The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	2899	79046	5191653	transposase,protease	Leptospira_phage(40.0%)	57	NA	NA
WP_098477673.1|2899_4001_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	1.3e-43
WP_007971883.1|4967_6074_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_007971884.1|6188_8633_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.7	1.6e-113
WP_007971885.1|8700_9537_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005912440.1|9721_10528_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_007968206.1|10805_11999_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003482203.1|12266_12824_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_007971888.1|12909_13671_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005912447.1|13717_14140_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005912449.1|14143_14557_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_007971889.1|15105_15513_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_007968197.1|15765_16533_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_005912451.1|16540_16810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007971891.1|16884_18345_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_007971893.1|18645_19371_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_042805567.1|19419_19785_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_007971897.1|19908_21036_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_007971900.1|21221_21923_-	2OG-Fe(II) oxygenase	NA	E3SK61	Synechococcus_phage	47.2	1.0e-17
WP_007968187.1|22187_23528_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_003482177.1|23747_24440_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_042805569.1|24548_24869_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_007971907.1|26022_27549_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.9	2.2e-25
WP_022557789.1|27651_28950_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_007971911.1|29047_29647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088370743.1|29806_31603_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_088370744.1|32007_33095_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_007970257.1|34167_35226_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.4	1.3e-77
WP_007970254.1|35535_36609_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_050780422.1|37394_38531_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_007970250.1|38832_39276_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_162829046.1|39673_40990_-	type III effector HopG1	NA	NA	NA	NA	NA
WP_007975321.1|41835_42798_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_088370746.1|43289_44376_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_042805853.1|45111_45459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007964895.1|45483_46965_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007964894.1|47161_51634_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_022557799.1|51835_52216_-	proteinase inhibitor	NA	NA	NA	NA	NA
WP_007973056.1|52272_53550_+	DNA topoisomerase IB	NA	A0A0U2TSJ7	Niemeyer_virus	35.1	7.1e-41
WP_003482129.1|53766_54111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003482061.1|54550_54937_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_007973059.1|54940_56683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042675361.1|57871_58381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042805848.1|58413_59595_+	saccharopine dehydrogenase NADP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_007964877.1|59735_60521_-	DUF1868 domain-containing protein	NA	NA	NA	NA	NA
WP_007973065.1|60532_63190_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042805849.1|63292_64450_+	ROK family protein	NA	NA	NA	NA	NA
WP_042805850.1|64594_66748_+	avirulence protein	NA	NA	NA	NA	NA
WP_007973071.1|67235_68747_-	ribonuclease H-like domain-containing protein	NA	NA	NA	NA	NA
WP_007973073.1|68743_71239_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	35.1	1.5e-07
WP_029818121.1|71416_72079_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_029818122.1|72144_72402_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_042675357.1|72389_72689_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_007973076.1|72868_73768_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007973078.1|73826_74564_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_007973080.1|74689_75601_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007973082.1|75815_76868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098477673.1|77944_79046_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	1.3e-43
>prophage 2
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	98213	152022	5191653	transposase,protease	Ralstonia_phage(42.86%)	40	NA	NA
WP_088370886.1|98213_101936_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_042805242.1|102219_102690_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_007970023.1|102923_103580_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_007970025.1|103690_104761_+	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_005917446.1|104757_105069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042674615.1|105359_105890_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_042805243.1|106103_107264_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_042674613.1|107506_107695_+	CsbD family protein	NA	NA	NA	NA	NA
