462342_2464985_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.1	9.1e-160
WP_003216497.1|2465441_2465630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058014531.1|2465676_2466708_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_058014530.1|2466745_2468002_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_061408838.1|2468138_2469428_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_034661673.1|2469455_2470427_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_061408841.1|2470423_2471215_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_058014527.1|2471211_2472147_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_058014526.1|2472188_2473019_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_061408845.1|2473026_2474394_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_058014524.1|2474636_2475122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003216344.1|2475165_2475753_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_058014523.1|2475749_2478074_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.5	5.9e-179
WP_012010784.1|2478245_2479907_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	36.8	1.0e-15
WP_058014522.1|2480043_2481309_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.2	7.7e-149
WP_034661695.1|2481560_2482835_-	trigger factor	NA	NA	NA	NA	NA
WP_061408848.1|2483074_2484082_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_058014520.1|2484207_2484807_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_034661700.1|2484820_2486236_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_058014519.1|2486276_2487374_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_058014518.1|2487392_2488946_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.6	3.2e-11
WP_058014517.1|2488932_2489961_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003216637.1|2489979_2490498_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_044139976.1|2490494_2492219_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.1	3.7e-61
WP_058014516.1|2492596_2493511_-	branched-chain-amino-acid transaminase	NA	NA	NA	NA	NA
WP_061408851.1|2493944_2494988_+	lactonase family protein	NA	NA	NA	NA	NA
WP_058014514.1|2495021_2495441_-	DUF1232 domain-containing protein	NA	A0A2I7S9Z5	Vibrio_phage	30.5	1.5e-08
WP_061408854.1|2495536_2496703_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_003216498.1|2496702_2496939_-	D-alanine--poly(phosphoribitol) ligase subunit 2	NA	NA	NA	NA	NA
WP_058014512.1|2496960_2498145_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.9	1.1e-16
WP_061408857.1|2498141_2499647_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	23.5	4.4e-34
WP_003216493.1|2499661_2499805_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_081042304.1|2500392_2501964_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	39.6	1.4e-35
WP_047202618.1|2501984_2502374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058014508.1|2503351_2503540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061408861.1|2504347_2504686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058014506.1|2505219_2505744_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_167550610.1|2505758_2506361_-	XTP/dITP diphosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	31.2	1.5e-09
WP_058014504.1|2506371_2507100_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_061408870.1|2507251_2508313_-	sporulation protein	NA	NA	NA	NA	NA
WP_061408873.1|2508414_2509230_-	glutamate racemase	NA	NA	NA	NA	NA
WP_003216546.1|2509240_2509681_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042631274.1|2509830_2509905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061408876.1|2509951_2511478_-	recombinase family protein	NA	A0A290FZV2	Caldibacillus_phage	51.1	7.2e-141
WP_061408879.1|2511637_2512570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061408882.1|2512641_2512833_+	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	82.3	4.9e-23
WP_061408885.1|2513005_2513470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061408888.1|2513627_2514437_-	N-acetylmuramoyl-L-alanine amidase	NA	M4ZRP4	Bacillus_phage	63.1	1.6e-86
WP_061408891.1|2514483_2514903_-|holin	holin family protein	holin	D6R405	Bacillus_phage	74.2	6.3e-47
WP_034325267.1|2514947_2515127_-	XkdX family protein	NA	NA	NA	NA	NA
WP_061408894.1|2515123_2516200_-|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	56.2	3.4e-52
WP_061408897.1|2516213_2518088_-	right-handed parallel beta-helix repeat-containing protein	NA	Q9ZXE2	Bacillus_phage	29.0	2.0e-23
WP_061408900.1|2518125_2519877_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	66.7	8.6e-215
WP_061408904.1|2519888_2520725_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	65.3	1.0e-101
WP_061408907.1|2520725_2525159_-|tail	phage tail tape measure protein	tail	A0A2H4JA91	uncultured_Caudovirales_phage	52.2	6.0e-79
WP_156060386.1|2525198_2525336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017358183.1|2525341_2525704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003216480.1|2525760_2526375_-|tail	tail protein	tail	J7KKC8	Streptococcus_phage	38.2	3.3e-12
WP_061408910.1|2526377_2526776_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_061408913.1|2526772_2527177_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_003216322.1|2527176_2527497_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	34.3	2.7e-10
