The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014781	Bacillus licheniformis strain HRBL-15TDI7 chromosome, complete genome	4252398	700545	710469	4252398		Synechococcus_phage(50.0%)	9	NA	NA
WP_003179530.1|700545_701841_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.1	5.9e-19
WP_061576038.1|701915_702632_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	42.4	2.4e-46
WP_003179532.1|702633_702888_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	8.0e-05
WP_003179533.1|702884_703568_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_009329142.1|703551_705780_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.5	3.2e-158
WP_003179536.1|705755_707186_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	4.5e-52
WP_011197613.1|707309_708350_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	46.3	2.7e-62
WP_003179538.1|708346_708934_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.1	1.4e-28
WP_003179539.1|708930_710469_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.0	4.3e-77
>prophage 2
NZ_CP014781	Bacillus licheniformis strain HRBL-15TDI7 chromosome, complete genome	4252398	1285883	1354293	4252398	terminase,plate,transposase,holin,coat,portal,tail	Bacillus_phage(25.64%)	84	NA	NA
WP_009328811.1|1285883_1286333_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011197778.1|1286483_1286972_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009328809.1|1287103_1287616_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009328808.1|1287686_1288085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328807.1|1288133_1288520_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011197779.1|1288666_1289023_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_009328806.1|1289309_1289519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197781.1|1289598_1289730_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_009328805.1|1289859_1290117_+	sporulation protein	NA	NA	NA	NA	NA
WP_011197782.1|1290155_1292438_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	35.6	1.0e-90
WP_016885900.1|1292559_1292817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328801.1|1292856_1293444_-	DedA family protein	NA	NA	NA	NA	NA
WP_011197784.1|1293539_1294526_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	1.6e-53
WP_009328799.1|1294522_1295413_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	55.6	1.2e-84
WP_011197785.1|1295435_1295831_-	GtrA family protein	NA	NA	NA	NA	NA
WP_009328797.1|1295995_1296415_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009328796.1|1296424_1296934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328793.1|1296998_1297721_-	esterase family protein	NA	NA	NA	NA	NA
WP_011197786.1|1297711_1298044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011197787.1|1298237_1298726_-	DNA damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_009328787.1|1298806_1299754_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_009328785.1|1300062_1301187_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	25.6	5.3e-16
WP_009328782.1|1301176_1302352_+	cystathionine beta-lyase	NA	A0A0B5JD48	Pandoravirus	29.3	6.7e-22
WP_011197789.1|1302397_1303588_-	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_011197790.1|1303761_1304331_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009328774.1|1304320_1304605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474216.1|1304780_1306154_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	23.9	3.8e-08
WP_009328769.1|1306458_1307445_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_016885898.1|1308046_1308130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061565996.1|1308568_1308748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474214.1|1308781_1309360_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_017474213.1|1309446_1309734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474212.1|1309941_1310832_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011197796.1|1311152_1312982_+	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_003180762.1|1313009_1314728_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_085959889.1|1314800_1315963_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.2	1.5e-34
WP_003180765.1|1316074_1316962_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180767.1|1317053_1317926_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003180768.1|1317973_1318351_+	glyoxalase	NA	NA	NA	NA	NA
WP_009328757.1|1318394_1318943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180772.1|1319395_1320130_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	60.8	4.2e-30
WP_011197798.1|1320185_1321610_-	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	24.6	5.1e-16
WP_003180775.1|1321625_1322204_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180778.1|1322216_1322552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180779.1|1322580_1322994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180781.1|1323368_1323851_-	DUF600 family protein	NA	NA	NA	NA	NA
WP_009328750.1|1323854_1325903_-	hypothetical protein	NA	O64023	Bacillus_phage	24.5	1.9e-27