WP_007969091.1|108797_109760_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_098477673.1|109832_110935_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	1.3e-43
WP_049963129.1|111484_111952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088370749.1|112274_113285_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	36.9	1.8e-47
WP_016849085.1|113550_114753_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_042805499.1|114909_117048_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	1.1e-67
WP_042675319.1|117254_117551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042805500.1|117746_118259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007971530.1|118642_120172_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_007971531.1|120349_120745_+	DUF779 domain-containing protein	NA	NA	NA	NA	NA
WP_022557861.1|120850_121030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003489963.1|121271_121580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007971536.1|121579_122539_+	Ku protein	NA	NA	NA	NA	NA
WP_007971538.1|122675_123842_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_007971540.1|124089_125325_+	serine hydrolase	NA	NA	NA	NA	NA
WP_042805505.1|125410_126610_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003489973.1|126606_127239_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_007964731.1|127728_128127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042675311.1|128415_128964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007970760.1|129102_129501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007970758.1|129497_132845_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_007970756.1|133126_134335_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_007970754.1|134901_135924_-	sugar kinase	NA	NA	NA	NA	NA
WP_007970752.1|136209_138990_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_007969091.1|142278_143241_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_007969091.1|144465_145428_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_007962146.1|145542_146523_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	1.8e-100
WP_162269067.1|147127_147286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007969199.1|147282_147606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088370750.1|147738_148719_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.3	5.1e-100
WP_098477673.1|149749_150852_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	1.3e-43
WP_007962146.1|151041_152022_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	1.8e-100
>prophage 3
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	378063	438507	5191653	tRNA,transposase,integrase	Leptospira_phage(57.14%)	49	379191:379250	436139:437342
WP_088370746.1|378063_379150_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
379191:379250	attL	CCGACATCCCCCCAATTTTGAGTATCACCTCAGTTTGGAGTCCAATTCCCTACCCCAAGG	NA	NA	NA	NA
WP_098477673.1|379259_380361_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	1.3e-43
WP_007974272.1|381197_383036_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_007974270.1|383421_384783_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_082332486.1|384831_385098_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_003485643.1|385138_385684_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_007974266.1|387620_388880_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_007974265.1|389323_389854_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007974262.1|390021_391014_+	transporter	NA	NA	NA	NA	NA
WP_007968429.1|391047_391815_+	coniferyl-alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_007974260.1|391845_393339_+	benzaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_007974256.1|394749_395934_+	4-hydroxybenzoate 3-monooxygenase	NA	NA	NA	NA	NA
WP_039731177.1|396386_396899_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_007968439.1|397010_398510_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_007968441.1|398650_399472_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_042676213.1|399646_401161_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_007968445.1|401384_402212_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007974253.1|402707_403691_-	oxidoreductase	NA	NA	NA	NA	NA
WP_007974252.1|403791_404868_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_007974251.1|405119_405983_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_007974250.1|405979_406768_+	CoA-transferase subunit beta	NA	NA	NA	NA	NA
WP_007974249.1|406764_407973_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_007974248.1|408051_408786_+	protocatechuate 3,4-dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_007968458.1|408790_409354_+	protocatechuate 3,4-dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_042806138.1|409711_411064_+	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_007974245.1|411882_412296_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_007974244.1|412410_413337_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_042806136.1|413892_414753_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_007968468.1|414901_415762_+	serine protein kinase RIO	NA	NA	NA	NA	NA
WP_007974240.1|416034_417003_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	29.8	2.4e-25
WP_007974239.1|417297_417978_-	DUF2490 domain-containing protein	NA	NA	NA	NA	NA
WP_007974237.1|418214_420119_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_003485699.1|420692_421166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007968475.1|421323_422283_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_033481400.1|422267_422885_+	YdcF family protein	NA	NA	NA	NA	NA
