The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012504	Aeromonas veronii strain TH0426 chromosome, complete genome	4923009	499039	592891	4923009	portal,holin,capsid,tRNA,tail,terminase,head,plate,protease,integrase	Aeromonas_virus(71.88%)	93	496235:496253	593349:593367
496235:496253	attL	AGCCGGTCACCATCAAGAC	NA	NA	NA	NA
WP_064335202.1|499039_500305_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	42.3	7.4e-83
WP_064335203.1|500465_501314_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064335204.1|501326_502103_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_064335205.1|502212_503469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064335206.1|503692_504010_+	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_064335207.1|504477_505926_-	catalase	NA	A0A2K9L0T1	Tupanvirus	46.6	1.0e-96
WP_064335208.1|506087_506585_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_064335209.1|506589_507444_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_064335210.1|507540_508128_-	superinfection exclusion B family protein	NA	NA	NA	NA	NA
WP_082182191.1|508492_509479_+	sodium:calcium antiporter	NA	NA	NA	NA	NA
WP_064335212.1|509546_512399_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.0	9.0e-137
WP_064335213.1|512464_512920_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_005336423.1|513095_514604_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	1.7e-49
WP_064335214.1|514776_515889_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_005336421.1|515914_516985_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_064335215.1|517059_517593_-	RDD family protein	NA	NA	NA	NA	NA
WP_064335216.1|518089_518548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064335218.1|519285_519984_-	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_064335219.1|519994_521608_-	hypothetical protein	NA	A5X9J8	Aeromonas_virus	84.9	1.9e-272
WP_064335220.1|521604_522156_-	hypothetical protein	NA	A5X9J7	Aeromonas_virus	74.3	1.1e-64
WP_064335221.1|522152_523034_-	hypothetical protein	NA	A5X9J6	Aeromonas_virus	72.9	1.7e-115
WP_064335222.1|523030_523249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064335223.1|524033_524816_-|tail	phage tail protein	tail	G0ZT38	Aeromonas_phage	77.2	1.2e-54
WP_064335224.1|524800_525493_-	hypothetical protein	NA	A5X9J2	Aeromonas_virus	58.9	1.5e-50
WP_064335225.1|525485_526673_-|plate	baseplate J/gp47 family protein	plate	A5X9J1	Aeromonas_virus	84.2	1.6e-188
WP_017786909.1|526669_526993_-	DUF2590 family protein	NA	A5X9J0	Aeromonas_virus	89.7	3.9e-49
WP_064335226.1|526989_529044_-|tail	phage tail tape measure protein	tail	A5X9I9	Aeromonas_virus	58.7	2.0e-199
WP_043122797.1|529232_529499_-|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	63.4	2.6e-22
WP_064335227.1|529622_530057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064335228.1|530053_530515_-	glycoside hydrolase family 104 protein	NA	G0ZT35	Aeromonas_phage	87.6	1.7e-77
WP_064335229.1|530501_530828_-|holin	phage holin, lambda family	holin	A5X9I3	Aeromonas_virus	59.4	4.0e-25
WP_064335230.1|530851_531061_-	TraR/DksA family transcriptional regulator	NA	A5X9I2	Aeromonas_virus	84.1	1.2e-27
WP_043122804.1|531071_531527_-	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	84.7	1.8e-68
WP_064335231.1|531530_532655_-	DUF2586 family protein	NA	A5X9I0	Aeromonas_virus	86.1	1.0e-184
WP_064335232.1|532680_533196_-|tail	phage tail protein	tail	A5X9H8	Aeromonas_virus	57.6	7.7e-55
WP_034282250.1|533192_533654_-|head	head completion/stabilization protein	head	A5X9H7	Aeromonas_virus	69.3	1.8e-50
WP_017412417.1|533759_534485_-|terminase	terminase	terminase	A5X9H6	Aeromonas_virus	73.6	4.7e-98
WP_017412418.1|534487_535567_-|capsid	phage major capsid protein, P2 family	capsid	A5X9H5	Aeromonas_virus	71.0	1.1e-140
WP_082182193.1|535577_536495_-|capsid	GPO family capsid scaffolding protein	capsid	A5X9H4	Aeromonas_virus	48.5	3.4e-69
WP_082182194.1|536672_538802_+|terminase	terminase	terminase	A5X9H3	Aeromonas_virus	67.4	2.0e-242
WP_082182195.1|538719_539535_+|portal	phage portal protein	portal	A5X9H1	Aeromonas_virus	77.0	2.5e-116
WP_082182196.1|539593_539848_+	ogr/Delta-like zinc finger family protein	NA	A5X9H0	Aeromonas_virus	67.5	1.4e-25
