The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018664	Acinetobacter baumannii strain ATCC 17978 chromosome, complete genome	4004792	139212	154010	4004792		Acinetobacter_phage(100.0%)	10	NA	NA
WP_000566784.1|139212_139788_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	3.2e-110
WP_109104826.1|139884_142656_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	98.8	0.0e+00
WP_005134946.1|142663_145396_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	97.8	0.0e+00
WP_001982145.1|145751_146801_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000608308.1|146810_147617_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	99.6	1.8e-146
WP_000066123.1|147626_148322_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	99.6	2.2e-121
WP_001164225.1|148332_149316_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	98.8	6.6e-188
WP_005134944.1|149322_151698_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	99.6	0.0e+00
WP_000893681.1|151699_153199_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	96.6	1.0e-277
WP_001187844.1|153461_154010_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
>prophage 2
NZ_CP018664	Acinetobacter baumannii strain ATCC 17978 chromosome, complete genome	4004792	1254299	1277151	4004792	integrase,transposase	uncultured_Caudovirales_phage(40.0%)	27	1255759:1255773	1285302:1285316
WP_085944194.1|1254299_1255518_+|transposase	IS3-like element ISAba18 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.2	3.2e-75
1255759:1255773	attL	TTTTATGAATGAAAC	NA	NA	NA	NA
WP_017397630.1|1255813_1256929_-	TniQ family protein	NA	NA	NA	NA	NA
WP_074031684.1|1256955_1257756_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000954590.1|1258076_1259279_+|integrase	site-specific integrase	integrase	T1S9J3	Salmonella_phage	55.1	5.0e-121
WP_001179606.1|1259426_1259648_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001162384.1|1259652_1260480_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000743064.1|1260466_1261348_+	replication protein C	NA	NA	NA	NA	NA
WP_000024442.1|1262380_1262569_+	stabilization protein	NA	NA	NA	NA	NA
WP_000836966.1|1262709_1263489_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_000718002.1|1263501_1263738_+	entry exclusion lipoprotein TrbK	NA	NA	NA	NA	NA
WP_001405816.1|1263748_1265176_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_000213809.1|1265180_1265429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211355.1|1265492_1265717_+	type I toxin-antitoxin system ptaRNA1 family toxin	NA	NA	NA	NA	NA
WP_000131871.1|1265753_1265957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272375.1|1266071_1267139_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_000140066.1|1267135_1267642_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	42.6	3.0e-27
WP_001239389.1|1267638_1268406_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	63.3	1.4e-76
WP_000447876.1|1268402_1268735_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001366550.1|1268882_1269620_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|1269616_1269841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|1270051_1271545_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|1271575_1271827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|1271720_1272023_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|1272109_1272925_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_085940413.1|1273017_1274107_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000573066.1|1274529_1276440_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000736393.1|1276440_1277151_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	5.3e-06
1285302:1285316	attR	GTTTCATTCATAAAA	NA	NA	NA	NA
>prophage 3
NZ_CP018664	Acinetobacter baumannii strain ATCC 17978 chromosome, complete genome	4004792	2743672	2770546	4004792	terminase,capsid	Acinetobacter_phage(55.17%)	41	NA	NA
WP_000729980.1|2743672_2744992_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.8	7.8e-59
WP_001077408.1|2745103_2746102_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_001111769.1|2746145_2746703_-	cytochrome b	NA	NA	NA	NA	NA
WP_000735756.1|2746942_2747332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000495836.1|2747397_2747964_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.4	1.8e-25
