The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012958	Aggregatibacter actinomycetemcomitans strain VT1169, complete genome	2129092	570018	578726	2129092	tail,integrase	Haemophilus_phage(45.45%)	15	570274:570293	580114:580133
WP_005592077.1|570018_570216_-	hypothetical protein	NA	D0UIM6	Aggregatibacter_phage	93.2	1.5e-22
570274:570293	attL	AAAAAGTGCGGTCGGATTTT	NA	NA	NA	NA
WP_005572271.1|570301_570958_-	hypothetical protein	NA	Q7Y5X0	Haemophilus_phage	98.6	1.3e-120
WP_005545968.1|571401_571626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005572272.1|571690_572047_-	DUF2513 domain-containing protein	NA	A0A1W6JNL0	Staphylococcus_phage	30.1	8.3e-08
WP_060828814.1|572354_572672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005572275.1|572961_573405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143108455.1|573387_573489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005592078.1|573447_573816_+	hypothetical protein	NA	A0A0M3LR73	Mannheimia_phage	57.6	1.7e-11
WP_061869853.1|573966_574233_+	hypothetical protein	NA	Q7Y5S9	Haemophilus_phage	96.6	1.8e-44
WP_005572282.1|574423_574783_+	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	99.2	2.6e-65
WP_014167744.1|574808_575228_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A2H4JFV9	uncultured_Caudovirales_phage	46.7	6.5e-28
WP_005578509.1|575279_575462_-	type II toxin-antitoxin system HicA family toxin	NA	A0A2H4JDU5	uncultured_Caudovirales_phage	45.8	4.0e-06
WP_005590091.1|575962_577129_+|tail	tail fiber protein	tail	Q7Y5S2	Haemophilus_phage	97.1	1.9e-202
WP_005590093.1|577128_577740_+	DUF4376 domain-containing protein	NA	Q7Y5S1	Haemophilus_phage	98.5	2.5e-113
WP_081107544.1|577892_578726_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	G9L697	Escherichia_phage	55.6	1.6e-81
580114:580133	attR	AAAAAGTGCGGTCGGATTTT	NA	NA	NA	NA
>prophage 2
NZ_CP012958	Aggregatibacter actinomycetemcomitans strain VT1169, complete genome	2129092	930002	940714	2129092	tRNA	Moraxella_phage(33.33%)	8	NA	NA
WP_081107549.1|930002_932420_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.5	6.3e-216
WP_005569269.1|932481_934332_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.5	7.6e-36
WP_005588315.1|934407_936165_-	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	32.6	1.4e-44
WP_005537983.1|936286_936502_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_005568391.1|936726_937755_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.2	8.9e-111
WP_005548460.1|937819_938053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005548462.1|938055_938634_+	thymidine kinase	NA	A0A1Z1LZ42	Serratia_phage	52.1	4.7e-53
WP_005548464.1|938701_940714_-	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	48.3	5.0e-134
>prophage 3
NZ_CP012958	Aggregatibacter actinomycetemcomitans strain VT1169, complete genome	2129092	1123070	1130061	2129092		Enterobacteria_phage(50.0%)	8	NA	NA
WP_025298484.1|1123070_1123808_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	3.1e-17
WP_025298485.1|1123810_1124602_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005567298.1|1124635_1125175_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	52.5	2.4e-51
WP_005567295.1|1125177_1126056_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.8	2.1e-36
WP_014167907.1|1126056_1126929_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	5.4e-109
WP_005569397.1|1127006_1128074_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	3.0e-101
WP_005567291.1|1128143_1129274_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_005586307.1|1129275_1130061_-	glycosyltransferase	NA	F2Y1U7	Organic_Lake_phycodnavirus	29.7	8.8e-18
