The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013261	Corynebacterium pseudotuberculosis strain MB14, complete genome	2370761	1758722	1836421	2370761	integrase,bacteriocin,protease	Agrobacterium_phage(16.67%)	60	1805590:1805617	1811502:1811529
WP_014367461.1|1758722_1760009_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.4	1.8e-132
WP_014523534.1|1760169_1762974_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	34.5	2.8e-82
WP_013242459.1|1763050_1763680_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.5	1.4e-37
WP_013242460.1|1763695_1764295_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.3	1.3e-42
WP_014524025.1|1764506_1765859_-	trigger factor	NA	NA	NA	NA	NA
WP_014300878.1|1766648_1766891_+	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	48.4	3.9e-09
WP_014523535.1|1767027_1767804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367466.1|1767890_1768901_-	pirin family protein	NA	NA	NA	NA	NA
WP_013242465.1|1769018_1769492_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_014367467.1|1769558_1770179_-	DSBA oxidoreductase	NA	NA	NA	NA	NA
WP_014367469.1|1770512_1773128_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	29.7	5.9e-42
WP_061406475.1|1773264_1773540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014523536.1|1773550_1774129_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_014367472.1|1774247_1774640_+	globin	NA	NA	NA	NA	NA
WP_013242473.1|1775550_1776159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242474.1|1776164_1776593_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014522869.1|1776800_1778471_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	27.9	1.3e-47
WP_014367473.1|1778660_1779221_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_014367476.1|1779749_1781504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367477.1|1781500_1783039_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014523541.1|1783065_1784544_+	nitroreductase	NA	NA	NA	NA	NA
WP_014367479.1|1784540_1787144_+	lantibiotic dehydratase	NA	NA	NA	NA	NA
WP_014367480.1|1787143_1788157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367481.1|1788153_1789134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367482.1|1789172_1789343_+|bacteriocin	thiazolylpeptide-type bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014733038.1|1789416_1790868_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014367484.1|1790889_1791648_-	permease	NA	NA	NA	NA	NA
WP_014367485.1|1791644_1792568_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.1	4.2e-19
WP_014367486.1|1792658_1794704_-	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_014367488.1|1795296_1797582_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_014367489.1|1797601_1797802_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_014367490.1|1798142_1799969_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.8	6.8e-29
WP_014733040.1|1800244_1801240_+	oxidoreductase	NA	NA	NA	NA	NA
WP_014523547.1|1801366_1802170_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014523548.1|1802235_1802895_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	35.0	8.4e-22
WP_014367495.1|1803074_1803902_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_014523549.1|1803955_1805146_-	L,D-transpeptidase	NA	NA	NA	NA	NA
1805590:1805617	attL	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_050494099.1|1805764_1806442_+	hypothetical protein	NA	A0A1X9SFC1	Mycobacterium_phage	34.0	5.1e-22
WP_080713377.1|1806384_1806897_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_032802512.1|1807348_1808353_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_050494101.1|1808349_1809159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367498.1|1810240_1810798_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	46.2	4.0e-33
WP_014367502.1|1811841_1812840_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
1811502:1811529	attR	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_013242498.1|1814070_1814346_-	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_013242499.1|1814434_1814914_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_013242500.1|1814951_1815605_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013242501.1|1815617_1816007_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_014367505.1|1816137_1825236_-	type I polyketide synthase	NA	NA	NA	NA	NA
WP_014523551.1|1825460_1825766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014655722.1|1825926_1827042_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_014367508.1|1827038_1827665_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014367509.1|1827708_1828740_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_014524035.1|1828922_1829681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367512.1|1831439_1831886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367513.1|1831973_1832333_+	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_014367514.1|1832401_1833025_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_032802570.1|1833021_1833756_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_014523555.1|1833794_1834562_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_050859131.1|1834634_1835456_-	glutamate racemase	NA	NA	NA	NA	NA
WP_014367517.1|1835602_1836421_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP013261	Corynebacterium pseudotuberculosis strain MB14, complete genome	2370761	1985385	1993846	2370761	holin	Pandoravirus(33.33%)	11	NA	NA
WP_014367621.1|1985385_1987134_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	31.5	4.9e-61
WP_014367622.1|1987111_1987780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367623.1|1987787_1988174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367624.1|1988170_1988686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242641.1|1988696_1989143_-	DUF3180 domain-containing protein	NA	NA	NA	NA	NA
WP_014367625.1|1989139_1989595_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4W084	Pandoravirus	33.8	1.1e-09
WP_014655799.1|1989596_1989938_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_014523608.1|1989924_1990707_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.2	6.5e-21
WP_014367628.1|1990708_1991272_-	GTP cyclohydrolase I FolE	NA	A0A1W7AF02	Streptococcus_virus	57.8	2.6e-48
WP_088428658.1|1991264_1993220_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	50.3	7.6e-111
WP_014300955.1|1993264_1993846_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.4	3.0e-15
