The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014643	Lysinibacillus sphaericus strain OT4b.25 chromosome, complete genome	4665575	1057	82783	4665575	protease,transposase,integrase	Bacillus_phage(50.0%)	49	11492:11550	78767:78825
WP_061504535.1|1057_1276_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036160806.1|3165_5130_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.1	4.9e-17
WP_155726281.1|10452_10602_+	hypothetical protein	NA	NA	NA	NA	NA
11492:11550	attL	TAATAGGAGTTGGATCATTAGTTGAAGATAGATAAAGACTTACATCCGCAGACATAATA	NA	NA	NA	NA
WP_036160800.1|11556_12507_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
WP_158511882.1|13784_13994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036160796.1|14224_14815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012292847.1|15032_15536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012292846.1|15965_16973_-	DUF4179 domain-containing protein	NA	NA	NA	NA	NA
WP_012292845.1|16950_17493_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012292844.1|17803_20344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036160793.1|20695_21031_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_036160791.1|21465_22302_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	30.3	2.3e-24
WP_080695238.1|22307_23282_-|integrase	tyrosine-type recombinase/integrase	integrase	W5RV39	Staphylococcus_phage	25.5	1.0e-07
WP_012292840.1|24223_25057_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	26.5	3.0e-16
WP_036160788.1|25062_25956_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	25.7	1.4e-19
WP_012292837.1|28398_29799_+	spore germination protein	NA	NA	NA	NA	NA
WP_036160781.1|29828_30956_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_139015314.1|31377_31788_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_012292834.1|32594_33005_+	DUF4183 domain-containing protein	NA	NA	NA	NA	NA
WP_036160776.1|33052_33373_+	DUF4183 domain-containing protein	NA	NA	NA	NA	NA
WP_012292832.1|34001_34745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012292831.1|35438_37172_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_080695167.1|38039_38138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012292829.1|38277_38715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012292828.1|39039_39912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012292827.1|41153_42587_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_051563177.1|43269_45609_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	34.3	4.3e-20
WP_036160771.1|45793_48406_+	hypothetical protein	NA	A0A0K2CYN4	Paenibacillus_phage	35.9	2.5e-133
WP_036160769.1|48992_49568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012292822.1|51472_51934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139015313.1|52472_53351_+	ETX/MTX2 family pore-forming toxin	NA	NA	NA	NA	NA
WP_012292817.1|55629_56037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080695166.1|56078_56339_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1P8CWQ3	Bacillus_phage	65.4	2.0e-11
WP_139015312.1|56290_56485_-	hypothetical protein	NA	A0A1P8CWQ3	Bacillus_phage	67.3	2.3e-12
WP_139015311.1|56833_57151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036160766.1|58644_58938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012292811.1|59609_60086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139015351.1|60213_60639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012292809.1|61203_61818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080695165.1|61995_62499_-	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_012292806.1|62583_62838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012292805.1|63526_63895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012292804.1|63907_66895_-	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_012292803.1|66897_68373_-	DNRLRE domain-containing protein	NA	NA	NA	NA	NA
WP_036160763.1|68359_68725_-	hypothetical protein	NA	I1TLF2	Bacillus_phage	45.1	2.3e-05
WP_012292800.1|69487_69688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036160758.1|70694_72851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036160752.1|75032_79904_-	DNRLRE domain-containing protein	NA	I1TLF2	Bacillus_phage	26.6	3.4e-11
78767:78825	attR	TAATAGGAGTTGGATCATTAGTTGAAGATAGATAAAGACTTACATCCGCAGACATAATA	NA	NA	NA	NA
WP_139015310.1|81432_82783_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	81.8	1.9e-124
>prophage 2
