The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013234	Collimonas pratensis strain Ter91 chromosome, complete genome	5730025	974373	981893	5730025		Enterobacteria_phage(50.0%)	6	NA	NA
WP_061937436.1|974373_975414_-	GDP-mannose 4,6-dehydratase	NA	M1HKK4	Acanthocystis_turfacea_Chlorella_virus	53.9	4.9e-101
WP_061937439.1|977320_978403_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.1	1.6e-78
WP_061937442.1|978399_979302_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	63.8	4.4e-98
WP_061937445.1|979304_979850_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.7	3.2e-51
WP_150119618.1|979741_980728_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	30.6	3.2e-25
WP_082792602.1|980942_981893_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A223FNK3	NY_014_poxvirus	29.9	1.2e-08
>prophage 2
NZ_CP013234	Collimonas pratensis strain Ter91 chromosome, complete genome	5730025	1242391	1249958	5730025	protease	Phage_21(16.67%)	7	NA	NA
WP_061938073.1|1242391_1243645_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	6.8e-12
WP_009665919.1|1243809_1244013_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	1.4e-23
WP_061938076.1|1244340_1244649_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.1e-11
WP_061938080.1|1244645_1246946_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.5	5.5e-169
WP_167595131.1|1247037_1248126_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_061938086.1|1248137_1248587_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	63.9	5.5e-49
WP_061938089.1|1248752_1249958_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.0	3.1e-38
>prophage 3
NZ_CP013234	Collimonas pratensis strain Ter91 chromosome, complete genome	5730025	2500470	2507185	5730025		uncultured_Mediterranean_phage(33.33%)	7	NA	NA
WP_061940275.1|2500470_2501208_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	55.4	5.4e-70
WP_061940277.1|2501204_2502098_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.4	2.8e-36
WP_061940279.1|2502193_2503189_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_061946134.1|2503257_2504229_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	33.9	4.4e-35
WP_061940281.1|2504351_2505701_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	24.9	1.0e-26
WP_061940283.1|2505784_2506480_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	37.1	1.9e-24
WP_061940285.1|2506774_2507185_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.1	1.1e-19
>prophage 4
NZ_CP013234	Collimonas pratensis strain Ter91 chromosome, complete genome	5730025	3047743	3099773	5730025	integrase,transposase	Stx2-converting_phage(25.0%)	39	3050926:3050984	3083987:3084045
WP_150119692.1|3047743_3048127_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_061941207.1|3048123_3048471_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	75.7	7.0e-44
WP_061941209.1|3048500_3050060_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	55.1	5.2e-155
WP_061941211.1|3050115_3050673_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
3050926:3050984	attL	AGACTTAAAATCTCTCGCTCGTAAGGGTGTGCCGGTTCAAGTCCGGCCTCGGGCACCAA	NA	NA	NA	NA
WP_150119693.1|3051213_3051633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061941213.1|3051766_3052174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061941215.1|3052191_3053424_-	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_061941217.1|3053420_3053822_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_167595169.1|3053878_3054889_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_061941221.1|3054942_3057666_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_061941223.1|3057724_3058468_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_099047200.1|3058619_3059177_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_082792834.1|3060419_3061442_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082792835.1|3061839_3065364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061941231.1|3065411_3066254_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_150119695.1|3066391_3066751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061941233.1|3066984_3067503_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	38.8	6.9e-11
WP_082793486.1|3067499_3068069_-	glycoside hydrolase family 19 protein	NA	F1C5D2	Cronobacter_phage	55.2	5.9e-40
WP_150119696.1|3068152_3068419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061941238.1|3068402_3068762_-	hypothetical protein	NA	Q6J1Q7	Burkholderia_virus	51.8	1.6e-22
WP_082793487.1|3068809_3069040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061941241.1|3070547_3070835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061941243.1|3071158_3074224_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_061941244.1|3074390_3075665_-	thioredoxin	NA	NA	NA	NA	NA
WP_150119697.1|3075682_3076177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150119698.1|3076222_3076477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150119699.1|3077078_3077555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167595119.1|3077659_3077893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082792837.1|3077867_3078086_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_061941248.1|3078271_3079516_+	MFS transporter	NA	S4TR35	Salmonella_phage	21.7	6.3e-18