WP_061408916.1|2527486_2527789_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	8.0e-12
WP_061408919.1|2527801_2528209_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	54.5	3.6e-15
WP_061408922.1|2528232_2529528_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	46.7	4.4e-91
WP_061408925.1|2529567_2530191_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	72.4	1.3e-77
WP_061408928.1|2530153_2531434_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	60.9	1.4e-145
WP_061408931.1|2531438_2531618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061408934.1|2531617_2533330_-|terminase	terminase large subunit	terminase	W8CZ43	Bacillus_phage	63.7	5.1e-212
WP_061408937.1|2533326_2533839_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	45.8	4.4e-34
WP_061408940.1|2534067_2534433_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	49.2	1.1e-26
WP_081106494.1|2534422_2534779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061408946.1|2534829_2535390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061408949.1|2535389_2536715_-	AAA family ATPase	NA	NA	NA	NA	NA
2535651:2535668	attL	TTTAATTATTTTAGAGAA	NA	NA	NA	NA
WP_061408954.1|2537163_2537535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058015872.1|2537775_2538318_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	59.6	3.6e-55
WP_058015871.1|2538314_2538764_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	52.9	1.6e-35
WP_058015898.1|2539132_2540011_-	amidinotransferase	NA	NA	NA	NA	NA
WP_058015869.1|2540296_2540680_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	54.8	9.5e-26
WP_061408959.1|2540816_2541242_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	87.2	1.8e-65
WP_061408962.1|2541364_2541637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167550611.1|2541704_2541881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061408966.1|2541891_2542632_-	hypothetical protein	NA	A0A2H4J6H9	uncultured_Caudovirales_phage	95.9	4.1e-126
WP_061408969.1|2542661_2543648_-	site-specific DNA-methyltransferase	NA	A0A2H4JD00	uncultured_Caudovirales_phage	93.3	5.1e-164
WP_061408972.1|2543668_2544928_-	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	43.8	2.5e-115
WP_061408975.1|2544924_2545173_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	82.7	4.5e-29
WP_061408978.1|2545206_2545416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167550612.1|2545482_2545653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141235147.1|2545666_2545807_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_061408981.1|2545915_2546443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167550613.1|2546439_2546595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081106461.1|2546678_2547500_-	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	40.8	9.1e-50
WP_061408987.1|2547483_2548335_-	DNA replication protein DnaD	NA	A0A0U3TZZ4	Bacillus_phage	49.3	1.7e-62
2550713:2550730	attR	TTCTCTAAAATAATTAAA	NA	NA	NA	NA
>prophage 7
NZ_CP011007	Bacillus pumilus strain SH-B9 chromosome, complete genome	3787586	2761642	2879562	3787586	plate,capsid,integrase,portal,terminase,tail,holin	Bacillus_phage(23.53%)	145	2798882:2798920	2852684:2852722
WP_003217754.1|2761642_2762047_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_003217712.1|2762203_2762395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058014987.1|2762520_2762958_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	66.2	4.8e-50
WP_041815877.1|2763089_2763236_+	YtzI protein	NA	NA	NA	NA	NA
WP_061409231.1|2763244_2763679_-	FixH family protein	NA	NA	NA	NA	NA
WP_003217624.1|2763794_2764268_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_061409234.1|2764394_2764619_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	69.9	6.1e-25
WP_061409236.1|2764620_2765187_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_061409239.1|2765401_2766385_+	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_058014984.1|2766457_2766700_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_003217550.1|2766875_2768207_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_061409242.1|2768222_2769275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008360682.1|2769343_2769502_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_058014981.1|2769527_2769719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061409245.1|2769824_2770949_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_061409248.1|2770949_2772398_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	36.3	1.9e-82
WP_044142129.1|2772469_2773288_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_058014978.1|2773302_2774127_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_061409251.1|2774111_2775854_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_061409254.1|2775846_2777265_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_061409257.1|2777647_2778586_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_061409260.1|2778706_2779441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058014973.1|2779527_2780004_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_012011009.1|2788013_2788589_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_012011010.1|2788680_2788869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061409263.1|2788828_2789383_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_061409266.1|2789552_2790188_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_058013864.1|2790202_2791357_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_144461939.1|2791359_2792496_+	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_003213366.1|2792526_2794074_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	28.4	9.5e-08