NZ_CP014643	Lysinibacillus sphaericus strain OT4b.25 chromosome, complete genome	4665575	1215465	1222933	4665575		Bacillus_virus(33.33%)	8	NA	NA
WP_012291984.1|1215465_1216440_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	51.1	1.1e-86
WP_012291985.1|1216513_1217266_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_012291986.1|1217262_1217994_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.6	1.1e-17
WP_012291987.1|1218093_1218594_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	46.6	3.2e-21
WP_012291988.1|1218660_1219962_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	40.5	1.8e-68
WP_012291989.1|1219975_1220317_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_036160402.1|1220629_1222090_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	46.7	5.0e-115
WP_012291991.1|1222108_1222933_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.2	3.8e-72
>prophage 3
NZ_CP014643	Lysinibacillus sphaericus strain OT4b.25 chromosome, complete genome	4665575	1244814	1253226	4665575		Synechococcus_phage(33.33%)	8	NA	NA
WP_012292010.1|1244814_1246110_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.5	4.7e-16
WP_012292011.1|1246239_1246950_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SS43	Cyanophage	41.0	3.4e-45
WP_012292012.1|1246952_1247201_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_012292013.1|1247203_1247887_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_012292014.1|1247873_1250108_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.4	1.4e-156
WP_012292015.1|1250083_1251508_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	3.4e-52
WP_012292016.1|1251601_1252657_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	43.7	8.6e-61
WP_012292017.1|1252656_1253226_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.3	1.3e-23
>prophage 4
NZ_CP014643	Lysinibacillus sphaericus strain OT4b.25 chromosome, complete genome	4665575	1712709	1722045	4665575	tRNA	Staphylococcus_phage(66.67%)	7	NA	NA
WP_012295735.1|1712709_1713288_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	49.5	2.9e-42
WP_031416441.1|1713284_1714241_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	75.2	5.1e-60
WP_036162335.1|1714467_1715646_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	49.2	5.8e-106
WP_012295733.1|1715792_1716140_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_031416439.1|1716197_1717940_+	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	28.1	5.8e-46
WP_012295731.1|1718301_1720719_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	73.8	0.0e+00
WP_036162332.1|1720863_1722045_-	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	21.6	2.5e-08
>prophage 5
NZ_CP014643	Lysinibacillus sphaericus strain OT4b.25 chromosome, complete genome	4665575	2159814	2231462	4665575	protease,integrase,plate,coat,tail,terminase,head,tRNA,holin,capsid,portal	Vibrio_phage(19.44%)	85	2169294:2169316	2194316:2194338
WP_036162193.1|2159814_2161164_-|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
WP_139015344.1|2161367_2163281_-	recombinase family protein	NA	A0A0A7RUB1	Clostridium_phage	49.7	1.0e-144
WP_036162191.1|2163770_2163950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036162189.1|2163957_2164320_-	helix-turn-helix transcriptional regulator	NA	A0A0A8WJK5	Clostridium_phage	33.0	8.2e-11
WP_051563287.1|2164365_2164731_-	helix-turn-helix transcriptional regulator	NA	A0A0A8WJK5	Clostridium_phage	43.4	1.2e-17
WP_155726286.1|2164917_2165073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012295315.1|2165327_2165501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012295314.1|2165494_2165845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012295313.1|2166132_2167065_+	hypothetical protein	NA	Q0SPI6	Clostridium_phage	37.9	1.0e-33
WP_051563285.1|2167039_2167513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012295310.1|2167525_2169067_+	hypothetical protein	NA	A0A0E3XCJ0	Enterococcus_phage	32.8	6.4e-12
WP_012295309.1|2169063_2169921_+	DUF3102 domain-containing protein	NA	A0A2H4J025	uncultured_Caudovirales_phage	45.6	3.3e-18
2169294:2169316	attL	TTCAAATTCCCAAGCGTTTGGGA	NA	NA	NA	NA
WP_012295308.1|2169920_2170127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158511878.1|2170113_2170485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012295306.1|2170559_2171279_+	hypothetical protein	NA	A0A068EMK6	Bacillus_phage	30.7	3.9e-20