WP_000906487.1|2748033_2748288_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
WP_001185176.1|2748534_2749815_-	aspartate kinase	NA	NA	NA	NA	NA
WP_000362184.1|2750024_2750240_-	hypothetical protein	NA	A0A0R6PG25	Moraxella_phage	55.9	3.7e-11
WP_000015931.1|2750241_2750499_-	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	89.3	8.3e-42
WP_000048746.1|2750502_2750787_-	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	94.7	1.3e-43
WP_049594848.1|2750783_2751191_-	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	52.2	7.5e-13
WP_049594847.1|2751191_2751443_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	98.7	8.4e-39
WP_000067517.1|2751444_2752404_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	89.7	1.5e-160
WP_000206151.1|2752418_2753186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000181031.1|2753197_2753521_-	hypothetical protein	NA	A0A0P0IKP4	Acinetobacter_phage	95.3	1.8e-54
WP_001101454.1|2753523_2753964_-	hypothetical protein	NA	A0A0N7IRE9	Acinetobacter_phage	96.6	7.0e-73
WP_000187984.1|2754191_2754983_-	helix-turn-helix domain-containing protein	NA	A0A0R6PH50	Moraxella_phage	52.1	1.4e-10
WP_000210973.1|2754985_2755234_+	helix-turn-helix domain-containing protein	NA	A0A0R6PH31	Moraxella_phage	58.6	8.0e-18
WP_001289843.1|2755288_2755789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001194329.1|2755839_2756127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001003656.1|2756123_2757038_+	DNA cytosine methyltransferase	NA	A0A2I7QZY6	Vibrio_phage	65.8	4.5e-58
WP_001110397.1|2757034_2757985_+	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	64.9	1.2e-101
WP_000544517.1|2757977_2758727_+	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	96.8	1.9e-134
WP_000017854.1|2758723_2759131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000778995.1|2759127_2759529_+	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	48.4	1.7e-25
WP_001288428.1|2759521_2759737_+	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	59.0	1.0e-05
WP_000100167.1|2759736_2760138_+	DUF559 domain-containing protein	NA	A0A0P0IKL1	Acinetobacter_phage	93.2	3.4e-66
WP_000959672.1|2760148_2760883_+	hypothetical protein	NA	J7HXD9	Acinetobacter_phage	99.2	8.8e-137
WP_000527469.1|2761054_2761267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000134358.1|2761344_2761536_+	hypothetical protein	NA	J7I0V8	Acinetobacter_phage	85.7	2.6e-24
WP_000348740.1|2761548_2761977_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	66.7	9.3e-46
WP_049594846.1|2761945_2762587_+	hypothetical protein	NA	A0A0P0I449	Acinetobacter_phage	87.3	3.8e-112
WP_000729394.1|2762645_2763122_+	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	53.6	4.5e-33
WP_001088670.1|2763099_2764626_+|terminase	phage terminase large subunit	terminase	A0A291LBL3	Klebsiella_phage	40.6	4.4e-90
WP_000852317.1|2764634_2765969_+	DUF1073 domain-containing protein	NA	M4SN90	Psychrobacter_phage	39.2	2.0e-86
WP_000207480.1|2765913_2766726_+|capsid	minor capsid protein	capsid	M4T3R2	Psychrobacter_phage	41.0	2.8e-51
WP_001016202.1|2766697_2767249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000823404.1|2767337_2767637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000160522.1|2767879_2769082_+	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	34.3	1.9e-24
WP_000240726.1|2769095_2769566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000039808.1|2769571_2770546_+	DUF2184 domain-containing protein	NA	M4SQD1	Psychrobacter_phage	37.5	2.0e-51
>prophage 4
NZ_CP018664	Acinetobacter baumannii strain ATCC 17978 chromosome, complete genome	4004792	2778242	2792420	4004792	integrase	Acinetobacter_phage(30.0%)	13	2775684:2775699	2793090:2793105
2775684:2775699	attL	GTTCAATCTGCTTTTG	NA	NA	NA	NA
WP_001248150.1|2778242_2779100_+	DUF2163 domain-containing protein	NA	A0A0U3DZV3	Pseudomonas_phage	23.1	1.4e-08
WP_001130838.1|2779156_2780959_+	hypothetical protein	NA	A0A0S1S0B7	Acinetobacter_phage	56.4	4.6e-155
WP_000008889.1|2780962_2781733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000792723.1|2781733_2782156_+	C40 family peptidase	NA	A0A0B5A615	Paracoccus_phage	33.3	5.8e-08
WP_031977643.1|2782156_2784646_+	hypothetical protein	NA	A0A1I9L2F3	Xanthomonas_phage	22.9	2.9e-06
WP_000433902.1|2784709_2785099_+	hypothetical protein	NA	A0A0P0IYC0	Acinetobacter_phage	96.9	2.4e-64