WP_058013862.1|2794085_2794616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081042275.1|2794790_2795300_+	DinB family protein	NA	NA	NA	NA	NA
WP_058013861.1|2795339_2796548_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_061409269.1|2796575_2798045_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_061409272.1|2798252_2798810_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
2798882:2798920	attL	CGGGGCATTAGCTCAGCTGGGAGAGCGCTACGCTGGCAG	NA	NA	NA	NA
WP_061409274.1|2799199_2800327_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	48.8	2.8e-94
WP_061409277.1|2800926_2803455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409280.1|2803503_2803998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409283.1|2804167_2804980_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	77.5	2.1e-67
WP_061409287.1|2805036_2805300_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	77.0	6.1e-32
WP_061410257.1|2805315_2805528_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	58.0	3.9e-13
WP_081106495.1|2805590_2805731_-	XkdX family protein	NA	A0A2H4JD72	uncultured_Caudovirales_phage	54.5	3.0e-06
WP_061409293.1|2805730_2806105_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	43.0	1.1e-10
WP_061409296.1|2806109_2807237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409299.1|2807254_2807638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409301.1|2807650_2808574_-	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	27.9	8.8e-09
WP_061409304.1|2808560_2809607_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.0	7.7e-70
WP_061409307.1|2809599_2810028_-	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	32.5	3.3e-11
WP_061409309.1|2810027_2810309_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	40.4	1.0e-08
WP_061409312.1|2810305_2811403_-	hypothetical protein	NA	H7BV96	unidentified_phage	28.3	1.5e-36
WP_047946071.1|2811415_2812078_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2SUI2	Clostridium_phage	32.1	1.5e-26
WP_061409316.1|2812070_2817047_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	47.6	5.9e-43
WP_061410258.1|2817226_2817676_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	33.8	2.4e-12
WP_074041930.1|2817828_2817918_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_044139480.1|2818201_2818645_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	47.2	1.3e-26
WP_061409319.1|2818646_2819993_-|tail	phage tail sheath protein	tail	A0A0A7S087	Clostridium_phage	42.3	5.8e-86
WP_061409322.1|2819995_2820220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409325.1|2820206_2820662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409328.1|2820666_2821173_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.5	1.2e-39
WP_061409331.1|2821169_2821526_-	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_061409333.1|2821522_2821915_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_061409336.1|2821920_2822286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409338.1|2822291_2823221_-|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	64.8	1.7e-105
WP_061409340.1|2823244_2824399_-|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	50.6	8.0e-84
WP_061409341.1|2824425_2825250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409343.1|2825334_2826240_-	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	40.1	6.5e-49
WP_061409344.1|2826236_2827766_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	51.8	4.2e-141
WP_167550624.1|2827762_2829070_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	62.6	2.6e-155
WP_061409348.1|2829081_2829966_-|terminase	terminase	terminase	D2IZ90	Enterococcus_phage	36.9	2.1e-28
WP_061409350.1|2830013_2830262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409353.1|2830401_2831679_-	DNA modification methylase	NA	A0A1B0RXE5	Streptococcus_phage	40.1	9.1e-81
WP_061409355.1|2831733_2832078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008362098.1|2832169_2832352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081106466.1|2832859_2834212_+	collagen-like protein	NA	NA	NA	NA	NA
WP_056702476.1|2834245_2834590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061409357.1|2834704_2835088_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	53.2	9.5e-26
WP_061409359.1|2835167_2835353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409361.1|2835507_2835741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409363.1|2835737_2836148_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	42.4	1.0e-09
WP_061409365.1|2836144_2836750_-	HNH endonuclease	NA	A0A1S5SAI9	Streptococcus_phage	38.5	1.5e-36
WP_061409367.1|2836752_2836983_-	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	64.9	1.1e-16
WP_061409371.1|2837422_2837878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409373.1|2837877_2838186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409374.1|2838187_2838400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409378.1|2838612_2838837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409380.1|2838869_2839073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409382.1|2839146_2839428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409384.1|2839715_2840411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409386.1|2840429_2840921_-	hypothetical protein	NA	A0A0C5AFC9	Paenibacillus_phage	54.2	2.8e-38