WP_003180784.1|1326123_1326771_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	47.5	4.1e-45
WP_003180785.1|1326784_1327441_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	49.7	4.0e-40
WP_003180787.1|1327629_1327983_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.6	2.7e-19
WP_003180788.1|1328155_1328416_+	helix-turn-helix transcriptional regulator	NA	S5MA07	Brevibacillus_phage	41.2	7.9e-08
WP_003180790.1|1328405_1328702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180792.1|1328702_1329533_+	hypothetical protein	NA	S6BFM4	Thermus_phage	31.0	1.3e-27
WP_011197802.1|1329432_1330233_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	48.1	3.6e-59
WP_003180798.1|1330503_1330845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180800.1|1330841_1331045_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	54.7	1.9e-12
WP_003180803.1|1331165_1331669_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	38.7	1.4e-21
WP_003180804.1|1331811_1332612_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	51.4	5.7e-65
WP_009328741.1|1332608_1333907_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	60.2	7.2e-150
WP_003180808.1|1333910_1335425_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.5	3.4e-143
WP_009328740.1|1335432_1336281_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	62.8	2.1e-57
WP_009328739.1|1336298_1337234_+|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	64.1	1.1e-102
WP_011201613.1|1337321_1337702_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_009328738.1|1337698_1338055_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_003180822.1|1338051_1338540_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	44.6	1.9e-34
WP_017474400.1|1338552_1338993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180826.1|1338993_1339218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061876346.1|1339217_1340564_+|tail	phage tail sheath protein	tail	S5MNC1	Brevibacillus_phage	40.0	1.3e-77
WP_003180830.1|1340565_1341009_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	44.7	2.1e-24
WP_003180832.1|1341191_1341641_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	38.7	4.1e-12
WP_003180833.1|1341682_1341820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061876347.1|1341823_1345606_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	45.3	1.7e-42
WP_003180838.1|1345598_1346255_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	32.6	4.0e-24
WP_003180841.1|1346311_1347292_+	hypothetical protein	NA	H7BV96	unidentified_phage	32.3	9.2e-41
WP_003180843.1|1347288_1347597_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	37.3	1.0e-06
WP_003180844.1|1347615_1348041_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	39.0	5.4e-14
WP_003180847.1|1348033_1349077_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	9.7e-73
WP_009328731.1|1349063_1349984_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	28.3	5.0e-12
WP_003180850.1|1349997_1350384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197807.1|1350399_1351605_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	48.3	9.3e-27
WP_011197808.1|1351649_1352609_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	28.4	1.2e-11
WP_011197809.1|1352630_1352900_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	66.3	5.6e-25
WP_003180859.1|1352914_1353178_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	67.8	5.3e-28
WP_009328730.1|1353228_1354293_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	50.8	2.0e-44
>prophage 3
NZ_CP014781	Bacillus licheniformis strain HRBL-15TDI7 chromosome, complete genome	4252398	2179246	2214614	4252398		Bacillus_phage(91.89%)	46	NA	NA
WP_017474717.1|2179246_2179837_-	hypothetical protein	NA	A0A1P8CX67	Bacillus_phage	81.2	8.7e-87
WP_017474718.1|2179879_2180059_-	hypothetical protein	NA	O64193	Bacillus_phage	47.3	1.1e-05
WP_017474719.1|2180036_2180486_-	NADAR family protein	NA	A0A172JI41	Bacillus_phage	65.5	5.1e-47
WP_017474720.1|2180533_2180761_-	hypothetical protein	NA	A0A0E3D9Q5	Bacillus_phage	48.7	1.1e-10
WP_100225865.1|2180788_2181103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328256.1|2181204_2181378_-	hypothetical protein	NA	O64190	Bacillus_phage	89.5	2.7e-20
WP_017474722.1|2181419_2181599_-	hypothetical protein	NA	A0A1P8CWU9	Bacillus_phage	84.7	1.6e-20
WP_017474723.1|2181647_2182463_-	metallophosphoesterase	NA	O64184	Bacillus_phage	88.7	9.1e-151
WP_017474724.1|2182582_2182801_+	acid-soluble spore protein SspC	NA	Q77YX0	Bacillus_phage	98.6	2.8e-30
WP_017474726.1|2184454_2184757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474727.1|2184771_2185002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474728.1|2184991_2185354_-	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	45.8	2.9e-16
WP_017474729.1|2185507_2186359_-	thymidylate synthase	NA	U5J9N5	Bacillus_phage	40.3	1.7e-51
WP_017474730.1|2186360_2186648_-	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	50.5	1.3e-14
WP_017474732.1|2186977_2187160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474733.1|2187255_2187690_-	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	86.6	1.6e-69