WP_064335235.1|540435_542154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155728456.1|543210_543585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064335237.1|543957_545814_-	replication endonuclease	NA	A5X9G4	Aeromonas_virus	40.7	1.4e-117
WP_064335238.1|545813_546098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064337604.1|546811_547078_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017412429.1|547101_547287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064335239.1|547326_547752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082182197.1|547765_548341_-	phage regulatory CII family protein	NA	A5X9F7	Aeromonas_virus	55.7	2.5e-38
WP_064335240.1|548276_548564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082182327.1|548574_548760_-	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
WP_064335241.1|548878_549529_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	44.6	2.0e-44
WP_064335242.1|549589_550525_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_064335243.1|550568_551171_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_082182198.1|551909_553022_+|integrase	site-specific integrase	integrase	A5X9F3	Aeromonas_virus	80.9	3.5e-161
WP_064335245.1|553409_554624_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	44.2	1.2e-87
WP_155728458.1|554644_555529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174531735.1|555782_556007_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_082182200.1|556128_556329_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_064335247.1|556255_557056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155728460.1|558200_558740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155728462.1|558853_559750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064335249.1|560589_561099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064335250.1|562243_562867_-	PepSY-associated TM helix domain-containing protein	NA	NA	NA	NA	NA
WP_064335251.1|562930_564973_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_064335252.1|565264_566302_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_005336410.1|566525_567437_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_064335253.1|567696_569154_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_064337605.1|569589_570432_-	EamA family transporter	NA	NA	NA	NA	NA
WP_064337606.1|570501_571422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021231817.1|571542_572598_-	porin	NA	NA	NA	NA	NA
WP_005336386.1|572819_573830_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_005336384.1|573961_574213_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_064335254.1|574283_575447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064335255.1|575457_576507_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_064335256.1|576503_577238_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_146045109.1|577234_578164_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_064335258.1|578486_581006_+	class I adenylate cyclase	NA	NA	NA	NA	NA
WP_064335259.1|581070_581724_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_064335260.1|581720_582035_-	iron donor protein CyaY	NA	NA	NA	NA	NA
WP_074045189.1|582108_582285_+	lipoprotein	NA	NA	NA	NA	NA
WP_064335261.1|582317_583568_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_005336371.1|583830_584661_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_005336370.1|584752_585433_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_174531749.1|585479_586403_+	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	32.9	1.1e-14
WP_064335263.1|586435_587146_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_064335264.1|587222_587621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064335265.1|587666_589193_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_064337607.1|589338_589722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064335266.1|589734_590517_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_031227939.1|590908_591454_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_064335267.1|591547_592891_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
593349:593367	attR	GTCTTGATGGTGACCGGCT	NA	NA	NA	NA
>prophage 2
NZ_CP012504	Aeromonas veronii strain TH0426 chromosome, complete genome	4923009	809107	815418	4923009	tRNA	Bacillus_thuringiensis_phage(100.0%)	6	NA	NA