WP_034620081.1|2840917_2841157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409388.1|2841153_2841354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409390.1|2841368_2842661_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	45.1	4.1e-97
WP_061409392.1|2842632_2842920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409394.1|2842924_2843764_-	hypothetical protein	NA	B4XYS6	Lactobacillus_phage	29.6	3.7e-22
WP_061409398.1|2843971_2844676_-	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	69.2	1.2e-90
WP_061409400.1|2844672_2845593_-	recombinase RecT	NA	D7RWF9	Brochothrix_phage	63.0	5.7e-85
WP_061409402.1|2845585_2847550_-	AAA family ATPase	NA	A0A1L2K2K3	Aeribacillus_phage	42.0	8.1e-129
WP_061409404.1|2847652_2847871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409406.1|2847867_2848065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409408.1|2848422_2848692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041085486.1|2848694_2848946_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061409410.1|2849048_2849246_-	helix-turn-helix domain-containing protein	NA	U5P0W4	Brevibacillus_phage	54.2	3.7e-10
WP_061409411.1|2849291_2849489_-	helix-turn-helix transcriptional regulator	NA	A8ATX6	Listeria_phage	54.7	2.3e-12
WP_144471008.1|2849659_2850022_+	helix-turn-helix domain-containing protein	NA	A8ATX5	Listeria_phage	41.8	1.3e-08
WP_061409416.1|2850081_2850708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061409418.1|2850806_2851310_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	35.1	1.7e-22
WP_061409420.1|2851302_2852586_+|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	47.0	1.1e-105
WP_058013859.1|2852810_2852999_-	hypothetical protein	NA	NA	NA	NA	NA
2852684:2852722	attR	CGGGGCATTAGCTCAGCTGGGAGAGCGCTACGCTGGCAG	NA	NA	NA	NA
WP_058013858.1|2853114_2853918_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	66.7	7.3e-60
WP_003212734.1|2853937_2854201_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	70.1	5.9e-27
WP_017367922.1|2854212_2854425_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	53.6	5.1e-13
WP_061410260.1|2854462_2854603_-	XkdX family protein	NA	NA	NA	NA	NA
WP_058013856.1|2854602_2854923_-	hypothetical protein	NA	O64053	Bacillus_phage	45.2	3.0e-17
WP_061409422.1|2854935_2856321_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	31.7	1.1e-28
WP_061409424.1|2856485_2857691_-	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	53.4	1.1e-67
WP_058013853.1|2857765_2858149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409426.1|2858160_2859084_-	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	29.2	4.7e-10
WP_058013851.1|2859067_2860117_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	42.3	4.3e-68
WP_012011034.1|2860109_2860532_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_061409428.1|2860546_2860813_-	DUF2577 family protein	NA	S6C459	Thermus_phage	36.4	6.2e-08
WP_061409430.1|2860809_2861820_-	hypothetical protein	NA	H7BV96	unidentified_phage	29.0	1.6e-35
WP_003213616.1|2861831_2862500_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2SUI2	Clostridium_phage	30.1	5.9e-23
WP_061410261.1|2862492_2866560_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	41.9	6.3e-43
WP_088002055.1|2866614_2866752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012011040.1|2866793_2867234_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	36.8	9.9e-11
WP_080772987.1|2867386_2867476_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_058013848.1|2867761_2868205_-|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	45.8	1.3e-26
WP_061409432.1|2868206_2869553_-|tail	phage tail sheath protein	tail	S5MNC1	Brevibacillus_phage	39.1	1.6e-75
WP_058013846.1|2869556_2869769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058013845.1|2869755_2870211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409434.1|2870215_2870713_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.2	3.1e-37
WP_058013843.1|2870709_2871066_-	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_061409436.1|2871062_2871446_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_061409438.1|2871459_2872383_-|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	63.6	2.8e-108
WP_058013840.1|2872405_2873494_-|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	41.8	4.7e-62
WP_061409440.1|2873532_2874990_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	51.8	2.4e-138
WP_061409442.1|2874986_2876300_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	61.0	3.9e-151
WP_061409444.1|2876296_2876941_-	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	44.3	5.5e-42
WP_061409446.1|2877093_2877612_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J6J3	uncultured_Caudovirales_phage	47.5	8.0e-36
WP_012011053.1|2877738_2877945_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	68.5	2.6e-14
WP_061409448.1|2877941_2878343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061410262.1|2878393_2878624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167550615.1|2878613_2878766_-	hypothetical protein	NA	A0A2H4J4L6	uncultured_Caudovirales_phage	61.1	7.3e-06