WP_061941253.1|3080097_3080676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061946224.1|3080685_3080892_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061941255.1|3081286_3082240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167595170.1|3082254_3082893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099047201.1|3083417_3083864_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	41.8	2.2e-18
WP_061941261.1|3084600_3092946_-	hypothetical protein	NA	NA	NA	NA	NA
3083987:3084045	attR	AGACTTAAAATCTCTCGCTCGTAAGGGTGTGCCGGTTCAAGTCCGGCCTCGGGCACCAA	NA	NA	NA	NA
WP_150119700.1|3093530_3098030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150119701.1|3098059_3098242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099047202.1|3098607_3099773_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.6	1.1e-72
>prophage 5
NZ_CP013234	Collimonas pratensis strain Ter91 chromosome, complete genome	5730025	3550967	3593023	5730025	integrase,transposase	Stx2-converting_phage(33.33%)	35	3545794:3545808	3585012:3585026
3545794:3545808	attL	CCGCCAGGTACAGCC	NA	NA	NA	NA
WP_150119692.1|3550967_3551351_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_061941207.1|3551347_3551695_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	75.7	7.0e-44
WP_061941209.1|3551724_3553284_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	55.1	5.2e-155
WP_061941211.1|3553339_3553897_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_061941920.1|3554363_3554705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061941921.1|3554786_3555221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082792892.1|3555499_3557116_+|integrase	tyrosine-type recombinase/integrase	integrase	Q774Z5	Bordetella_phage	35.7	1.7e-55
WP_099047303.1|3557119_3557878_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_082792896.1|3558017_3564740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150119722.1|3564787_3564988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150119723.1|3565151_3565910_-	hypothetical protein	NA	A0A1V0SKV6	Klosneuvirus	31.1	6.1e-24
WP_082792898.1|3565949_3566228_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_061941931.1|3566262_3566805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082792900.1|3566801_3568505_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4JIA8	uncultured_Caudovirales_phage	23.3	1.5e-17
WP_061946317.1|3571647_3571965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082792902.1|3572072_3573140_+	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_061946319.1|3573375_3573858_-	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_150119724.1|3574182_3574578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061941941.1|3574918_3575155_-	helix-turn-helix transcriptional regulator	NA	A0A2K9V490	Faecalibacterium_phage	41.7	2.7e-07
WP_150119725.1|3575155_3575710_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_150119726.1|3576347_3580043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061941947.1|3580056_3580818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061941948.1|3580995_3581739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061941950.1|3581748_3581973_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_061941952.1|3582759_3583104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061941954.1|3583201_3584098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061941956.1|3584119_3584386_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_167595182.1|3584658_3585882_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
3585012:3585026	attR	CCGCCAGGTACAGCC	NA	NA	NA	NA
WP_061941958.1|3586010_3586904_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061941960.1|3587266_3587509_-	Atu4866 domain-containing protein	NA	NA	NA	NA	NA
WP_099047211.1|3588632_3589127_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_061945813.1|3589309_3590746_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_061941962.1|3590942_3591485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167595183.1|3591694_3591853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099047175.1|3591935_3593023_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP013234	Collimonas pratensis strain Ter91 chromosome, complete genome	5730025	3950762	3971713	5730025	integrase,plate	Synechococcus_phage(100.0%)	21	3936238:3936252	3956810:3956824
3936238:3936252	attL	GGTGGCGCGCATGGC	NA	NA	NA	NA
WP_150119743.1|3950762_3952463_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_082792965.1|3952496_3953675_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_014005219.1|3954127_3954364_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_009667251.1|3954386_3954554_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_099047220.1|3954760_3955957_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_061942465.1|3956088_3957459_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
3956810:3956824	attR	GCCATGCGCGCCACC	NA	NA	NA	NA
WP_061942467.1|3957576_3958830_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_061942469.1|3958983_3959607_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.1	1.1e-20
WP_061942471.1|3959655_3960054_-	barstar family protein	NA	NA	NA	NA	NA
WP_061946369.1|3960114_3960477_-	ribonuclease	NA	NA	NA	NA	NA