WP_064335369.1|809107_811174_+|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	Q56AQ2	Bacillus_thuringiensis_phage	92.2	1.9e-96
WP_064335370.1|811160_811880_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q56AQ6	Bacillus_thuringiensis_phage	94.6	3.3e-128
WP_064335371.1|812081_813098_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	99.4	5.0e-191
WP_082182208.1|813274_813754_+	hypothetical protein	NA	Q56AR5	Bacillus_thuringiensis_phage	97.4	8.8e-37
WP_064335372.1|813771_814386_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	97.1	3.0e-114
WP_064335373.1|814470_815418_-	YdcF family protein	NA	Q56AS0	Bacillus_thuringiensis_phage	100.0	2.4e-22
>prophage 3
NZ_CP012504	Aeromonas veronii strain TH0426 chromosome, complete genome	4923009	1931081	1939386	4923009	transposase	Bodo_saltans_virus(33.33%)	7	NA	NA
WP_064336001.1|1931081_1932704_+	acyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	25.6	5.1e-28
WP_064336002.1|1932790_1934080_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.0	1.0e-18
WP_064336003.1|1934434_1935970_+	NTPase KAP	NA	R9TRQ8	Vibrio_phage	37.1	1.0e-49
WP_064336004.1|1936020_1937061_-|transposase	IS481-like element ISAs19 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	42.1	2.2e-72
WP_064336005.1|1937208_1937859_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	32.6	2.0e-15
WP_005345639.1|1937851_1938625_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_042030922.1|1938624_1939386_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	A0A2H4UVM0	Bodo_saltans_virus	23.2	1.6e-08
>prophage 4
NZ_CP012504	Aeromonas veronii strain TH0426 chromosome, complete genome	4923009	2290090	2359317	4923009	transposase,protease,integrase	Vibrio_phage(20.0%)	52	2283511:2283526	2314643:2314658
2283511:2283526	attL	CCTGCTGCGGGACGCC	NA	NA	NA	NA
WP_064336202.1|2290090_2291008_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	56.3	4.1e-91
WP_064336203.1|2291384_2292032_-	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_064336204.1|2292028_2293069_-	type I-F CRISPR-associated protein Csy3	NA	NA	NA	NA	NA
WP_146045097.1|2293073_2295170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167555772.1|2295175_2296366_-	TniQ family protein	NA	NA	NA	NA	NA
WP_064336207.1|2296726_2300845_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_064336208.1|2300934_2301219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043826353.1|2301314_2301644_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_043826355.1|2301751_2302759_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_064336209.1|2302758_2304630_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_064336210.1|2304622_2305270_-	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_064336211.1|2305604_2306393_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_064336212.1|2306498_2307935_-	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_064336213.1|2308293_2309073_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_064336214.1|2309125_2310028_-	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_064336215.1|2310079_2311192_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_064336216.1|2311210_2311993_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_064336217.1|2312133_2313291_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_064336218.1|2313596_2314739_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
2314643:2314658	attR	CCTGCTGCGGGACGCC	NA	NA	NA	NA
WP_064336219.1|2314735_2316370_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	52.4	3.3e-19
WP_064336220.1|2316381_2317236_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_064336221.1|2317232_2319203_+	methylcrotonoyl-CoA carboxylase	NA	NA	NA	NA	NA
WP_064336222.1|2319199_2320168_+	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	36.0	8.8e-44
WP_047436889.1|2320170_2320581_+	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_064336223.1|2320617_2321379_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_064336224.1|2321431_2324434_+	DUF748 domain-containing protein	NA	NA	NA	NA	NA