WP_001019729.1|2785141_2785684_+	N-acetylmuramidase	NA	A0A0P0IW03	Acinetobacter_phage	95.0	7.2e-96
WP_001084012.1|2786863_2787376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000679992.1|2787413_2788712_-	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	61.4	6.7e-156
WP_001289330.1|2788715_2789210_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	61.5	4.8e-46
WP_001067291.1|2789621_2790134_+	DUF4065 domain-containing protein	NA	A0A0R6PCI9	Moraxella_phage	39.5	6.5e-22
WP_001008609.1|2790138_2791122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229156.1|2791214_2792420_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0R6PDI8	Moraxella_phage	50.9	1.6e-103
2793090:2793105	attR	GTTCAATCTGCTTTTG	NA	NA	NA	NA
>prophage 5
NZ_CP018664	Acinetobacter baumannii strain ATCC 17978 chromosome, complete genome	4004792	3236253	3277069	4004792	integrase,capsid,tail,terminase,protease,head,portal,tRNA	Acinetobacter_phage(40.74%)	54	3246346:3246367	3281495:3281516
WP_000033177.1|3236253_3236757_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	A0A0B5J096	Pandoravirus	31.3	2.9e-06
WP_001246675.1|3236826_3237270_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_000218018.1|3237277_3237964_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140309.1|3238068_3239742_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000205997.1|3239898_3240201_+	integration host factor subunit beta	NA	B5TA87	Burkholderia_phage	42.9	5.6e-13
WP_001269278.1|3240225_3240591_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_000392928.1|3240756_3241455_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_001190745.1|3241451_3242363_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_109104877.1|3242412_3243960_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_085920605.1|3244123_3245101_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000933387.1|3245184_3246327_+	cell division protein ZapE	NA	NA	NA	NA	NA
3246346:3246367	attL	CGCTCTAAATTGAGCGCTTTTT	NA	NA	NA	NA
WP_000190203.1|3246503_3247463_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	35.4	7.6e-48
WP_000141160.1|3247428_3247680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000005654.1|3247672_3247942_-	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	94.0	1.9e-44
WP_000992057.1|3247938_3248421_-	methyltransferase domain-containing protein	NA	A0A0N7IRF6	Acinetobacter_phage	74.8	4.6e-70
WP_000130778.1|3248424_3248955_-	DUF551 domain-containing protein	NA	A0A1B1P9F6	Acinetobacter_phage	88.2	1.6e-31
WP_000717853.1|3248966_3249230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284990.1|3250087_3250360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001071965.1|3250352_3250790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049594836.1|3251044_3251677_-	Cro/Cl family transcriptional regulator	NA	A0A2H4JAJ5	uncultured_Caudovirales_phage	48.4	2.3e-24
WP_001005276.1|3252081_3252378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049594835.1|3252377_3253262_+	YdaU family protein	NA	A0A2I7RGZ2	Vibrio_phage	63.4	4.6e-31
WP_000009564.1|3253261_3254593_+	AAA family ATPase	NA	A0A0P0IVX0	Acinetobacter_phage	55.2	9.7e-126
WP_000846967.1|3254589_3254868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000801885.1|3254864_3255467_+	hypothetical protein	NA	A0A068CBJ8	Acinetobacter_phage	45.8	4.4e-09
WP_001003589.1|3255463_3255634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001060708.1|3255633_3256131_+	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	34.2	1.4e-16
WP_000344040.1|3256221_3256938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000910071.1|3256963_3257326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000380484.1|3257343_3257514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000152595.1|3257838_3258267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856321.1|3258350_3258749_+	hypothetical protein	NA	T1S9H7	Salmonella_phage	38.0	1.4e-11
WP_000433061.1|3258764_3259295_+	hypothetical protein	NA	A0A2H4JB76	uncultured_Caudovirales_phage	44.0	5.7e-37
WP_000093655.1|3259284_3259467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000503076.1|3259459_3259723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074031681.1|3259700_3259991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001219091.1|3260341_3260824_+|terminase	terminase small subunit	terminase	A0A2H4J8R0	uncultured_Caudovirales_phage	46.0	2.7e-25