WP_017474734.1|2188018_2188405_-	hypothetical protein	NA	A0A0S2MVH4	Bacillus_phage	44.6	1.2e-12
WP_026080849.1|2188442_2188694_-	NrdH-redoxin	NA	A0A1P8CX24	Bacillus_phage	69.7	9.0e-25
WP_017474736.1|2188734_2189454_-	hypothetical protein	NA	A0A2I6UHL5	Bacillus_phage	60.3	1.1e-80
WP_017474737.1|2189443_2190415_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	79.7	1.3e-143
WP_071583983.1|2191066_2193604_-	hypothetical protein	NA	A0A1P8CX40	Bacillus_phage	83.6	0.0e+00
WP_017474742.1|2193847_2194576_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A217ER63	Bacillus_phage	87.8	1.3e-116
WP_017474743.1|2194532_2194934_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	S6ANL8	Bacillus_phage	65.8	1.7e-38
WP_017474744.1|2194933_2195281_-	hypothetical protein	NA	O64171	Bacillus_phage	41.7	6.8e-15
WP_009328276.1|2195983_2196298_+	hypothetical protein	NA	S6B1N1	Thermus_phage	43.6	1.6e-15
WP_071583670.1|2196338_2196500_-	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	75.5	5.7e-17
WP_017474747.1|2196564_2196756_-	hypothetical protein	NA	S6BUY9	Bacillus_phage	51.6	7.3e-11
WP_009328277.1|2196814_2197492_-	hypothetical protein	NA	Q6JII4	Burkholderia_virus	25.7	2.0e-18
WP_017474749.1|2197659_2198022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080601105.1|2198037_2198472_-	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	44.7	8.6e-15
WP_017474752.1|2198708_2198975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474753.1|2198964_2199165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474756.1|2200159_2200504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474757.1|2200528_2201113_-	hypothetical protein	NA	A7KV03	Bacillus_phage	38.1	1.1e-28
WP_017474760.1|2201436_2201652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474761.1|2201656_2202373_-	hypothetical protein	NA	O64147	Bacillus_phage	46.3	2.5e-43
WP_080601104.1|2202383_2203820_-	hypothetical protein	NA	A0A1P8CX14	Bacillus_phage	76.8	2.6e-217
WP_009328288.1|2203806_2204577_-	hypothetical protein	NA	R9QM99	Lactococcus_phage	32.8	6.2e-16
WP_080601106.1|2204760_2207325_-	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	88.0	0.0e+00
WP_017474762.1|2207340_2209062_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	64.4	1.3e-215
WP_017474763.1|2209065_2210199_-	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	69.4	4.8e-158
WP_017474764.1|2210215_2211730_-	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	81.3	8.2e-238
WP_017474765.1|2211744_2212215_-	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	69.2	1.3e-56
WP_017474766.1|2212261_2213233_-	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	83.8	5.5e-155
WP_017474767.1|2213286_2214198_-	hypothetical protein	NA	A0A1P8CX09	Bacillus_phage	67.6	6.4e-113
WP_017474768.1|2214281_2214614_-	hypothetical protein	NA	A0A1P8CX10	Bacillus_phage	50.5	1.8e-17
>prophage 4
NZ_CP014781	Bacillus licheniformis strain HRBL-15TDI7 chromosome, complete genome	4252398	2218466	2225101	4252398		Bacillus_phage(100.0%)	16	NA	NA
WP_061576017.1|2218466_2218661_-	hypothetical protein	NA	R4JF30	Bacillus_phage	100.0	3.2e-30
WP_061576016.1|2218657_2219056_-	hypothetical protein	NA	R4JKA5	Bacillus_phage	95.5	2.8e-73
WP_017474432.1|2219052_2219502_-	hypothetical protein	NA	A0A1B1P7V7	Bacillus_phage	39.6	2.8e-08
WP_017474434.1|2219759_2219984_-	hypothetical protein	NA	O64132	Bacillus_phage	66.2	2.2e-22
WP_006640547.1|2220076_2220889_+	hypothetical protein	NA	O64130	Bacillus_phage	75.8	7.7e-118
WP_006640548.1|2220898_2221147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328307.1|2221280_2221589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328308.1|2221601_2222135_-	hypothetical protein	NA	U5PUK4	Bacillus_phage	58.1	2.4e-51
WP_009328309.1|2222176_2222581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042885756.1|2222672_2222867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474436.1|2222866_2223121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006640553.1|2223155_2223443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474437.1|2223464_2223638_-	hypothetical protein	NA	A0A1B1P7C0	Bacillus_phage	68.4	1.1e-13
WP_017474438.1|2223664_2224009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474439.1|2224055_2224253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474440.1|2224432_2225101_-	DUF1273 family protein	NA	A0A1P8CWY2	Bacillus_phage	74.0	2.2e-94
>prophage 5
NZ_CP014781	Bacillus licheniformis strain HRBL-15TDI7 chromosome, complete genome	4252398	2261910	2269439	4252398		Bacillus_phage(33.33%)	7	NA	NA
WP_017474483.1|2261910_2262186_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	73.3	1.9e-28
WP_009328365.1|2262977_2263493_+	hypothetical protein	NA	A0A0A0PL66	Bacillus_phage	49.7	1.8e-35
WP_017474485.1|2264011_2264203_+	hypothetical protein	NA	A0A1P8CWT3	Bacillus_phage	87.3	3.4e-24
WP_017474486.1|2264215_2265409_+	metallophosphoesterase	NA	A0A0N9SK37	Staphylococcus_phage	38.2	8.3e-68
WP_017474487.1|2265766_2266396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474488.1|2266683_2267685_+	hypothetical protein	NA	Q331V7	Clostridium_botulinum_C_phage	25.4	4.3e-09