WP_005336948.1|2324658_2325255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064336225.1|2325711_2326755_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_082182247.1|2326751_2328536_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_082182248.1|2329379_2330195_-	zinc-dependent peptidase	NA	NA	NA	NA	NA
WP_064336226.1|2330226_2330664_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_019445254.1|2331012_2332512_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_146045098.1|2334085_2334388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064336227.1|2334482_2335160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064336228.1|2335259_2336426_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_042067783.1|2336680_2336932_-	ogr/Delta-like zinc finger family protein	NA	A5X9H0	Aeromonas_virus	90.4	4.1e-38
WP_064336229.1|2337536_2338343_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_064336230.1|2338511_2340299_+	cyclic nucleotide-binding/CBS domain-containing protein	NA	NA	NA	NA	NA
WP_064336231.1|2340301_2340928_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_005336970.1|2341033_2341345_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_026035062.1|2341356_2343009_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_064336232.1|2343120_2344041_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	56.3	1.2e-90
WP_082182249.1|2344551_2344980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082182250.1|2344976_2345843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082182251.1|2345842_2346367_-	type VI secretion system PAAR protein	NA	A0A1S6L356	Erwinia_phage	45.7	2.6e-05
WP_082182252.1|2346988_2348050_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_064335419.1|2349021_2350065_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_005351341.1|2351133_2352726_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.3	1.9e-59
WP_021230591.1|2352969_2354883_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_005315375.1|2355033_2355306_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	61.8	5.0e-21
WP_005336976.1|2355546_2357901_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	53.5	6.1e-224
WP_005336977.1|2358042_2359317_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.5	2.5e-131
>prophage 5
NZ_CP012504	Aeromonas veronii strain TH0426 chromosome, complete genome	4923009	2609550	2681486	4923009	portal,holin,capsid,tRNA,tail,terminase,head,integrase	Pseudomonas_phage(15.62%)	78	2601195:2601212	2675791:2675808
2601195:2601212	attL	GGGCCGTGCTGCTGGCGG	NA	NA	NA	NA
WP_019445081.1|2609550_2610927_-|tRNA	cysteine--tRNA ligase	tRNA	H2EDD6	Moumouvirus	30.5	5.4e-47
WP_064336343.1|2611139_2611637_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_064336344.1|2611626_2612424_+	DUF4269 domain-containing protein	NA	NA	NA	NA	NA
WP_064336345.1|2612420_2613176_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_005337420.1|2617165_2617342_+	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_064336346.1|2617590_2617839_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_064336347.1|2617904_2619308_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_064336348.1|2619303_2619978_-	transcriptional regulator TctD	NA	NA	NA	NA	NA
WP_064336349.1|2620200_2621187_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_042082375.1|2621198_2621630_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_064336350.1|2621639_2623172_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_082182260.1|2624960_2625839_-	phosphatidylserine/phosphatidylglycerophosphate/ cardiolipin synthase family protein	NA	NA	NA	NA	NA
WP_174531740.1|2625846_2626431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174531741.1|2626488_2628054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064336351.1|2628066_2632269_-	helicase	NA	NA	NA	NA	NA
WP_064336352.1|2632252_2635018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082182261.1|2635014_2636793_-	N-6 DNA methylase	NA	A0A2R2ZGH5	Clostridioides_phage	24.9	2.9e-08
WP_155728497.1|2637002_2637152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146045082.1|2637376_2637883_-|terminase	terminase small subunit protein	terminase	A0A2K8HN72	Pseudomonas_phage	56.6	3.0e-35
WP_064336355.1|2638856_2641121_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	44.2	1.7e-93