WP_012295304.1|2171661_2171820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012295303.1|2171914_2172250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051563284.1|2172276_2172723_+	hypothetical protein	NA	A0A1B1P7B2	Bacillus_phage	36.2	6.7e-15
WP_012295301.1|2172719_2173301_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLG4	Bacillus_phage	52.1	5.6e-46
WP_012295299.1|2173695_2173890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012295298.1|2174039_2174618_+	hypothetical protein	NA	A0A0E3Y4U4	Fusobacterium_phage	28.0	4.2e-09
WP_036162186.1|2174577_2176413_+|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	52.6	3.5e-174
WP_036162184.1|2176388_2176622_+	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	49.4	1.1e-13
WP_012295296.1|2176637_2178215_+|portal	phage portal protein	portal	A0A0C5AJ48	Bacteriophage	58.3	2.4e-155
WP_012295295.1|2178201_2179269_+|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	49.0	1.8e-45
WP_012295294.1|2179269_2179635_+|head	head decoration protein	head	NA	NA	NA	NA
WP_012295293.1|2179638_2180664_+|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	38.1	1.1e-57
WP_012295292.1|2180675_2181041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012295291.1|2181033_2181366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012295290.1|2181378_2181930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012295289.1|2181929_2182421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012295288.1|2182410_2182716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036162181.1|2182717_2184148_+	hypothetical protein	NA	A0A0C5AEE8	Bacteriophage	41.5	2.0e-100
WP_012295287.1|2184165_2184687_+|tail	phage major tail tube protein	tail	A0A0E3Y6F4	Fusobacterium_phage	33.5	3.8e-25
WP_012295286.1|2184714_2185113_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_051563282.1|2185261_2188213_+|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	62.4	1.7e-98
WP_036162178.1|2188205_2188421_+	hypothetical protein	NA	A0A067ZJB1	Vibrio_phage	37.5	6.1e-06
WP_012295282.1|2188417_2189434_+	bacteriophage regulatory protein	NA	A0A0C5AJ59	Bacteriophage	33.3	4.2e-44
WP_012295281.1|2189433_2189625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051563280.1|2189635_2190310_+	SH3 domain-containing protein	NA	A0A067ZI88	Vibrio_phage	40.9	3.6e-20
WP_036162860.1|2190328_2190613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012295278.1|2190602_2191733_+|plate	baseplate J/gp47 family protein	plate	A0A067ZJB4	Vibrio_phage	38.8	2.4e-69
WP_012295277.1|2191725_2192373_+|tail	phage tail protein I	tail	A0A059WLJ8	Vibrio_phage	31.1	5.0e-19
WP_012295276.1|2192374_2193709_+|tail	phage tail protein	tail	A0A2H4J194	uncultured_Caudovirales_phage	53.4	1.0e-42
WP_012295275.1|2193727_2194168_+	hypothetical protein	NA	S5MUI6	Brevibacillus_phage	29.7	3.0e-07
WP_012295274.1|2194446_2195703_+	DNA (cytosine-5-)-methyltransferase	NA	A0A141E1L1	Streptococcus_phage	60.5	2.4e-134
2194316:2194338	attR	TCCCAAACGCTTGGGAATTTGAA	NA	NA	NA	NA
WP_012295273.1|2195755_2196145_+|holin	holin	holin	Q8SBN5	Clostridium_phage	52.1	2.9e-22
WP_080695220.1|2196141_2196837_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A060AC40	Listeria_phage	50.3	1.1e-43
WP_036162852.1|2196979_2197204_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_036162175.1|2197197_2197536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012295269.1|2197641_2198112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012295268.1|2198220_2198424_-	helix-turn-helix transcriptional regulator	NA	A0A0A0RVA6	Bacillus_phage	45.5	8.6e-10
WP_036162170.1|2198597_2199491_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036162167.1|2199873_2201169_+	cell division protein FtsK	NA	A0A2H4J9G1	uncultured_Caudovirales_phage	57.5	4.7e-133
WP_051563278.1|2201110_2201710_+	hypothetical protein	NA	A0A1S5QTS6	Bacillus_phage	48.7	2.0e-46
WP_012295264.1|2201710_2202250_+	hypothetical protein	NA	A0A2H4JA12	uncultured_Caudovirales_phage	67.9	2.0e-21
WP_012295263.1|2202774_2203446_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_036162165.1|2203572_2203797_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_012295262.1|2203793_2204057_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_031417041.1|2204081_2204651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012295261.1|2204698_2205355_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_036162163.1|2205381_2206719_-	ATP synthase subunit J	NA	NA	NA	NA	NA
WP_004227078.1|2207228_2207402_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_031417037.1|2207703_2209032_+	membrane protein	NA	NA	NA	NA	NA
