The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014700	Bacillus amyloliquefaciens strain S499, complete genome	3927922	66265	76156	3927922		Synechococcus_phage(50.0%)	9	NA	NA
WP_007408896.1|66265_67558_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
WP_015388592.1|67633_68353_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.7	3.4e-48
WP_003155758.1|68352_68607_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_015388591.1|68603_69287_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_015388590.1|69270_71499_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.5	3.2e-158
WP_015388589.1|71474_72905_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	1.6e-54
WP_015388588.1|72996_74037_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.1	1.4e-63
WP_003155752.1|74033_74621_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.3	1.0e-26
WP_015388587.1|74617_76156_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	5.1e-78
>prophage 2
NZ_CP014700	Bacillus amyloliquefaciens strain S499, complete genome	3927922	583140	674298	3927922	integrase,capsid,portal,head,terminase,holin,protease,tail,tRNA	Bacillus_phage(46.94%)	99	616477:616492	632718:632733
WP_007408194.1|583140_583584_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_015387900.1|583610_585173_-	SH3 domain-containing protein	NA	E5DV68	Deep-sea_thermophilic_phage	33.3	1.5e-13
WP_003152726.1|585830_587105_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015387901.1|587119_588898_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	29.1	8.7e-13
WP_003152728.1|589224_589989_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A291ATS8	Pandoravirus	32.5	4.1e-20
WP_015387902.1|590064_591333_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	52.3	3.4e-112
WP_003152730.1|591527_591944_+	cysteine metabolism transcriptional regulator CymR	NA	NA	NA	NA	NA
WP_003152731.1|591962_593102_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_015387903.1|593138_594254_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_088005508.1|594341_594962_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_014305491.1|594980_597359_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.7	5.8e-81
WP_003152735.1|597477_597936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003152738.1|597948_598140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003152741.1|598161_598293_+	DUF3918 domain-containing protein	NA	NA	NA	NA	NA
WP_015387904.1|598328_598985_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003152744.1|599002_599653_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003152745.1|599709_600537_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003152746.1|600557_601286_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	3.3e-35
WP_015387905.1|601505_602567_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003152748.1|602898_605535_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	34.1	3.1e-67
WP_003152749.1|605619_605886_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_003152750.1|605894_606311_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_003152751.1|606323_606605_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_014305487.1|606715_607807_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_015387906.1|607958_608612_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_003152757.1|608618_609548_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_014305485.1|609565_610834_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.2	7.3e-38
WP_014418513.1|610840_611473_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.2	4.1e-34
WP_015387907.1|611537_612698_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	36.6	1.3e-65
WP_014418511.1|613004_614186_+	helix-turn-helix transcriptional regulator	NA	A0A288WGA2	Bacillus_phage	25.6	1.3e-09
WP_015387909.1|614556_614946_-	helix-turn-helix transcriptional regulator	NA	A0A0U4B088	Bacillus_phage	30.6	2.2e-06
WP_152514780.1|615106_615307_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015387911.1|615347_615665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015387912.1|615678_616551_+	DNA damage-inducible protein DnaD	NA	A0A0U3TZZ4	Bacillus_phage	50.2	6.5e-62
616477:616492	attL	AATGAAGGATTTTACA	NA	NA	NA	NA
WP_031306578.1|616534_617368_+	DNA replication protein	NA	Q2I8C8	Bacillus_phage	34.4	3.5e-33
WP_015387916.1|617683_618232_+	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	3.5e-05
WP_015387918.1|618339_618480_+	BH0509 family protein	NA	NA	NA	NA	NA
WP_014721584.1|618727_618931_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	56.9	9.8e-14
WP_015387921.1|619451_619682_+	hypothetical protein	NA	J9PL10	Bacillus_phage	42.9	3.0e-11
WP_015387922.1|619678_620080_+	hypothetical protein	NA	X2JNJ3	Bacillus_phage	45.6	1.3e-28
WP_015387923.1|620092_620350_+	hypothetical protein	NA	F8WQ54	Bacillus_phage	42.3	9.6e-06
WP_015387924.1|620354_621731_+	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	48.9	3.4e-142
WP_015387925.1|621744_622569_+	DNA adenine methylase	NA	Q8W5X3	Listeria_phage	48.4	1.1e-63
WP_015387927.1|622678_623002_+	hypothetical protein	NA	M5ABU9	Bacillus_phage	33.7	7.8e-05
WP_015387928.1|622998_623598_+	hypothetical protein	NA	A0A1L2JY27	Aeribacillus_phage	39.0	1.2e-27
WP_015387930.1|624096_624531_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	69.3	2.0e-48
WP_015387932.1|624778_625291_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J6J3	uncultured_Caudovirales_phage	38.8	8.5e-30