WP_007974235.1|422927_423347_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_007974233.1|423582_424488_-	lipid A hydroxylase LpxO	NA	S4VR59	Pandoravirus	39.5	1.2e-37
WP_007968479.1|424736_425621_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_007968480.1|425688_426471_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_007974230.1|426515_427277_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_007968484.1|427378_427759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007968486.1|427946_429152_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_007968487.1|429236_430271_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_007974227.1|430320_431046_+	ComF family protein	NA	NA	NA	NA	NA
WP_007974225.1|431294_432200_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_007974223.1|432920_434114_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	50.9	6.7e-110
WP_007969091.1|434812_435775_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_098477673.1|436207_437309_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	1.3e-43
WP_088370746.1|437420_438507_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
436139:437342	attR	CCGACATCCCCCCAATTTTGAGTATCACCTCAGTTTGGAGTCCAATTCCCTACCCCAAGGAGATTGGACGTGAAGAAGCGTTTTACCGAAGAGCAGATCATCGGCTTCCTGCGCGAAGCCGAAGGCGGCGTGGCGATCAAGGATCTGTGCCGGCGCCATGGCTTCAGCGAGGCCTCGTACTATCTGTGGCGTAGCAAGTTCGGCGGCATGAGCGTGCCCGATGCCAAGCGGCTCAAGGACCTTGAGGCCGAGAACGCGCGGCTGAAGAAGTTGCTGGCCGAGCAGTTGTTCGAGAACGACCTGATCAAGGATGCGTTGCGAAAAAAGTGGTGAGCGCACCGGCGCGTCGTATGCTGGTGCGCGAGTGGATCGGGCGTGGTGCCAGCGAGCGTCGTGCGCTGGCAGTGATCGGCATGAGCGCCAGCGCGCTGCGCTATTGCCCACGCCAAGACCGCAACGGCGAACTGCGCGAGCGCATTCTTGCGTTGGCGCATCGCCATCGCCGCTACGGCGTGGGGATGATCTATCTCAAACTGCGACAGGAAGGACGCCTGGTGAACTACAAGCGCGTGGAGCGGTTGTATCGCGAGCAGCAGTTACAAGTCCGGCGCCGCCAGCGCAAGAAGGTACCGGTTGGCGAGCGTCAGCCGCTGCTGCGGCCAGCGCAGGCCAACCAGGTGTGGTCGATGGACTTCGTGTTCGACCGCTCCGCCGAAGGCCGAGTGATCAAGTGTCTGGTGATCGTGGACGACGCAACGCACGAAGCGGTCGCCATCGAGGTGGAGCGCGCGATCTCTGGGCACGGGGTTGCGCGCGTCCTGGATCGGTTGGCACACAGTCGCGGCCTGCCGCAGGTGATCCGCACCGACAACGGCAAGGAGTTTTGCGGTATGGCAATGGTCGCCTGGGCGCATGCCCGTGGCGTGCAGTTGCGGCTGATCCAACCAGGCAAACCGAACCAGAACGCCTACGTCGAATCCTTCAACGGCCGGCTACGCGATGAATGCCTCAACGAGCACTGGTTCCCGACGTTGCTGCACGCGCGCACCGAGATCGAACGCTGGCGACGCGAATACAACGAGGACCGACCCAAGAAAGCAATTGGCGGCATGACGCCGGCTGCGTATGCCCAACATCTGGCAAACACCGATATCATCAACCCCGGACTCTAAACCCGACCGCTACTCAGGGCGGGGGGACGTCG	NA	NA	NA	NA
>prophage 4
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	445927	519869	5191653	tail,transposase	Ralstonia_phage(50.0%)	57	NA	NA
WP_157768392.1|445927_446047_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099206383.1|446074_446260_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_007965402.1|448014_449004_-	pectate lyase	NA	NA	NA	NA	NA
WP_007972484.1|449202_449673_-	CesT family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_131438874.1|449727_450009_-	serine kinase	NA	NA	NA	NA	NA
WP_042675499.1|450087_450330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007965398.1|450339_451278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007972482.1|451274_452090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002802878.1|452086_452347_-	type III secretion system export apparatus subunit SctS	NA	NA	NA	NA	NA
WP_007972480.1|452351_452996_-	type III secretion system export apparatus subunit SctR	NA	NA	NA	NA	NA
WP_042805706.1|452982_453936_-	type III secretion system cytoplasmic ring protein SctQ	NA	NA	NA	NA	NA
WP_007965390.1|454028_454667_-	type III secretion system protein SctP	NA	NA	NA	NA	NA
WP_007972477.1|454666_456604_-	FHIPEP family type III secretion protein	NA	NA	NA	NA	NA
WP_007972475.1|456597_457671_-	type III secretion system export apparatus subunit SctU	NA	NA	NA	NA	NA
WP_007965384.1|457887_458343_+	HrpB1 family type III secretion system apparatus protein	NA	NA	NA	NA	NA
WP_007965382.1|458376_458769_+	type III secretion protein HrpB2	NA	NA	NA	NA	NA
WP_007972473.1|458770_459532_+	type III secretion inner membrane ring lipoprotein SctJ	NA	NA	NA	NA	NA
WP_007972471.1|459539_460169_+	type III secretion protein HrpB4	NA	NA	NA	NA	NA
WP_007965376.1|460153_460855_+	type III secretion system stator protein SctL	NA	NA	NA	NA	NA
WP_007972469.1|460844_462173_+	type III secretion system ATPase SctN	NA	NA	NA	NA	NA
WP_007972466.1|462165_462675_+	type III secretion protein HrpB7	NA	NA	NA	NA	NA
WP_007965371.1|462671_463502_+	type III secretion system export apparatus subunit SctT	NA	NA	NA	NA	NA
WP_007972464.1|463583_465407_+	type III secretion system outer membrane ring subunit SctC	NA	NA	NA	NA	NA
WP_007962146.1|465786_466767_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	1.8e-100
WP_007975737.1|467298_467703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007969091.1|467900_468863_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_007969478.1|469155_469719_+	lytic transglycosylase domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	39.4	5.2e-12
WP_042805092.1|470053_471622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007962146.1|471900_472881_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	1.8e-100
WP_007974834.1|474200_474542_-	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_173362066.1|474689_477284_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_042806228.1|477380_479489_-	phosphoglycerol transferase I	NA	NA	NA	NA	NA
WP_007974840.1|479915_481634_-	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.4	3.9e-34