WP_008179446.1|2209035_2210040_+	flotillin-like protein FloA	NA	NA	NA	NA	NA
WP_012295257.1|2210065_2210545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012295256.1|2210600_2210849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012295255.1|2210850_2211963_+	stage IV sporulation protein	NA	NA	NA	NA	NA
WP_031417032.1|2211965_2212922_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.9	3.2e-46
WP_012295253.1|2213145_2215266_+	HD family phosphohydrolase	NA	NA	NA	NA	NA
WP_012295252.1|2215274_2215748_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_012295251.1|2215748_2216099_+	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_008179431.1|2216164_2216578_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_036162160.1|2216564_2217482_+	GTPase Era	NA	NA	NA	NA	NA
WP_036162158.1|2217673_2218462_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_036162156.1|2218486_2219890_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_031417025.1|2220639_2222358_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_012295244.1|2222408_2223794_-|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	31.1	2.2e-48
WP_008178461.1|2224473_2225106_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_008178459.1|2225123_2225936_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_012295243.1|2226143_2227976_+	DNA primase	NA	A0A1S5RH72	Helicobacter_phage	34.8	6.6e-48
WP_012295242.1|2228008_2229136_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	2.4e-37
WP_036162150.1|2229368_2229932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012295240.1|2230245_2230605_+	cytochrome c	NA	NA	NA	NA	NA
WP_031417022.1|2230769_2231462_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP014643	Lysinibacillus sphaericus strain OT4b.25 chromosome, complete genome	4665575	2799503	2805515	4665575		Pneumococcus_phage(50.0%)	6	NA	NA
WP_012294688.1|2799503_2801858_-	peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.0	6.4e-72
WP_031418567.1|2802453_2802954_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	61.1	4.4e-47
WP_012294686.1|2803073_2803733_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	56.3	6.6e-67
WP_012294685.1|2803735_2804209_+	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	72.2	3.3e-60
WP_036161829.1|2804201_2804930_+	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	43.4	4.7e-50
WP_012294683.1|2804975_2805515_+	hypothetical protein	NA	E7DND6	Pneumococcus_phage	27.0	1.0e-04
>prophage 7
NZ_CP014643	Lysinibacillus sphaericus strain OT4b.25 chromosome, complete genome	4665575	3015172	3062237	4665575	tRNA,transposase,integrase	Bacillus_virus(16.67%)	40	3014996:3015012	3073054:3073070
3014996:3015012	attL	AAAAATCCTCTACCCAA	NA	NA	NA	NA
WP_036161677.1|3015172_3015778_+|transposase	IS607 family transposase	transposase	Q331Z3	Clostridium_botulinum_C_phage	53.3	4.2e-52
WP_012294477.1|3015770_3016940_+|transposase	transposase	transposase	D2XQ03	Bacillus_virus	49.7	1.8e-96
WP_036161675.1|3017471_3018908_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	38.8	4.9e-99
WP_012294475.1|3019240_3020962_-	phosphodiesterase	NA	G3MA91	Bacillus_virus	33.9	2.6e-14
WP_012294474.1|3021339_3021510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004230023.1|3021713_3021863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012294472.1|3022457_3022955_-	DinB family protein	NA	NA	NA	NA	NA
WP_012294471.1|3023008_3023971_-	tyrosine recombinase XerC	NA	A0A160DCT0	Gordonia_phage	29.6	8.5e-15
WP_036161672.1|3024310_3024724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012294469.1|3024802_3026290_+	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_080695199.1|3026243_3027209_+	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_012294467.1|3027270_3028125_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_012294466.1|3028177_3029053_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012294465.1|3029414_3030209_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_031415877.1|3030467_3030788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012294463.1|3031038_3031854_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_012294462.1|3032165_3033341_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_012294461.1|3033819_3035019_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_012294460.1|3035083_3036034_-	LCP family protein	NA	NA	NA	NA	NA