WP_058013834.1|2878762_2879026_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003213241.1|2879184_2879562_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	44.5	6.1e-17
>prophage 8
NZ_CP011007	Bacillus pumilus strain SH-B9 chromosome, complete genome	3787586	3422277	3480450	3787586	transposase,tRNA,protease,coat,bacteriocin	Bacillus_phage(25.0%)	60	NA	NA
WP_003214902.1|3422277_3422568_-|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_034620267.1|3423572_3423764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409871.1|3424115_3425258_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_061409873.1|3425274_3426387_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_061409875.1|3426398_3427262_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_061409877.1|3427281_3428457_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_061409879.1|3428559_3430671_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_061409881.1|3430814_3432011_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_061409883.1|3432023_3432986_+	UV DNA damage repair endonuclease UvsE	NA	A0A127AW32	Bacillus_phage	35.8	3.1e-41
WP_058013450.1|3433059_3433314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058013449.1|3433343_3434342_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_058013879.1|3434414_3436130_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.9	2.0e-59
WP_144461927.1|3436235_3437699_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_058013448.1|3437894_3438866_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_058013447.1|3439275_3440949_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_058013446.1|3440945_3441368_-	DUF1934 family protein	NA	NA	NA	NA	NA
WP_061409885.1|3441492_3441840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003214818.1|3441919_3442792_-	agmatinase	NA	NA	NA	NA	NA
WP_003214614.1|3442861_3443692_-	spermidine synthase	NA	NA	NA	NA	NA
WP_061409887.1|3443916_3445986_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_058013442.1|3446111_3446630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409889.1|3446642_3447305_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003214939.1|3447412_3447598_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_061409891.1|3447647_3448460_-	peptidase M84	NA	NA	NA	NA	NA
WP_058013439.1|3448684_3449185_-	YwgA family protein	NA	NA	NA	NA	NA
WP_007497716.1|3449215_3450517_-	HD domain-containing protein	NA	A0A1V0SGM3	Hokovirus	30.3	1.6e-24
WP_003215259.1|3450687_3450909_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_061409893.1|3451147_3451948_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_061409894.1|3451982_3452216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409896.1|3452212_3454489_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_058013435.1|3454607_3455093_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_061409898.1|3455133_3455982_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_061409900.1|3456149_3456542_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_061409902.1|3456581_3456944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409904.1|3456958_3458488_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_061409906.1|3458499_3458778_-	YwqI/YxiC family protein	NA	NA	NA	NA	NA
WP_058013432.1|3458770_3459181_-	DUF5082 family protein	NA	NA	NA	NA	NA
WP_058013431.1|3459356_3459623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061409908.1|3459636_3460971_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_058013429.1|3461016_3461892_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_081106477.1|3461903_3462575_-	RraA family protein	NA	NA	NA	NA	NA
WP_058013427.1|3462718_3463570_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061409912.1|3463704_3464676_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_058013426.1|3464915_3465686_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_061409914.1|3465753_3466914_+	MFS transporter	NA	NA	NA	NA	NA
WP_058013424.1|3466927_3467407_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_061409916.1|3467552_3468785_+	MFS transporter	NA	NA	NA	NA	NA
WP_058013422.1|3468934_3469537_+	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
WP_061409918.1|3469538_3470246_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_058013420.1|3470242_3471004_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.2	8.8e-23
WP_058013419.1|3471019_3472441_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_167550626.1|3472459_3473653_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_061410277.1|3473667_3474465_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_058013417.1|3474559_3475015_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_058013416.1|3475007_3475862_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	5.6e-34
WP_058013415.1|3475865_3476831_-	dTDP-glucose 4,6-dehydratase	NA	K7QJG5	Escherichia_phage	45.9	1.3e-76
WP_061409922.1|3476827_3477568_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	41.6	9.4e-46
WP_061409923.1|3477570_3478599_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_061409925.1|3478595_3479336_-	glycosyltransferase family protein	NA	NA	NA	NA	NA
WP_061409927.1|3479325_3480450_-|coat	spore coat protein	coat	A0A1B1IVE2	uncultured_Mediterranean_phage	29.3	3.8e-22