WP_061942473.1|3960653_3961862_-	Patatin	NA	NA	NA	NA	NA
WP_061942475.1|3962003_3962789_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_061942477.1|3962785_3964132_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_082792968.1|3964217_3964823_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_061942481.1|3965088_3965676_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_061942483.1|3965745_3966255_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_061942485.1|3966256_3967744_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_061942487.1|3967768_3968260_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_061942490.1|3968327_3968819_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_061942492.1|3968822_3970667_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_061942494.1|3970630_3971713_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 7
NZ_CP013234	Collimonas pratensis strain Ter91 chromosome, complete genome	5730025	4138588	4198542	5730025	integrase,transposase	Burkholderia_phage(25.0%)	50	4161349:4161365	4204356:4204372
WP_082792986.1|4138588_4139059_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_061942709.1|4139514_4140384_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_061942711.1|4140442_4141333_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_061942713.1|4141329_4142073_-	metal ABC transporter ATP-binding protein	NA	M1HY76	Paramecium_bursaria_Chlorella_virus	26.4	1.9e-06
WP_167595120.1|4142069_4142228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061942715.1|4142236_4143469_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_061942717.1|4143794_4144925_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_167595192.1|4145480_4146338_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_061942725.1|4148040_4148286_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_061942727.1|4148458_4150297_+	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_061942729.1|4150293_4150593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061946396.1|4151596_4152562_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_082792990.1|4152916_4154254_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_082792992.1|4154430_4155360_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_061942731.1|4155356_4156184_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_061946402.1|4156192_4156909_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_061942733.1|4156978_4158124_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	30.2	1.5e-21
WP_061942735.1|4158212_4159613_+	mannitol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_061942737.1|4159727_4161218_+	xylulokinase	NA	NA	NA	NA	NA
4161349:4161365	attL	TCCTCTCTCCGGCACCA	NA	NA	NA	NA
WP_061942739.1|4161563_4162559_+|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	47.1	2.7e-72
WP_061942741.1|4162555_4162822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061942743.1|4162894_4165567_-	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	54.4	3.4e-271
WP_082792994.1|4165902_4166145_-	ogr/Delta-like zinc finger family protein	NA	K4PAZ0	Burkholderia_phage	47.9	2.0e-13
WP_061942745.1|4166314_4166599_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_061942747.1|4166797_4167169_+	helix-turn-helix transcriptional regulator	NA	K4NXA8	Burkholderia_phage	60.2	4.1e-26
WP_061942749.1|4167489_4168026_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	26.1	2.2e-12
WP_061942751.1|4168257_4168785_-	response regulator	NA	W8CYM9	Bacillus_phage	37.8	3.3e-13
WP_061942753.1|4168781_4170686_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	33.2	2.9e-22
WP_061538637.1|4170682_4171456_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061942755.1|4171613_4172111_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_061942757.1|4172826_4173207_+	VOC family protein	NA	NA	NA	NA	NA
WP_061942759.1|4173236_4174715_-	hypothetical protein	NA	R9TRQ8	Vibrio_phage	35.2	2.6e-31
WP_099047175.1|4174740_4175828_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_061942761.1|4175868_4176261_-	PAAR domain-containing protein	NA	R4JMI1	Burkholderia_phage	44.4	2.0e-18
WP_061942763.1|4176915_4178055_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_150119744.1|4178701_4180657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061942770.1|4183156_4184335_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.0	1.5e-13
WP_061945813.1|4184931_4186368_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_150119745.1|4187043_4187430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061942773.1|4187498_4187873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061942775.1|4188132_4188585_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_061942777.1|4189027_4189429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061946403.1|4189415_4189871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061942779.1|4189945_4192213_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_150119746.1|4192450_4192759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061942782.1|4193295_4194150_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061935832.1|4194428_4195859_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_061942783.1|4196046_4196466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061942785.1|4196481_4197075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099047310.1|4197455_4198542_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
