The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046529	Mycobacterium tuberculosis strain SIT745/EAI1-MYS chromosome, complete genome	4414742	2947299	2985575	4414742	capsid,protease,head,tRNA,integrase,terminase	Mycobacterium_phage(30.0%)	47	2976100:2976127	2985728:2985755
WP_003413486.1|2947299_2949378_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2949486_2949714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2949710_2951096_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2951440_2951941_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2951957_2952398_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2952544_2953222_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2953206_2953560_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2953572_2953998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2953994_2954669_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2954746_2955568_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2955703_2956597_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2956599_2957418_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2957432_2958614_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2958672_2959104_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2959617_2960859_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2961168_2961531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2961877_2963002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2963003_2963543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2963682_2964981_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2965019_2965301_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2965445_2965931_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2965957_2966215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2966215_2968552_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2968580_2968823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2968823_2969501_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2969696_2970353_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2970515_2970962_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2971136_2971469_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2971588_2971948_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2972049_2972508_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2972643_2973024_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2973020_2974517_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2974751_2974943_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2975015_2975189_+	hypothetical protein	NA	NA	NA	NA	NA
2976100:2976127	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2976233_2976665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2976661_2977660_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2977673_2978138_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_009935349.1|2978551_2979991_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2979998_2980532_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2980684_2981311_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899414.1|2981342_2981666_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2981745_2981991_-	type II toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2981987_2983415_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2983416_2983809_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2983805_2984066_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2984082_2984445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2984447_2985575_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2985728:2985755	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