WP_017474489.1|2267684_2269439_+	hypothetical protein	NA	A0A0K2FLD6	Brevibacillus_phage	30.4	3.9e-66
>prophage 6
NZ_CP014781	Bacillus licheniformis strain HRBL-15TDI7 chromosome, complete genome	4252398	2274720	2282507	4252398	integrase	Bacillus_phage(100.0%)	12	2264284:2264297	2285864:2285877
2264284:2264297	attL	ATTATTTAAAAATA	NA	NA	NA	NA
WP_017474496.1|2274720_2275389_+	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	49.8	1.5e-47
WP_017474497.1|2275385_2275916_+	hypothetical protein	NA	O64060	Bacillus_phage	61.9	2.5e-56
WP_017474498.1|2275912_2276623_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	39.4	2.4e-38
WP_017474499.1|2276654_2277500_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	42.5	9.4e-26
WP_017474500.1|2277522_2277915_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	48.0	4.2e-13
WP_017474501.1|2278023_2278389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474502.1|2278391_2280020_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	50.3	1.3e-34
WP_016886028.1|2280032_2280359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474503.1|2280355_2280547_+	XkdX family protein	NA	NA	NA	NA	NA
WP_016886026.1|2280585_2281071_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	32.1	8.1e-14
WP_016886025.1|2281072_2281492_+	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	56.3	3.3e-40
WP_016886024.1|2281505_2282507_+|integrase	site-specific integrase	integrase	A0A1P8CWP6	Bacillus_phage	86.2	7.4e-171
2285864:2285877	attR	TATTTTTAAATAAT	NA	NA	NA	NA
>prophage 7
NZ_CP014781	Bacillus licheniformis strain HRBL-15TDI7 chromosome, complete genome	4252398	2299126	2308817	4252398	holin	Bacillus_phage(100.0%)	9	NA	NA
WP_061876374.1|2299126_2301766_+	hypothetical protein	NA	A0A1P8CWQ0	Bacillus_phage	50.6	4.7e-241
WP_017474511.1|2301781_2302579_+	hypothetical protein	NA	O64043	Bacillus_phage	59.0	2.8e-72
WP_061876375.1|2302594_2304499_+	hypothetical protein	NA	U5PWM6	Bacillus_phage	35.3	6.0e-52
WP_017474513.1|2304654_2305722_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	62.7	1.6e-107
WP_017474514.1|2305854_2306241_+	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	71.9	4.0e-40
WP_017474515.1|2306259_2306541_+|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	45.2	8.3e-11
WP_017474516.1|2306558_2306861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016885999.1|2307057_2307150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474517.1|2307710_2308817_-	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	26.0	1.0e-27
>prophage 8
NZ_CP014781	Bacillus licheniformis strain HRBL-15TDI7 chromosome, complete genome	4252398	2476219	2488400	4252398		Staphylococcus_phage(55.56%)	15	NA	NA
WP_003183104.1|2476219_2476813_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.6	3.4e-14
WP_009327962.1|2476802_2477558_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.6	1.4e-07
WP_003183108.1|2477740_2477836_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003183111.1|2477956_2478478_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003183113.1|2478488_2478863_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003183115.1|2478964_2479429_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	70.7	1.7e-45
WP_003183117.1|2479463_2480660_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.9	2.1e-116
WP_017473932.1|2480681_2481329_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.5	5.7e-39
WP_017473931.1|2481340_2482429_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.8	6.6e-64
WP_003183123.1|2482789_2483134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011198084.1|2483396_2485583_-	AAA family ATPase	NA	A0A220BYT7	Staphylococcus_phage	41.3	1.4e-150
WP_003183127.1|2485709_2486147_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_003183128.1|2486305_2486611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009327959.1|2486600_2487731_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	43.3	1.4e-77
WP_003183133.1|2487962_2488400_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	44.6	5.4e-17
>prophage 9
NZ_CP014781	Bacillus licheniformis strain HRBL-15TDI7 chromosome, complete genome	4252398	2890946	2961219	4252398	tRNA,terminase,transposase,coat,integrase,protease	Bacillus_phage(33.33%)	69	2955274:2955299	2961280:2961305
WP_016885541.1|2890946_2891999_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_016885542.1|2892114_2893224_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_009327769.1|2893245_2894085_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_003184010.1|2894065_2895640_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_003184013.1|2895740_2896919_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	25.3	1.2e-31
WP_003184015.1|2896887_2897430_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_003184017.1|2897473_2898343_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003184018.1|2898351_2898795_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_003184021.1|2898908_2900195_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_003184022.1|2900227_2900806_-	sporulation protein	NA	NA	NA	NA	NA