WP_012294459.1|3036210_3036732_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_036161669.1|3036809_3038582_-	DNA helicase RecQ	NA	A0A0G2Y8K9	Acanthamoeba_polyphaga_mimivirus	35.4	3.5e-70
WP_012294457.1|3038589_3039690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036161666.1|3039946_3041122_-	MFS transporter	NA	NA	NA	NA	NA
WP_012294454.1|3041222_3042896_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.5	1.4e-73
WP_012294452.1|3043337_3045224_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012294451.1|3045814_3045955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139015334.1|3046153_3047302_-	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012294449.1|3048345_3049845_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.2	9.9e-10
WP_036161662.1|3050459_3051386_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_031415857.1|3051675_3052698_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	26.3	1.3e-16
WP_012294444.1|3053604_3054786_-	glucosyltransferase	NA	Q6QXI9	Agrotis_segetum_granulosis_virus	27.0	9.5e-08
WP_036161659.1|3054782_3055220_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051563241.1|3056250_3056583_-	DUF4288 domain-containing protein	NA	NA	NA	NA	NA
WP_012294441.1|3056607_3056937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012294440.1|3057097_3058078_-	ETX/MTX2 family pore-forming toxin	NA	A0A2I7SC07	Paenibacillus_phage	28.0	7.6e-19
WP_080695198.1|3058576_3059017_-	ETX/MTX2 family pore-forming toxin	NA	NA	NA	NA	NA
WP_012294438.1|3060666_3061323_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012294437.1|3061426_3061570_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012294436.1|3061535_3061862_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	62.3	3.0e-28
WP_081112813.1|3061865_3062237_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
3073054:3073070	attR	TTGGGTAGAGGATTTTT	NA	NA	NA	NA
>prophage 8
NZ_CP014643	Lysinibacillus sphaericus strain OT4b.25 chromosome, complete genome	4665575	3966382	3986293	4665575	holin,tail,plate	Clostridium_phage(47.37%)	25	NA	NA
WP_012293487.1|3966382_3967210_-	M23 family metallopeptidase	NA	D6QWN5	uncultured_phage	38.4	4.3e-15
WP_012293486.1|3967424_3968837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012293485.1|3969266_3969989_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A060AC40	Listeria_phage	49.1	2.9e-44
WP_012293484.1|3969985_3970252_-|holin	holin	holin	A0A2H4JAH4	uncultured_Caudovirales_phage	53.6	4.0e-15
WP_051563194.1|3970264_3970570_-	hypothetical protein	NA	A0A0H3UZE6	Geobacillus_virus	38.6	1.3e-09
WP_012293482.1|3970744_3971164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012293481.1|3971177_3972803_-	hypothetical protein	NA	S6B1J7	Thermus_phage	50.7	1.2e-24
WP_012293480.1|3972802_3973351_-	DUF2313 domain-containing protein	NA	A0A0A8WII4	Clostridium_phage	32.9	2.6e-16
WP_012293479.1|3973343_3974429_-|plate	baseplate J/gp47 family protein	plate	A0A0A8WJT7	Clostridium_phage	48.4	1.4e-85
WP_012293478.1|3974428_3974833_-	DUF2634 domain-containing protein	NA	A0A0A8WFW6	Clostridium_phage	52.8	4.7e-31
WP_012293477.1|3974832_3975147_-	DUF2577 domain-containing protein	NA	A0A0A7RTJ2	Clostridium_phage	30.8	3.9e-09
WP_139015321.1|3975148_3976111_-	hydrolase	NA	H7BVH4	unidentified_phage	50.6	3.8e-87
WP_036161043.1|3976103_3976787_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A8WFE5	Clostridium_phage	47.9	4.9e-41
WP_012293474.1|3976779_3978702_-	hypothetical protein	NA	A0A0A8WJT6	Clostridium_phage	23.8	3.7e-17
WP_008174525.1|3978916_3979081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012293473.1|3979110_3979545_-	hypothetical protein	NA	X5JAB6	Clostridium_phage	45.9	5.7e-27
WP_031419168.1|3979605_3980094_-|tail	phage tail tube protein	tail	A0A0A8WJ62	Clostridium_phage	58.4	4.3e-47
WP_012293471.1|3980136_3981459_-	hypothetical protein	NA	X5JAJ1	Clostridium_phage	51.6	2.5e-126
WP_139015320.1|3981460_3981673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012293469.1|3981644_3982103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012293468.1|3982899_3983232_-	hypothetical protein	NA	A0A290FZR5	Caldibacillus_phage	33.9	5.2e-12
WP_012293467.1|3983510_3984539_-	DnaD domain protein	NA	A6M985	Geobacillus_virus	46.8	1.8e-50
WP_099805129.1|3984865_3985135_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012293465.1|3985319_3985676_+	helix-turn-helix domain-containing protein	NA	S5MUA5	Brevibacillus_phage	36.6	2.0e-06
WP_139015319.1|3985750_3986293_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	39.6	1.0e-28