WP_015387933.1|625302_625755_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	56.6	2.6e-38
WP_014418494.1|625751_626294_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	60.0	1.1e-54
WP_152514783.1|626493_626820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015387934.1|626854_627589_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_015387935.1|627723_628005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015387936.1|628001_628316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015387937.1|628363_628732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015387938.1|628721_629087_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	54.2	7.9e-30
WP_015387939.1|629314_629830_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	44.6	1.7e-33
WP_014305147.1|629826_631536_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.6	2.1e-205
WP_015387940.1|631724_633005_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.3	3.4e-152
632718:632733	attR	AATGAAGGATTTTACA	NA	NA	NA	NA
WP_015387941.1|632967_633594_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	79.1	1.5e-84
WP_015387942.1|633631_634924_+|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	47.6	2.4e-89
WP_014305142.1|634951_635350_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	44.5	4.8e-12
WP_014305141.1|635367_635670_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	40.5	2.6e-10
WP_014418480.1|635659_635977_+|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	1.1e-11
WP_015387943.1|635973_636372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015387944.1|636368_636752_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_015387945.1|636766_637381_+|tail	tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	33.9	8.4e-24
WP_014305136.1|637439_637808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015387946.1|638013_642501_+|tail	phage tail tape measure protein	tail	A0A1Q1PVX7	Staphylococcus_phage	42.5	8.5e-65
WP_015387947.1|642494_643334_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	57.6	3.1e-93
WP_015387948.1|643348_645052_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	56.3	1.5e-179
WP_015387949.1|645102_647667_+	peptidase G2	NA	D6R401	Bacillus_phage	57.4	9.1e-290
WP_015387950.1|647679_648957_+	DUF2479 domain-containing protein	NA	D6R402	Bacillus_phage	81.9	2.1e-149
WP_014305128.1|648953_649316_+	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	90.8	7.1e-55
WP_015387951.1|649312_649501_+	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	100.0	3.7e-31
WP_015387952.1|649552_649975_+|holin	holin family protein	holin	D6R405	Bacillus_phage	98.5	3.3e-64
WP_015387953.1|650023_651037_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	96.7	4.9e-186
WP_015387954.1|651092_651287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015387955.1|651304_651814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015387956.1|652069_652729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003152766.1|653342_653816_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_015387957.1|653868_655623_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_015387958.1|655686_656403_+	YrrS family protein	NA	NA	NA	NA	NA
WP_015387959.1|656442_656646_-	DUF2536 family protein	NA	NA	NA	NA	NA
WP_015387960.1|656829_657471_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003152774.1|657491_658187_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_015387961.1|658234_659158_+	cysteine synthase family protein	NA	A0A1W6JHY1	Lactococcus_phage	43.4	8.4e-60
WP_003152778.1|659159_660302_+	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	A0A0B5JD48	Pandoravirus	29.2	2.8e-20
WP_003152779.1|660385_660616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015387962.1|660655_661147_-	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_094247929.1|661164_664107_-	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_003152783.1|664413_664782_+	DUF2294 domain-containing protein	NA	NA	NA	NA	NA
WP_007408225.1|665045_665846_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_003152787.1|666234_666375_+	YrzI family small protein	NA	NA	NA	NA	NA
WP_015387964.1|666876_667416_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003152789.1|667625_668192_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015387965.1|668219_671381_+	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	36.7	6.0e-73
WP_015387966.1|671530_672739_-	MFS transporter	NA	NA	NA	NA	NA
WP_003152795.1|672863_673748_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015387967.1|673815_674298_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP014700	Bacillus amyloliquefaciens strain S499, complete genome	3927922	976664	982917	3927922		Staphylococcus_phage(66.67%)	9	NA	NA
WP_015388054.1|976664_977780_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.9	1.2e-55
WP_003153370.1|977760_978408_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	1.5e-39
WP_003153371.1|978422_979619_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	2.1e-116
WP_003153372.1|979651_980116_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_003153373.1|980232_980607_+	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_012117889.1|980672_981194_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153376.1|981281_981371_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003153377.1|981578_982334_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.3	6.5e-10