WP_003184023.1|2901031_2901313_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003184025.1|2901325_2901667_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003184027.1|2901679_2901988_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003184028.1|2902144_2903011_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_044789852.1|2903003_2903795_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003184032.1|2903940_2904369_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_003184034.1|2904368_2904689_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003184035.1|2904733_2905540_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_011198163.1|2905542_2906223_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003184039.1|2906277_2906796_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003184040.1|2906792_2907701_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003184042.1|2907731_2908742_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_003184045.1|2908829_2909504_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_003184048.1|2909558_2910131_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003184050.1|2910284_2911316_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_011198164.1|2911519_2912269_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_017474374.1|2912411_2913716_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003184055.1|2913791_2916434_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	2.8e-161
WP_003184058.1|2916889_2917081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009329292.1|2917100_2918123_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_011198165.1|2918150_2919524_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_059260978.1|2919672_2920968_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_009329298.1|2920993_2921968_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_044789850.1|2921971_2922763_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003184068.1|2922752_2923694_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003184070.1|2923733_2924564_-	cytochrome c	NA	NA	NA	NA	NA
WP_017474375.1|2924569_2925931_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003184074.1|2926119_2926605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003184076.1|2926652_2927240_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016885551.1|2927236_2929561_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	45.2	1.0e-186
WP_003184080.1|2929779_2931435_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	35.7	1.4e-17
WP_003184083.1|2931617_2932883_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.5	7.2e-147
WP_003184085.1|2933151_2934426_-	trigger factor	NA	NA	NA	NA	NA
WP_017474376.1|2934652_2935660_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003184088.1|2935789_2936389_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_017474377.1|2936401_2937820_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_003184091.1|2937853_2938966_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_003184093.1|2938993_2940550_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.6	2.5e-08
WP_003184095.1|2940536_2941565_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003184097.1|2941588_2942107_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003184100.1|2942103_2943828_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.2	1.5e-62
WP_003184102.1|2944250_2945165_-	branched-chain-amino-acid transaminase	NA	NA	NA	NA	NA
WP_003184104.1|2945621_2945849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003184106.1|2945891_2947274_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_009329319.1|2947686_2947941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003184110.1|2947984_2948476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474379.1|2948489_2948690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025808006.1|2948911_2949127_-	hypothetical protein	NA	A0A1B1P7C8	Bacillus_phage	53.0	4.1e-10
WP_059260972.1|2950422_2951292_-|terminase	terminase	terminase	D2IYW0	Enterococcus_phage	40.4	3.9e-35
WP_017474640.1|2951337_2952342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009329322.1|2952832_2953606_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_026080840.1|2953911_2954682_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1B1P7C6	Bacillus_phage	63.1	1.3e-87
WP_003184124.1|2954690_2955047_-	hypothetical protein	NA	A0A1B1P7B5	Bacillus_phage	52.0	1.8e-23
2955274:2955299	attL	GTGTCCGCAGGCTCTCCGTCTTGGAC	NA	NA	NA	NA
WP_085959889.1|2955410_2956573_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.2	1.5e-34
WP_009329324.1|2956748_2957228_-	antitoxin YezG family protein	NA	NA	NA	NA	NA
WP_026699140.1|2957233_2959228_-|integrase	integrase	integrase	A0A1P8CWI7	Bacillus_phage	23.6	2.7e-15
WP_009329326.1|2959422_2960613_+	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	29.0	5.6e-40
WP_003184137.1|2960609_2960741_+	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_003184139.1|2960835_2961219_-	ArpU family transcriptional regulator	NA	A0A2H4J748	uncultured_Caudovirales_phage	43.9	5.4e-21
2961280:2961305	attR	GTGTCCGCAGGCTCTCCGTCTTGGAC	NA	NA	NA	NA