WP_064336356.1|2641117_2641450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041980245.1|2641460_2641697_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_064336358.1|2642346_2643660_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	39.8	2.8e-85
WP_064336359.1|2644122_2644407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064336360.1|2644573_2644948_+	helix-turn-helix transcriptional regulator	NA	A0A1I9KF60	Aeromonas_phage	45.9	4.8e-22
WP_064337662.1|2645054_2645312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155728503.1|2646252_2647308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064336362.1|2647770_2651079_-	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	46.6	1.1e-178
WP_064336363.1|2651063_2651477_-	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	55.3	9.9e-37
WP_064336364.1|2651479_2652067_-	hypothetical protein	NA	A0A0M7Q7T5	Escherichia_phage	43.8	1.7e-45
WP_069203132.1|2652063_2652630_-	hypothetical protein	NA	Q7Y3Z8	Yersinia_phage	48.7	3.0e-36
WP_064336366.1|2652673_2654980_-	hypothetical protein	NA	A0A2I7S7J2	Vibrio_phage	38.5	5.6e-28
WP_064336367.1|2654989_2655184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064336368.1|2655198_2655591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064336369.1|2655597_2656044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064336370.1|2656040_2656409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064336371.1|2656405_2656966_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_064336372.1|2656962_2657286_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_167555773.1|2657343_2657856_-	DUF4468 domain-containing protein	NA	NA	NA	NA	NA
WP_064336374.1|2658088_2658406_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	38.7	2.5e-11
WP_064336375.1|2658417_2658870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064336376.1|2658929_2660216_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	64.5	2.6e-144
WP_064336377.1|2660282_2661221_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	53.7	1.7e-84
WP_064336378.1|2661208_2662456_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	62.1	5.3e-150
WP_064336379.1|2662455_2662641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064336380.1|2662634_2664356_-|terminase	terminase large subunit	terminase	M1FN87	Enterobacteria_phage	74.3	1.5e-259
WP_064336381.1|2664359_2664851_-|terminase	phage terminase small subunit P27 family	terminase	A0A2D1GNP3	Pseudomonas_phage	57.1	1.3e-46
WP_082182263.1|2664946_2665300_-	HNH endonuclease	NA	U5P4L6	Shigella_phage	62.8	1.2e-35
WP_064336382.1|2665388_2665931_-	DUF2514 domain-containing protein	NA	A0A059VF51	Pseudomonas_phage	74.4	6.3e-07
WP_064336383.1|2665927_2666446_-	lysozyme	NA	V5YSX1	Pseudomonas_phage	75.4	1.6e-68
WP_064337663.1|2666432_2666756_-|holin	phage holin, lambda family	holin	A5X9I3	Aeromonas_virus	53.5	1.7e-23
WP_064336384.1|2667261_2667453_-	DUF3283 family protein	NA	NA	NA	NA	NA
WP_064336385.1|2667576_2667999_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.7	3.6e-34
WP_064336386.1|2668002_2669277_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	56.6	1.0e-132
WP_069203120.1|2669879_2670224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064336387.1|2670438_2670687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064336388.1|2670731_2671175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064336389.1|2671201_2671744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082182265.1|2671830_2672187_-	DUF1064 domain-containing protein	NA	T1SA23	Salmonella_phage	55.5	1.1e-23
WP_064336390.1|2672183_2673173_-	DUF968 domain-containing protein	NA	R9TRM9	Vibrio_phage	31.8	3.7e-37
WP_064336391.1|2673169_2673433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005346975.1|2673419_2673635_-	DUF3283 family protein	NA	NA	NA	NA	NA
WP_167555774.1|2673606_2673903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064336393.1|2673899_2674490_-	3'-5' exoribonuclease	NA	A0A1I9KF44	Aeromonas_phage	47.6	2.3e-39
WP_082182267.1|2674520_2675342_-	hypothetical protein	NA	A0A1W6JP13	Morganella_phage	47.6	4.4e-28
WP_064336395.1|2675444_2675633_-	DUF4406 domain-containing protein	NA	NA	NA	NA	NA
WP_064336396.1|2675686_2675992_-	hypothetical protein	NA	NA	NA	NA	NA
2675791:2675808	attR	CCGCCAGCAGCACGGCCC	NA	NA	NA	NA