WP_003153378.1|982323_982917_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
>prophage 4
NZ_CP014700	Bacillus amyloliquefaciens strain S499, complete genome	3927922	1402840	1409055	3927922		Bacillus_phage(50.0%)	7	NA	NA
WP_015417523.1|1402840_1403809_-	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
WP_015388200.1|1403857_1404082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015388201.1|1404115_1404874_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.4	1.1e-52
WP_015388202.1|1404924_1405545_-	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.4	2.7e-46
WP_003154059.1|1405593_1406583_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.6	8.7e-156
WP_003154060.1|1406600_1408703_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.0	0.0e+00
WP_014305044.1|1408662_1409055_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	6.5e-30
>prophage 5
NZ_CP014700	Bacillus amyloliquefaciens strain S499, complete genome	3927922	1958581	1990319	3927922	portal,plate,terminase,holin,tail	Bacillus_phage(33.33%)	42	NA	NA
WP_014304858.1|1958581_1959460_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.5	2.8e-81
WP_003154813.1|1959473_1959737_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_003154815.1|1959750_1960014_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_014304857.1|1960065_1960827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154819.1|1960883_1961081_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	4.3e-14
WP_014304856.1|1961086_1961458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014304855.1|1961470_1963093_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	39.3	5.3e-41
WP_014304854.1|1963095_1963368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154823.1|1963364_1963943_-	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	31.0	2.4e-12
WP_015388353.1|1963926_1964973_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.8	2.3e-69
WP_003154825.1|1964965_1965391_-	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	1.5e-11
WP_003154827.1|1965494_1965761_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	37.5	3.4e-06
WP_015388354.1|1965760_1966738_-	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	30.9	2.2e-34
WP_007610816.1|1966751_1967411_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	45.3	1.8e-08
WP_015388355.1|1967403_1972368_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	46.6	3.2e-41
WP_015239684.1|1972355_1972508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154836.1|1972549_1972996_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_003154837.1|1973072_1973516_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_015388356.1|1973517_1974915_-|portal	phage portal protein	portal	A0A0A7RTT5	Clostridium_phage	40.4	9.0e-82
WP_003154839.1|1974914_1975124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014304848.1|1975120_1975567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014304847.1|1975563_1976067_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_003154844.1|1976063_1976420_-	DUF3599 family protein	NA	NA	NA	NA	NA
WP_015388357.1|1976416_1976800_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_007407274.1|1976816_1977752_-|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
WP_015388358.1|1977778_1978624_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	57.1	2.2e-54
WP_088005490.1|1978643_1980035_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.6	3.0e-138
WP_003154853.1|1980083_1981382_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.6	8.5e-151
WP_003154855.1|1981378_1982176_-|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	50.6	9.4e-60
WP_003154857.1|1982288_1982801_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	43.9	5.0e-22
WP_003154859.1|1982913_1983117_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	5.4e-12
WP_003154861.1|1983106_1983448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154865.1|1983712_1984513_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.1	3.6e-59
WP_003154867.1|1984412_1985240_-|portal	phage portal protein	portal	S6BFM4	Thermus_phage	27.9	6.4e-19
WP_003154869.1|1985229_1985409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154871.1|1985600_1985939_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_003154873.1|1986087_1986678_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_003154876.1|1986832_1987438_-	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	46.8	7.4e-41
WP_003154878.1|1987547_1987925_+	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	40.6	1.1e-15
WP_003154880.1|1987962_1988916_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
WP_003154881.1|1989058_1989193_-	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_150974872.1|1989182_1990319_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.6	4.9e-94
>prophage 6
NZ_CP014700	Bacillus amyloliquefaciens strain S499, complete genome	3927922	2053001	2104853	3927922	integrase,capsid,portal,head,terminase,coat,holin,tail	uncultured_Caudovirales_phage(38.24%)	70	2048818:2048877	2089925:2090008
2048818:2048877	attL	AAAGTAAAAAACCCTTGCTACGCAAGGGTTTTGGCTATGATTCCGACTGGGCTCGAACCA	NA	NA	NA	NA
WP_015239640.1|2053001_2053424_-|holin	holin	holin	D6R405	Bacillus_phage	89.5	3.8e-60
WP_015388395.1|2053691_2053859_-	XkdX family protein	NA	NA	NA	NA	NA
