The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014869	Brevibacterium linens strain BS258 chromosome, complete genome	3862244	997618	1046428	3862244	transposase,protease,tRNA	Bacillus_phage(28.57%)	37	NA	NA
WP_062861109.1|997618_998695_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_062862769.1|998741_1002146_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_062861110.1|1002303_1003845_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082819282.1|1003896_1004508_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.6	2.9e-32
WP_062861112.1|1004616_1006281_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_062861113.1|1006467_1006917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062861114.1|1006900_1008616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062861115.1|1008654_1010610_-	phenol 2-monooxygenase	NA	NA	NA	NA	NA
WP_082018823.1|1010655_1012059_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_039207935.1|1012188_1013679_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_082819283.1|1013639_1014398_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062861116.1|1014394_1015900_+	5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_062861117.1|1015907_1017044_+	3,4-dihydroxyphenylacetate 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_062861118.1|1017055_1017841_+	2-oxo-hepta-3-ene-1,7-dioate hydratase	NA	NA	NA	NA	NA
WP_062861119.1|1017825_1018614_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_062861120.1|1018674_1020624_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_156483835.1|1021237_1022749_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_062861121.1|1022758_1023949_+|protease	MarP family serine protease	protease	A0A1B1IRH0	uncultured_Mediterranean_phage	30.9	1.4e-06
WP_062245057.1|1023973_1024915_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_062245054.1|1024990_1025809_-	winged helix-turn-helix transcriptional regulator	NA	W8CYM9	Bacillus_phage	42.7	4.3e-07
WP_039207917.1|1026075_1026714_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_062861122.1|1026787_1027342_+|tRNA	tRNA adenosine deaminase-associated protein	tRNA	NA	NA	NA	NA
WP_039207913.1|1027353_1027785_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_062861123.1|1028211_1029672_+	NCS2 family permease	NA	NA	NA	NA	NA
WP_062861124.1|1029868_1031326_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	A0A0P0IVM8	Acinetobacter_phage	36.2	2.8e-62
WP_062861125.1|1031325_1033704_+	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	45.6	1.1e-183
WP_062861126.1|1033700_1034486_+	xanthine dehydrogenase accessory protein XdhC	NA	NA	NA	NA	NA
WP_062861127.1|1034529_1035813_+	guanine deaminase	NA	NA	NA	NA	NA
WP_062861128.1|1035983_1036808_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_062861129.1|1036842_1037730_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_062861130.1|1037811_1039605_+	glyoxylate carboligase	NA	M4QSI1	Ostreococcus_lucimarinus_virus	27.5	6.0e-38
WP_062861131.1|1039710_1041066_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_167556028.1|1041133_1041598_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062861133.1|1042874_1043489_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_062245021.1|1043898_1044888_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_039208238.1|1044986_1045553_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082018836.1|1045549_1046428_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.7	8.8e-59
>prophage 2
NZ_CP014869	Brevibacterium linens strain BS258 chromosome, complete genome	3862244	1064703	1110196	3862244	integrase,transposase,protease,tRNA	Gordonia_phage(25.0%)	44	1084707:1084734	1086275:1086302
WP_156483970.1|1064703_1065918_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	34.6	6.2e-63
WP_062862772.1|1066113_1066725_-	queuosine precursor transporter	NA	A0A1W7AG82	Streptococcus_virus	35.0	1.1e-23
WP_062861147.1|1066852_1069435_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_062861148.1|1069529_1070600_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_062861149.1|1070617_1070839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062861150.1|1070897_1071368_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_062861151.1|1071364_1071919_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_062861152.1|1071911_1072586_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_082819286.1|1072551_1073190_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_062861153.1|1073358_1074882_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_062861154.1|1074881_1075301_+	DUF779 domain-containing protein	NA	NA	NA	NA	NA
WP_062861155.1|1075413_1076724_-	alkylhydroperoxidase domain protein	NA	NA	NA	NA	NA
WP_062861156.1|1076725_1077778_-	putative FMN-dependent luciferase-like monooxygenase	NA	NA	NA	NA	NA
WP_062861157.1|1077783_1079478_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	1.4e-15
WP_062861158.1|1079474_1080356_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_062861159.1|1080352_1081432_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_062861160.1|1081428_1083150_-	TIGR04028 family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_062861161.1|1083340_1084042_+	VOC family protein	NA	NA	NA	NA	NA
WP_062861162.1|1084029_1084698_+	VOC family protein	NA	NA	NA	NA	NA
1084707:1084734	attL	CGAGAAACGGGCTGCGTGTCGAGAAACG	NA	NA	NA	NA
WP_167556022.1|1084751_1085717_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_062861163.1|1085776_1086205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062861164.1|1086331_1087105_+	DUF3152 domain-containing protein	NA	NA	NA	NA	NA
1086275:1086302	attR	CGTTTCTCGACACGCAGCCCGTTTCTCG	NA	NA	NA	NA
WP_039207840.1|1087221_1089771_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	39.7	4.0e-128
WP_062861165.1|1089862_1090669_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_039207834.1|1090793_1091099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082018820.1|1091245_1091890_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	G3M9Z8	Bacillus_virus	35.2	1.4e-21
WP_062244927.1|1091886_1092468_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	40.0	1.6e-29
WP_082819287.1|1092498_1092858_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_062244923.1|1093036_1094065_+	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_062862774.1|1094112_1095615_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_082819288.1|1095941_1097366_-	RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
WP_062861166.1|1097326_1097758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052239815.1|1098387_1099536_+	dimethyl sulfone monooxygenase SfnG	NA	NA	NA	NA	NA
WP_062861167.1|1101334_1101868_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_062861168.1|1102106_1102802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062861169.1|1103066_1103474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062861170.1|1103498_1104698_+	RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
WP_062861171.1|1104746_1105679_-	RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
WP_062861172.1|1105675_1106707_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_167556029.1|1106936_1108007_+	FUSC family protein	NA	NA	NA	NA	NA
WP_062862776.1|1108118_1108784_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_082819290.1|1108974_1109154_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_082819291.1|1109138_1109888_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	46.9	6.6e-47
WP_040342619.1|1109884_1110196_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	47.7	2.1e-15