4204356:4204372	attR	TCCTCTCTCCGGCACCA	NA	NA	NA	NA
>prophage 8
NZ_CP013234	Collimonas pratensis strain Ter91 chromosome, complete genome	5730025	4303722	4413294	5730025	capsid,holin,terminase,head,tRNA,portal,integrase,plate,tail	Burkholderia_phage(36.17%)	109	4376973:4376994	4400246:4400267
WP_061942935.1|4303722_4305318_-|holin	choline dehydrogenase	holin	A0A1V0S9J5	Catovirus	32.1	5.3e-62
WP_061942937.1|4305470_4305695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061942939.1|4305871_4306183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061942940.1|4306333_4306990_-	Pr6Pr family membrane protein	NA	NA	NA	NA	NA
WP_061942941.1|4306998_4307622_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.4	5.9e-25
WP_061946420.1|4307660_4308746_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2I2L4R9	Orpheovirus	37.0	2.8e-46
WP_061942943.1|4309469_4310390_-	PilW family protein	NA	NA	NA	NA	NA
WP_061942944.1|4310383_4310926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061942946.1|4311021_4311489_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_061942947.1|4311704_4312952_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	50.3	4.3e-91
WP_082793018.1|4313300_4315652_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_061942949.1|4315938_4316685_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_061942951.1|4316772_4317231_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_061942953.1|4317454_4318156_+	protein TolQ	NA	NA	NA	NA	NA
WP_061942954.1|4318155_4318587_+	ExbD/TolR family protein	NA	NA	NA	NA	NA
WP_061942956.1|4318597_4319533_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_061942958.1|4319536_4320820_+	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_061942959.1|4320879_4321401_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_099047223.1|4321400_4322150_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_082793020.1|4322450_4322723_-	fucose-binding lectin protein	NA	NA	NA	NA	NA
WP_061942963.1|4323201_4323903_+	pirin family protein	NA	NA	NA	NA	NA
WP_061942965.1|4324065_4324998_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061942967.1|4325040_4325964_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_061942969.1|4326042_4326750_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_061946429.1|4326772_4328620_-	amidohydrolase	NA	NA	NA	NA	NA
WP_061942971.1|4328862_4330332_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	34.9	1.9e-13
WP_061942973.1|4331637_4332942_-	cytochrome c	NA	NA	NA	NA	NA
WP_082793023.1|4332953_4333712_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_061942976.1|4333823_4334015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061942978.1|4334179_4334605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061942980.1|4334803_4336102_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_061942982.1|4336442_4336883_+	universal stress protein	NA	NA	NA	NA	NA
WP_061942984.1|4336940_4339061_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_061942986.1|4339166_4339595_-	response regulator	NA	NA	NA	NA	NA
WP_061942987.1|4339727_4340360_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_061942989.1|4340572_4341124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061942991.1|4341382_4342996_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_061942993.1|4343048_4343711_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_061942995.1|4343721_4344417_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_061942997.1|4344465_4345656_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_061942999.1|4345970_4346444_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_061943001.1|4346596_4347082_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2I2L4Y7	Orpheovirus	35.0	1.4e-13
WP_061943003.1|4347237_4348350_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	34.2	1.2e-47
WP_061946431.1|4348592_4349606_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_061943005.1|4349717_4350749_+|integrase	site-specific integrase	integrase	A0A248XD46	Klebsiella_phage	40.1	2.1e-64
WP_061943008.1|4350760_4350967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061943011.1|4351689_4352277_+	PAAR domain-containing protein	NA	R4JMI1	Burkholderia_phage	41.9	4.2e-33
WP_061943013.1|4352286_4352928_+	hypothetical protein	NA	R4JJZ3	Burkholderia_phage	54.2	8.7e-56
WP_082793507.1|4354005_4355190_+	methyltransferase	NA	NA	NA	NA	NA
WP_061943017.1|4355189_4357436_+	sensor histidine kinase	NA	A0A1B5FPD5	Escherichia_phage	31.3	9.0e-07
WP_150119753.1|4357438_4358794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061943021.1|4359101_4359311_-	DUF2116 family Zn-ribbon domain-containing protein	NA	A0A2I7R756	Vibrio_phage	40.3	5.4e-07
WP_061943023.1|4359307_4360360_-|portal	phage portal protein	portal	A4JWV0	Burkholderia_virus	65.1	1.7e-133
WP_082793026.1|4360356_4362192_-|terminase	terminase ATPase subunit family protein	terminase	E5FFI8	Burkholderia_phage	65.9	9.9e-230
WP_061943025.1|4362329_4363148_+|capsid	GPO family capsid scaffolding protein	capsid	E5FFI7	Burkholderia_phage	50.4	4.6e-62