WP_015388396.1|2053997_2054387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388397.1|2054400_2057784_-	hypothetical protein	NA	Q5YA57	Bacillus_phage	46.1	2.1e-132
WP_015388398.1|2057796_2058561_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_015388399.1|2058557_2063372_-	hypothetical protein	NA	M9NRJ5	Staphylococcus_phage	24.3	4.7e-37
WP_003155844.1|2063376_2063685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003155845.1|2063732_2064239_-	hypothetical protein	NA	I6T7F0	Staphylococcus_virus	33.3	6.7e-11
WP_076983191.1|2064295_2064538_-	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_076983182.1|2064551_2064866_-	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	77.8	4.6e-26
WP_015388401.1|2064807_2065320_-|tail	phage major tail protein, TP901-1 family	tail	Q0PDK9	Bacillus_phage	42.4	1.2e-26
WP_015239630.1|2065333_2065732_-	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	44.6	4.9e-25
WP_007408589.1|2065750_2066167_-	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	54.2	7.4e-32
WP_015388402.1|2066159_2066498_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_015388403.1|2066494_2066794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388404.1|2066802_2067054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388405.1|2067055_2067397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388406.1|2067401_2068319_-|capsid	phage major capsid protein	capsid	A0A2H4JCG0	uncultured_Caudovirales_phage	67.9	2.9e-113
WP_015388407.1|2068334_2068916_-	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	56.3	1.5e-54
WP_015388408.1|2069018_2069945_-|head	head protein	head	A0A1Q1PVS0	Bacillus_phage	51.5	3.9e-81
WP_014304497.1|2069931_2071335_-|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	59.8	1.8e-154
WP_032865737.1|2071340_2072549_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	84.5	1.8e-203
WP_015388410.1|2072535_2073291_-	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	54.2	1.2e-61
WP_015388411.1|2073450_2073663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388412.1|2074039_2074903_-	C1 family peptidase	NA	A0A1V0SLQ7	Klosneuvirus	28.5	3.0e-19
WP_015388413.1|2075013_2075229_-	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	48.6	7.5e-12
WP_015239615.1|2075762_2076278_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	43.2	4.0e-27
WP_152514779.1|2076508_2077261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388416.1|2077431_2078256_-	DNA adenine methylase	NA	Q8W5X3	Listeria_phage	48.4	2.9e-64
WP_015388417.1|2078259_2078517_-	hypothetical protein	NA	F8WQ54	Bacillus_phage	40.0	6.6e-07
WP_015388418.1|2078513_2078798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003155894.1|2078829_2079033_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	3.4e-22
WP_015388419.1|2079323_2079752_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	63.5	7.3e-43
WP_152514781.1|2079986_2080934_-	AAA family ATPase	NA	A0A0K2CPA5	Brevibacillus_phage	50.7	2.0e-56
WP_015388423.1|2080818_2081520_-	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	33.3	1.2e-05
WP_021734186.1|2081717_2082455_-	hypothetical protein	NA	A0A0A7RUC1	Clostridium_phage	44.9	1.5e-51
WP_015388425.1|2082474_2083392_-	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	62.5	1.1e-88
WP_015388426.1|2083388_2083580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388427.1|2083579_2083930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388428.1|2084032_2084236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388429.1|2084232_2084490_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	38.0	3.9e-07
WP_015388430.1|2084486_2085059_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	56.1	2.0e-59
WP_015388431.1|2085116_2085845_-	phage regulatory protein	NA	A0A2H4J4N4	uncultured_Caudovirales_phage	63.3	1.4e-86
WP_007408621.1|2085841_2086036_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015388432.1|2086046_2086271_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J4N8	uncultured_Caudovirales_phage	81.1	7.2e-26
WP_015239592.1|2086429_2086804_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	65.9	1.2e-33
WP_015388433.1|2087025_2088003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015388434.1|2088075_2088597_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	63.9	2.7e-55
WP_015388435.1|2088601_2089831_+|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	49.5	1.2e-106
WP_003154961.1|2090171_2091347_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
2089925:2090008	attR	AAAGTAAAAAACCCTTGCTACGCAAGGGTTTTGGCTATGATTCCGACTGGGCTCGAACCAGCGACCTCTACCCTGTCAAGGTAG	NA	NA	NA	NA
WP_015388436.1|2091339_2092461_-	methionine biosynthesis PLP-dependent protein	NA	NA	NA	NA	NA
WP_015388437.1|2092830_2093553_+	esterase family protein	NA	NA	NA	NA	NA
WP_003154969.1|2093578_2094094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154971.1|2094098_2094530_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003154973.1|2094690_2094924_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014304807.1|2094924_2095662_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.3	5.2e-28
WP_003154977.1|2095654_2096377_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015388438.1|2096417_2097167_-	subclass B1 metallo-beta-lactamase	NA	NA	NA	NA	NA
WP_003154980.1|2097235_2097490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388439.1|2097610_2099896_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	33.2	1.9e-84
WP_003154986.1|2099964_2100219_-	sporulation protein	NA	NA	NA	NA	NA