WP_000467659.1|3260833_3261028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049594834.1|3261150_3262851_+|terminase	terminase large subunit	terminase	A0A2H4J559	uncultured_Caudovirales_phage	62.2	1.6e-197
WP_000108390.1|3262847_3264074_+|portal	phage portal protein	portal	A0A2H4J6S3	uncultured_Caudovirales_phage	75.9	3.9e-182
WP_000375470.1|3264066_3264729_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JAI0	uncultured_Caudovirales_phage	62.7	1.2e-73
WP_000137064.1|3264721_3265894_+|capsid	phage major capsid protein	capsid	A0A2H4JD98	uncultured_Caudovirales_phage	53.0	2.0e-103
WP_000666093.1|3265941_3266118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000631203.1|3266114_3266402_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	47.5	1.1e-18
WP_001139339.1|3266403_3266760_+|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	50.0	1.6e-19
WP_000426677.1|3266763_3267249_+	HK97 gp10 family phage protein	NA	A0A2H4JB20	uncultured_Caudovirales_phage	44.8	1.7e-27
WP_000598738.1|3267248_3267623_+	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	44.5	2.6e-20
WP_001062225.1|3267692_3268172_+	hypothetical protein	NA	A0A2H4JBZ0	uncultured_Caudovirales_phage	67.1	1.9e-55
WP_000113359.1|3268171_3268588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032061919.1|3268877_3269261_+	lipoprotein	NA	A0A1B1P9E7	Acinetobacter_phage	54.4	3.5e-36
WP_049594833.1|3269320_3272908_+	hypothetical protein	NA	J7I4Q7	Acinetobacter_phage	31.6	5.7e-72
WP_033502836.1|3272915_3273398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000133292.1|3273390_3273897_+	hypothetical protein	NA	A0A1B1P9F1	Acinetobacter_phage	37.3	1.5e-23
WP_000054088.1|3274210_3277069_+	hypothetical protein	NA	A0A1B1P9G8	Acinetobacter_phage	34.3	2.8e-130
3281495:3281516	attR	CGCTCTAAATTGAGCGCTTTTT	NA	NA	NA	NA
>prophage 6
NZ_CP018664	Acinetobacter baumannii strain ATCC 17978 chromosome, complete genome	4004792	3749781	3798366	4004792	integrase,terminase,capsid	Acinetobacter_phage(90.2%)	67	3747657:3747674	3798527:3798544
3747657:3747674	attL	ATAGAAAAAGTAGAATCC	NA	NA	NA	NA
WP_000829046.1|3749781_3751074_+	Y-family DNA polymerase	NA	A0A0P0I4F0	Acinetobacter_phage	90.2	8.9e-209
WP_000071917.1|3751102_3751525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086710.1|3751549_3751720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000265239.1|3751688_3752057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000066825.1|3752056_3752566_-	lysozyme	NA	A0A0B5L5F7	Acinetobacter_phage	59.2	2.8e-49
WP_000005350.1|3752549_3752825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049594825.1|3752891_3756338_-	bacteriophage protein	NA	A0A0D4DBG7	Acinetobacter_phage	96.9	0.0e+00
WP_000835157.1|3756330_3756693_-	hypothetical protein	NA	A0A0D4DCJ1	Acinetobacter_phage	98.3	4.4e-65
WP_000368392.1|3756689_3757196_-	DUF1833 family protein	NA	A0A0D4DCA4	Acinetobacter_phage	99.4	2.7e-92
WP_000277431.1|3757195_3757594_-	hypothetical protein	NA	A0A0P0IY66	Acinetobacter_phage	95.5	1.3e-70
WP_000046542.1|3757643_3762539_-	tape measure protein	NA	J7I4Q7	Acinetobacter_phage	98.3	0.0e+00
WP_031977960.1|3762631_3763021_-	hypothetical protein	NA	A0A0D4DBP2	Acinetobacter_phage	100.0	7.3e-66
WP_000523932.1|3763054_3763378_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_074031683.1|3763386_3763563_-	hypothetical protein	NA	A0A0R6PIB1	Moraxella_phage	57.7	8.2e-09
WP_000966688.1|3763662_3764067_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	100.0	3.9e-70
WP_000838146.1|3764159_3764342_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
WP_001185604.1|3764667_3765183_-	hypothetical protein	NA	A0A0P0J095	Acinetobacter_phage	98.5	5.3e-72
WP_000094261.1|3765252_3766170_-	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	98.4	2.7e-167
WP_000002414.1|3766222_3767401_-	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	65.1	1.9e-101
WP_000064603.1|3767400_3767754_-	hypothetical protein	NA	A0A0P0IY61	Acinetobacter_phage	95.7	5.1e-58
WP_000749906.1|3767850_3768372_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_001277696.1|3768480_3768699_-	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
WP_001251846.1|3768700_3769099_-	hypothetical protein	NA	A0A0P0IRA6	Acinetobacter_phage	90.9	5.2e-67