WP_155728506.1|2675984_2676191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064336398.1|2676190_2676418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064336399.1|2676414_2676813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064336400.1|2676809_2677070_-	hypothetical protein	NA	A0A1I9KFB1	Aeromonas_phage	47.5	3.4e-11
WP_064336401.1|2677069_2677729_-	hypothetical protein	NA	A0A1I9KFB0	Aeromonas_phage	71.0	5.0e-83
WP_064336402.1|2677728_2678643_-	replication protein	NA	A0A075B8J2	Enterobacteria_phage	52.0	2.4e-27
WP_064336403.1|2678635_2678839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064336404.1|2678831_2679878_-	Rha family transcriptional regulator	NA	A0A1C9IHV9	Salmonella_phage	48.7	3.5e-54
WP_064337664.1|2679946_2680453_-	phage regulatory CII family protein	NA	NA	NA	NA	NA
WP_167555764.1|2680418_2680685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064336405.1|2680793_2681486_+	hypothetical protein	NA	K7PM82	Enterobacteria_phage	36.8	2.1e-23
>prophage 6
NZ_CP012504	Aeromonas veronii strain TH0426 chromosome, complete genome	4923009	3374317	3404627	4923009	portal,holin,tRNA,tail,plate	Aeromonas_virus(77.78%)	33	NA	NA
WP_080741294.1|3374317_3374857_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_005334106.1|3375410_3375551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064336778.1|3376239_3377847_+	malate synthase A	NA	NA	NA	NA	NA
WP_064336779.1|3377920_3379234_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_005334113.1|3379339_3380083_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_064336780.1|3380143_3381163_-	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_005334115.1|3381313_3381940_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_042080181.1|3382116_3383154_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	47.4	3.8e-77
WP_064336781.1|3383150_3383789_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	39.2	3.2e-26
WP_064336782.1|3384657_3385356_-	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_064336783.1|3385366_3386983_-	hypothetical protein	NA	A5X9J8	Aeromonas_virus	77.1	1.9e-248
WP_064336784.1|3386979_3387540_-	hypothetical protein	NA	A5X9J7	Aeromonas_virus	75.0	1.1e-62
WP_082182335.1|3387536_3388349_-	hypothetical protein	NA	A5X9J6	Aeromonas_virus	72.1	2.9e-104
WP_064336786.1|3388414_3388651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064336787.1|3388650_3389727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064336788.1|3389726_3390509_-|tail	phage tail protein	tail	G0ZT38	Aeromonas_phage	77.2	2.4e-55
WP_064336789.1|3390493_3391186_-	hypothetical protein	NA	A5X9J2	Aeromonas_virus	58.3	2.6e-50
WP_064336790.1|3391178_3392366_-|plate	baseplate J/gp47 family protein	plate	A5X9J1	Aeromonas_virus	82.9	6.3e-185
WP_064337687.1|3392362_3392686_-	DUF2590 family protein	NA	A5X9J0	Aeromonas_virus	92.5	8.0e-50
WP_064336791.1|3392682_3394761_-|tail	phage tail tape measure protein	tail	A5X9I9	Aeromonas_virus	50.2	5.7e-173
WP_017412260.1|3394949_3395213_-|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	64.4	4.0e-23
WP_064336792.1|3395336_3395771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064336793.1|3395767_3396229_-	glycoside hydrolase family 104 protein	NA	G0ZT35	Aeromonas_phage	88.2	2.0e-78
WP_064336794.1|3396215_3396542_-|holin	phage holin, lambda family	holin	A5X9I3	Aeromonas_virus	62.4	3.3e-27
WP_064336795.1|3396565_3396775_-	TraR/DksA family transcriptional regulator	NA	A5X9I2	Aeromonas_virus	85.5	1.5e-28
WP_064336796.1|3396785_3397241_-	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	84.7	6.3e-69
WP_064336797.1|3397244_3398369_-	DUF2586 family protein	NA	A5X9I0	Aeromonas_virus	86.9	3.2e-186
WP_064336799.1|3398820_3401460_-	replication endonuclease	NA	A5X9G4	Aeromonas_virus	36.5	1.7e-113
WP_064336801.1|3401846_3402161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064336802.1|3402603_3402915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064336803.1|3402911_3403115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174531744.1|3403354_3403507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064336804.1|3403580_3404627_+|portal	phage portal protein	portal	A5X9H1	Aeromonas_virus	75.7	2.5e-145
>prophage 7