WP_003154988.1|2100381_2100549_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003154990.1|2100641_2100839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388440.1|2101126_2101483_-	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_003154992.1|2101653_2102040_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154993.1|2102077_2102392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154994.1|2102484_2102985_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154995.1|2103135_2103618_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154997.1|2103763_2104207_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015388441.1|2104265_2104853_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 7
NZ_CP014700	Bacillus amyloliquefaciens strain S499, complete genome	3927922	3591715	3643964	3927922	protease,coat,tRNA	Bacillus_phage(11.11%)	56	NA	NA
WP_003151071.1|3591715_3593386_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003151069.1|3593382_3593811_-	DUF1934 family protein	NA	NA	NA	NA	NA
WP_015387560.1|3594102_3595248_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	42.6	3.6e-76
WP_015387559.1|3595231_3595351_+	phosphatase	NA	NA	NA	NA	NA
WP_003151064.1|3595549_3595753_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003151062.1|3595766_3595970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014306021.1|3596378_3596660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015387558.1|3596703_3597216_+	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_014306022.1|3597220_3597760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003151056.1|3597806_3598025_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003151054.1|3598194_3599067_-	agmatinase	NA	NA	NA	NA	NA
WP_003151052.1|3599126_3599957_-	spermidine synthase	NA	NA	NA	NA	NA
WP_015387557.1|3600156_3602229_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_015387556.1|3602252_3602684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015387555.1|3602827_3603346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003151043.1|3603358_3604018_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003151042.1|3604123_3604312_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_003151040.1|3604349_3604769_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003151037.1|3605159_3606539_+	amino acid permease	NA	NA	NA	NA	NA
WP_003151036.1|3606603_3607104_-	YwgA family protein	NA	NA	NA	NA	NA
WP_003151035.1|3607143_3608445_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.5	1.0e-23
WP_003151034.1|3608605_3608830_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_003151032.1|3609034_3609808_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003151030.1|3610108_3610384_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003151028.1|3610384_3610939_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_015387552.1|3611304_3612168_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_007407666.1|3612214_3613114_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.1e-07
WP_015387551.1|3613229_3614207_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_003151012.1|3614243_3615215_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003151011.1|3615477_3616242_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_003151010.1|3616361_3617141_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_015387550.1|3617157_3618357_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003151007.1|3618369_3619551_-	MFS transporter	NA	NA	NA	NA	NA
WP_015387549.1|3619547_3620966_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_003151003.1|3620983_3621745_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.5	4.4e-22
WP_015387548.1|3621741_3622452_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003150997.1|3622441_3623056_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
WP_015387547.1|3623217_3624456_-	MFS transporter	NA	NA	NA	NA	NA
WP_014306037.1|3624678_3625881_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.3	6.4e-28
WP_015387546.1|3625913_3627332_-	amino acid permease	NA	NA	NA	NA	NA
WP_014306039.1|3627356_3629039_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_014306040.1|3629110_3630658_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015387545.1|3630865_3632152_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_003150988.1|3632337_3632799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015387544.1|3633014_3633470_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015387543.1|3633466_3634315_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	7.0e-37
WP_014306044.1|3634335_3635283_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.9	7.7e-69
WP_015387542.1|3635285_3636023_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	42.7	6.5e-47
WP_015387541.1|3636050_3637055_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014306047.1|3637056_3637800_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014306048.1|3637789_3638911_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015387539.1|3638910_3639774_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003150976.1|3639774_3640944_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_015387538.1|3640965_3642390_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_015387537.1|3642394_3643165_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	26.3	4.4e-06
WP_015387536.1|3643445_3643964_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