WP_000539743.1|3769100_3769469_-	hypothetical protein	NA	A0A0P0IDX0	Acinetobacter_phage	98.1	1.1e-55
WP_170825905.1|3769440_3769878_-	hypothetical protein	NA	J7I0W8	Acinetobacter_phage	91.0	4.7e-69
WP_000524217.1|3769856_3770225_-	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	100.0	2.6e-65
WP_000008486.1|3770226_3770616_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	99.2	8.6e-67
WP_000692542.1|3770620_3771286_-	hypothetical protein	NA	J7I4P7	Acinetobacter_phage	95.0	1.8e-109
WP_049594824.1|3771351_3772308_-	hypothetical protein	NA	A0A0D4DBM4	Acinetobacter_phage	99.7	6.0e-178
WP_000770049.1|3772335_3773103_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
WP_001139861.1|3773216_3773408_-	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
WP_000004365.1|3773631_3773868_-	hypothetical protein	NA	A0A0D4DC19	Acinetobacter_phage	94.9	4.8e-36
WP_000965191.1|3773966_3774395_-	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	99.3	1.2e-72
WP_000179750.1|3774403_3775507_-|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	99.2	6.6e-205
WP_001286363.1|3775508_3776960_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	98.8	1.6e-283
WP_000102084.1|3776956_3778384_-|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	92.8	5.3e-263
WP_000729376.1|3778373_3778844_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	89.1	4.4e-73
WP_000435236.1|3778902_3779544_-	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	92.0	4.7e-118
WP_000341081.1|3779512_3779941_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	61.1	1.3e-39
WP_000469283.1|3780665_3780884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162489797.1|3781409_3781529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170825904.1|3781894_3782068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000991752.1|3782282_3783083_-	hypothetical protein	NA	B6SD57	Bacteriophage	41.2	9.2e-55
WP_000992310.1|3783343_3783781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000097328.1|3783783_3784188_-	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	50.9	5.2e-22
WP_053100974.1|3784187_3784376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647824.1|3785058_3785400_-	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	57.1	4.6e-32
WP_000544508.1|3785396_3786146_-	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	95.6	7.8e-133
WP_001110402.1|3786138_3787089_-	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	61.4	1.3e-95
WP_001091618.1|3787085_3788639_-	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	41.8	2.4e-136
WP_000102847.1|3788635_3788920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001095599.1|3788916_3789192_-	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	98.9	2.6e-41
WP_000051076.1|3789235_3789499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217697.1|3789495_3789672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105766.1|3789799_3790489_+	helix-turn-helix domain-containing protein	NA	A0A2H4JAJ5	uncultured_Caudovirales_phage	73.1	2.0e-58
WP_000029179.1|3790561_3791452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054453.1|3791452_3792319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001101042.1|3792521_3792962_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	96.6	5.4e-73
WP_000181044.1|3792964_3793288_+	hypothetical protein	NA	A0A0P0IVW1	Acinetobacter_phage	80.4	3.8e-44
WP_001207475.1|3793298_3794420_+	ATP-binding protein	NA	A0A0N7IRE0	Acinetobacter_phage	99.7	1.5e-212
WP_001061220.1|3794416_3795625_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	50.2	4.4e-93
WP_000654848.1|3795626_3795878_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	98.7	1.1e-38
WP_000147327.1|3795878_3796286_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	52.2	7.5e-13
WP_000048748.1|3796282_3796567_+	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	97.9	1.2e-44
WP_000005652.1|3796570_3796828_+	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	96.5	3.2e-46
WP_000910238.1|3796828_3797098_+	hypothetical protein	NA	A0A0N7IRE8	Acinetobacter_phage	100.0	3.5e-43
WP_000773628.1|3797103_3798366_-|integrase	integrase family protein	integrase	A0A0P0IKP2	Acinetobacter_phage	99.0	3.6e-247
3798527:3798544	attR	ATAGAAAAAGTAGAATCC	NA	NA	NA	NA