NZ_CP012504	Aeromonas veronii strain TH0426 chromosome, complete genome	4923009	4137933	4148424	4923009	protease	Staphylococcus_phage(42.86%)	9	NA	NA
WP_005338866.1|4137933_4138404_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.3	5.1e-29
WP_041236048.1|4138620_4139847_+|protease	serine protease	protease	V5LQ56	Emiliania_huxleyi_virus	24.9	1.9e-06
WP_021230382.1|4139904_4141014_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.5	2.1e-65
WP_064337202.1|4141163_4141817_-	riboflavin synthase	NA	A0A1V0SE20	Indivirus	37.3	6.0e-20
WP_064337203.1|4141872_4142982_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	34.3	1.8e-48
WP_005338880.1|4143087_4143537_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_005338884.1|4143687_4144941_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.2	3.9e-100
WP_064337204.1|4145265_4145550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064337205.1|4145598_4148424_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	30.9	1.4e-44
>prophage 8
NZ_CP012504	Aeromonas veronii strain TH0426 chromosome, complete genome	4923009	4799019	4821584	4923009	holin,tail,integrase,plate	Aeromonas_virus(77.78%)	33	4798878:4798898	4822905:4822925
4798878:4798898	attL	AAAAAAGGAGGCCGAAGCCTC	NA	NA	NA	NA
WP_064337537.1|4799019_4799991_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	50.8	1.0e-87
WP_064337538.1|4800114_4800339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064337539.1|4800328_4800634_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_064337716.1|4800724_4801408_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	42.0	2.0e-42
WP_064337540.1|4801483_4801678_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_146045121.1|4801670_4802030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064337542.1|4802026_4802434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064337543.1|4802635_4802815_+	hypothetical protein	NA	A5X9F9	Aeromonas_virus	51.8	8.4e-09
WP_146045120.1|4802814_4803027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064337717.1|4803029_4803296_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_064336803.1|4803379_4803583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064336802.1|4803579_4803891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064336801.1|4804333_4804648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064336799.1|4805034_4807674_+	replication endonuclease	NA	A5X9G4	Aeromonas_virus	36.5	1.7e-113
WP_064337544.1|4807696_4807933_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155728542.1|4807929_4808358_+	3'-5' exoribonuclease	NA	NA	NA	NA	NA
WP_064336797.1|4808581_4809706_+	DUF2586 family protein	NA	A5X9I0	Aeromonas_virus	86.9	3.2e-186
WP_064336796.1|4809709_4810165_+	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	84.7	6.3e-69
WP_064336795.1|4810175_4810385_+	TraR/DksA family transcriptional regulator	NA	A5X9I2	Aeromonas_virus	85.5	1.5e-28
WP_064336794.1|4810408_4810735_+|holin	phage holin, lambda family	holin	A5X9I3	Aeromonas_virus	62.4	3.3e-27
WP_064336793.1|4810721_4811183_+	glycoside hydrolase family 104 protein	NA	G0ZT35	Aeromonas_phage	88.2	2.0e-78
WP_064336792.1|4811179_4811614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017412260.1|4811737_4812001_+|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	64.4	4.0e-23
WP_064336791.1|4812189_4814268_+|tail	phage tail tape measure protein	tail	A5X9I9	Aeromonas_virus	50.2	5.7e-173
WP_064337687.1|4814264_4814588_+	DUF2590 family protein	NA	A5X9J0	Aeromonas_virus	92.5	8.0e-50
WP_064336790.1|4814584_4815772_+|plate	baseplate J/gp47 family protein	plate	A5X9J1	Aeromonas_virus	82.9	6.3e-185
WP_064336789.1|4815764_4816457_+	hypothetical protein	NA	A5X9J2	Aeromonas_virus	58.3	2.6e-50
WP_064336788.1|4816441_4817224_+|tail	phage tail protein	tail	G0ZT38	Aeromonas_phage	77.2	2.4e-55
WP_064336787.1|4817223_4818300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064336786.1|4818299_4818536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082182335.1|4818601_4819414_+	hypothetical protein	NA	A5X9J6	Aeromonas_virus	72.1	2.9e-104
WP_064336784.1|4819410_4819971_+	hypothetical protein	NA	A5X9J7	Aeromonas_virus	75.0	1.1e-62
WP_064336783.1|4819967_4821584_+	hypothetical protein	NA	A5X9J8	Aeromonas_virus	77.1	1.9e-248
4822905:4822925	attR	AAAAAAGGAGGCCGAAGCCTC	NA	NA	NA	NA