WP_061943027.1|4363207_4364215_+|capsid	phage major capsid protein, P2 family	capsid	A4JWP9	Burkholderia_virus	64.3	4.2e-121
WP_061943029.1|4364216_4364930_+|integrase	integrase	integrase	E5FFI5	Burkholderia_phage	44.8	5.3e-38
WP_061943031.1|4365026_4365518_+|head	head completion/stabilization protein	head	A0A1S5NNA6	Burkholderia_phage	48.5	1.6e-33
WP_061943032.1|4365517_4365727_+|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	62.3	2.0e-17
WP_061943034.1|4365741_4366098_+	hypothetical protein	NA	E5FFI2	Burkholderia_phage	62.3	2.9e-29
WP_061943036.1|4366090_4366360_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_061943039.1|4366356_4366821_+	hypothetical protein	NA	C7BGD8	Burkholderia_phage	58.1	1.1e-36
WP_061943041.1|4366811_4367234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061946435.1|4367332_4367821_+|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	46.3	1.3e-30
WP_061943043.1|4367817_4368285_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	57.9	3.5e-38
WP_167595194.1|4368288_4368777_-	YcxB family protein	NA	NA	NA	NA	NA
WP_061943047.1|4368837_4369605_-	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	63.3	9.6e-94
WP_082793029.1|4369576_4369789_-	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	75.0	3.5e-14
WP_061943050.1|4370045_4370711_+|plate	phage baseplate assembly protein V	plate	E5E3V6	Burkholderia_phage	36.7	7.9e-28
WP_061943051.1|4370710_4371046_+	oxidoreductase	NA	Q9ZXK9	Pseudomonas_virus	54.0	6.0e-24
WP_061943053.1|4371042_4371933_+|plate	baseplate assembly protein	plate	R4JDM0	Burkholderia_phage	54.0	6.6e-78
WP_167595235.1|4371944_4372490_+|tail	phage tail protein I	tail	E5FFH2	Burkholderia_phage	54.5	4.2e-51
WP_061943057.1|4372496_4374605_+	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	43.6	3.2e-30
WP_061943059.1|4374604_4375192_+	hypothetical protein	NA	A0A2H4J9Z7	uncultured_Caudovirales_phage	36.6	4.3e-09
WP_061943061.1|4375219_4376392_+|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	70.6	8.2e-161
WP_061943063.1|4376419_4376929_+|tail	phage major tail tube protein	tail	E5E3U9	Burkholderia_phage	58.6	9.3e-53
4376973:4376994	attL	TTAGGACCACACCATGAAAAAC	NA	NA	NA	NA
WP_061943065.1|4376985_4377309_+|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	57.7	3.2e-22
WP_082793033.1|4377317_4377434_+|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	67.6	3.9e-07
WP_061943067.1|4377446_4380167_+	hypothetical protein	NA	A4PE52	Ralstonia_virus	50.0	2.1e-220
WP_061943069.1|4380178_4380706_+|tail	phage tail protein	tail	A0A2H4JG54	uncultured_Caudovirales_phage	57.1	3.3e-37
WP_061943070.1|4380705_4381968_+	phage late control D family protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	44.7	9.9e-88
WP_061943072.1|4382214_4382643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167595195.1|4383516_4384320_-	DUF91 domain-containing protein	NA	NA	NA	NA	NA
WP_167595196.1|4384961_4385441_-	helix-turn-helix domain-containing protein	NA	K4NXA8	Burkholderia_phage	45.1	5.0e-24
WP_150119755.1|4385513_4385711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082793037.1|4385722_4385974_+	ogr/Delta-like zinc finger family protein	NA	K4PAZ0	Burkholderia_phage	48.1	1.4e-14
WP_150119756.1|4386104_4386323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061943082.1|4386430_4386769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061943084.1|4386765_4388733_+	replication endonuclease	NA	A4JWW0	Burkholderia_virus	36.0	5.9e-79
WP_061943086.1|4388729_4388918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061943089.1|4388910_4389198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099047224.1|4389188_4390121_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	56.3	3.0e-97
WP_082793509.1|4390123_4390360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150119757.1|4390431_4391055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099047312.1|4391512_4392403_+|integrase	site-specific integrase	integrase	A0A2D1GMX8	Marinobacter_phage	34.4	1.5e-45
WP_150119758.1|4392357_4392921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061943096.1|4392930_4393161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061942182.1|4394168_4395626_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	54.9	2.2e-147
WP_150119759.1|4396317_4397307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061943021.1|4398242_4398452_-	DUF2116 family Zn-ribbon domain-containing protein	NA	A0A2I7R756	Vibrio_phage	40.3	5.4e-07
WP_082793511.1|4398448_4400185_-|portal	phage portal protein	portal	E5E3X1	Burkholderia_phage	69.1	1.1e-132
WP_061943102.1|4400245_4400581_-	hypothetical protein	NA	NA	NA	NA	NA
4400246:4400267	attR	TTAGGACCACACCATGAAAAAC	NA	NA	NA	NA
WP_150119760.1|4400539_4401577_+	hypothetical protein	NA	A4PE52	Ralstonia_virus	58.4	5.4e-108
WP_082793042.1|4402739_4406045_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_061943106.1|4406610_4407174_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_061943108.1|4407279_4408371_-	peptidase	NA	NA	NA	NA	NA
WP_061943110.1|4408662_4410009_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_061943112.1|4410236_4412072_-	translational GTPase TypA	NA	NA	NA	NA	NA
WP_061943114.1|4412340_4413294_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
