The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013263	Corynebacterium pseudotuberculosis strain MB66, complete genome	2372202	690885	765266	2372202	protease,bacteriocin,integrase	Tupanvirus(18.18%)	58	716792:716819	722704:722731
WP_032802571.1|690885_691185_+|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_013242516.1|691279_691816_+	DUF2017 domain-containing protein	NA	NA	NA	NA	NA
WP_014367517.1|691902_692721_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_014367516.1|692794_693688_+	glutamate racemase	NA	NA	NA	NA	NA
WP_014523555.1|693760_694528_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_032802570.1|694566_695301_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_014367514.1|695297_695921_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_014367513.1|695989_696349_-	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_014367512.1|696436_696883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014524035.1|698640_699399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367509.1|699581_700613_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_014367508.1|700656_701283_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014655722.1|701279_702395_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_014523551.1|702555_702861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367505.1|703085_712184_+	type I polyketide synthase	NA	NA	NA	NA	NA
WP_013242501.1|712314_712704_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_013242500.1|712716_713370_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013242499.1|713407_713887_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_013242498.1|713975_714251_+	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_014655718.1|714726_715281_-	isochorismatase family protein	NA	A0A2K9L2K0	Tupanvirus	32.6	5.2e-17
WP_014367502.1|715480_716479_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
716792:716819	attL	GTGCGCCATCAGGGACTTGAACCCCGAA	NA	NA	NA	NA
WP_014367498.1|717522_718080_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	46.2	4.0e-33
WP_050494101.1|719161_719971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032802512.1|719967_720972_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_080713377.1|721423_721936_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_050494099.1|721878_722556_-	hypothetical protein	NA	A0A1X9SFC1	Mycobacterium_phage	34.0	5.1e-22
WP_014523549.1|723174_724365_+	L,D-transpeptidase	NA	NA	NA	NA	NA
722704:722731	attR	GTGCGCCATCAGGGACTTGAACCCCGAA	NA	NA	NA	NA
WP_014367495.1|724418_725246_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_014523548.1|725425_726085_-	oligoribonuclease	NA	M4M9I5	Vibrio_phage	35.0	8.4e-22
WP_014523547.1|726150_726954_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014733040.1|727080_728076_-	oxidoreductase	NA	NA	NA	NA	NA
WP_014367490.1|728351_730178_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.8	6.8e-29
WP_014367489.1|730518_730719_-	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_014367486.1|733615_735661_+	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_014367485.1|735751_736675_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.1	4.2e-19
WP_014367484.1|736671_737430_+	permease	NA	NA	NA	NA	NA
WP_014733038.1|737451_738903_-	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014367482.1|738976_739147_-|bacteriocin	thiazolylpeptide-type bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014367481.1|739185_740166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367480.1|740162_741176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014523541.1|743774_745253_-	nitroreductase	NA	NA	NA	NA	NA
WP_014367477.1|745279_746818_-	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014367476.1|746814_748569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367473.1|749097_749658_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_014522869.1|749847_751518_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	27.9	1.3e-47
WP_013242474.1|751725_752154_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_013242473.1|752159_752768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367472.1|753678_754071_-	globin	NA	NA	NA	NA	NA
WP_014523536.1|754189_754768_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_014367469.1|755189_757805_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	29.7	5.9e-42
WP_014367467.1|758138_758759_+	DSBA oxidoreductase	NA	NA	NA	NA	NA
WP_013242465.1|758825_759299_+	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_014367466.1|759416_760427_+	pirin family protein	NA	NA	NA	NA	NA
WP_014523535.1|760513_761290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014300878.1|761426_761669_-	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	48.4	3.9e-09
WP_014524025.1|762458_763811_+	trigger factor	NA	NA	NA	NA	NA
WP_013242460.1|764021_764621_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.3	1.3e-42
WP_013242459.1|764636_765266_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.5	1.4e-37
>prophage 2
NZ_CP013263	Corynebacterium pseudotuberculosis strain MB66, complete genome	2372202	1384680	1448601	2372202	protease,transposase,holin,tRNA	Bacillus_phage(17.65%)	54	NA	NA
WP_014366814.1|1384680_1385421_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_013241618.1|1385522_1387199_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	1.1e-17
WP_014366812.1|1387204_1388164_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013241616.1|1388156_1389083_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014366811.1|1389174_1390755_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014366810.1|1391007_1391394_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_014523872.1|1391855_1392611_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_014523871.1|1392607_1394008_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.9	1.7e-11
WP_014366806.1|1394249_1394864_-	membrane protein	NA	NA	NA	NA	NA
WP_014366805.1|1395016_1395901_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_014366804.1|1396030_1396957_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_043014386.1|1397144_1399469_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	33.8	3.5e-123
WP_014366802.1|1399544_1401221_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	33.3	2.5e-22
WP_014523870.1|1401217_1402858_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.6	5.0e-23
WP_014366800.1|1402923_1403310_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_014366799.1|1403486_1404026_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_014366797.1|1404551_1405637_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_014523868.1|1405770_1407345_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_080713369.1|1408411_1409755_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.4	3.5e-59
WP_080713369.1|1409854_1411198_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.4	3.5e-59
WP_014367640.1|1411741_1411891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367639.1|1411943_1412129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032802653.1|1412288_1413185_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_014367635.1|1417693_1418134_-	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_014367634.1|1418155_1419403_-	lipase	NA	NA	NA	NA	NA
WP_014367633.1|1419417_1419609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242652.1|1419673_1421116_+	C4-dicarboxylate transporter DctA	NA	NA	NA	NA	NA
WP_014367631.1|1421150_1421435_-	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	39.2	5.6e-07
WP_013242650.1|1421436_1421913_-	inorganic diphosphatase	NA	NA	NA	NA	NA
WP_014300957.1|1421962_1423147_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_014367630.1|1423177_1424020_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_014300955.1|1424023_1424605_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.4	3.0e-15
WP_088428658.1|1424649_1426605_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	50.3	7.6e-111
WP_014367628.1|1426597_1427161_+	GTP cyclohydrolase I FolE	NA	A0A1W7AF02	Streptococcus_virus	57.8	2.6e-48
WP_014523608.1|1427162_1427945_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.2	6.5e-21
WP_014655799.1|1427931_1428273_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_014367625.1|1428274_1428730_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4W084	Pandoravirus	33.8	1.1e-09
WP_013242641.1|1428726_1429173_+	DUF3180 domain-containing protein	NA	NA	NA	NA	NA
WP_014367624.1|1429183_1429699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367623.1|1429695_1430082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367622.1|1430089_1430758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367621.1|1430735_1432484_-|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	31.5	4.9e-61
WP_014367620.1|1432689_1434837_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.7	7.0e-17
WP_014367619.1|1434846_1436352_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_014367618.1|1436348_1437638_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_014523607.1|1437792_1437993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014524074.1|1437992_1438937_-	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_014523605.1|1439047_1440604_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	34.2	8.0e-71
WP_014523604.1|1440852_1441515_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014367613.1|1441581_1442478_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014367612.1|1442561_1443554_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_014367611.1|1443591_1444995_+	MFS transporter	NA	NA	NA	NA	NA
WP_013242626.1|1445070_1445757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367610.1|1445943_1448601_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	40.0	1.1e-131