WP_007967773.1|481882_482824_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_007974842.1|482904_484533_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_007974844.1|485020_486604_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_007974847.1|486600_488817_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_007974849.1|488819_490577_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_007974851.1|490573_492523_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_007974853.1|492519_495129_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_003486435.1|495149_495335_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_003486432.1|495452_497615_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_007974855.1|497631_498264_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_007974857.1|498635_499394_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	37.7	1.0e-10
WP_007974859.1|499769_501179_+	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_007967792.1|501403_501835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007967796.1|503545_504163_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007974865.1|504241_505390_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_007974867.1|505386_508485_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_162045113.1|508500_509424_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007967804.1|509612_509948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007974871.1|510309_511602_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.1	1.9e-46
WP_007974873.1|512054_513578_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_003486396.1|513574_513958_-	SH3 domain protein	NA	NA	NA	NA	NA
WP_007967812.1|513959_515030_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_007967814.1|515022_516111_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_007974877.1|516287_519869_-|tail	lamin tail domain-containing protein	tail	NA	NA	NA	NA
>prophage 5
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	748493	884317	5191653	transposase,integrase	Leptospira_phage(18.18%)	91	795815:795874	800272:800684
WP_007975311.1|748493_749474_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_007970540.1|749575_750400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007970538.1|750489_751698_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_007970536.1|751697_752213_-	3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA	NA	NA	NA	NA	NA
WP_007970533.1|752559_753639_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_007970530.1|753781_754432_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_157835079.1|754863_757080_+	FepA family TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_007970525.1|757138_758107_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_022559997.1|758145_758532_-	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_003484068.1|758528_759011_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_007970523.1|759341_760016_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_007970521.1|760129_760465_-	phasin family protein	NA	NA	NA	NA	NA
WP_088370744.1|762413_763501_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_042805257.1|764269_764623_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_042805258.1|764892_767514_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.6	8.8e-46
WP_088370744.1|769900_770987_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_003484084.1|771366_772749_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	9.3e-55
WP_173362018.1|773057_774116_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_007969488.1|774147_774810_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_003484093.1|775338_776472_-	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_173362029.1|776654_776954_+	DUF4398 domain-containing protein	NA	NA	NA	NA	NA
WP_007964831.1|776950_777841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003484103.1|778192_778411_+	YdcH family protein	NA	NA	NA	NA	NA
WP_007964832.1|778649_780020_+	pyridoxal-phosphate dependent enzyme	NA	A0A1X9I5F1	Streptococcus_phage	38.5	2.0e-49
WP_007971000.1|780108_781296_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_007971002.1|781668_784788_+	glycosyltransferase	NA	A0A218MKE2	uncultured_virus	24.4	1.4e-13
WP_007971003.1|784870_785665_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_007964837.1|785661_786948_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	22.5	2.2e-10
WP_007971004.1|787012_789160_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_007971005.1|789159_791676_+	glycosyltransferase family 4 protein	NA	A0A2K9VGK0	Pontimonas_phage	27.9	4.2e-05
WP_003484125.1|791787_792828_+	GDP-mannose 4,6-dehydratase	NA	M1HVB5	Paramecium_bursaria_Chlorella_virus	54.2	5.8e-102
WP_007971006.1|792805_793705_+	GDP-mannose 4,6-dehydratase	NA	NA	NA	NA	NA
WP_131438843.1|793754_795728_+	hypothetical protein	NA	NA	NA	NA	NA
795815:795874	attL	TCCTGATTAGCCCTATCCCTCAGCCATGAAAGTTGCTTGCCATGCGCAAAACGCTCTCTG	NA	NA	NA	NA
WP_088370744.1|796307_797394_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_088370758.1|797428_798268_-	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_042805040.1|798618_799809_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	57.2	1.2e-119
WP_007969091.1|800290_801253_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
800272:800684	attR	TCCTGATTAGCCCTATCCCTCAGCCATGAAAGTTGCTTGCCATGCGCAAAACGCTCTCTGGGCAAGGCGTACAGCGCATCAGCGCCGTCGCCAGTCGCGGCAGCATCTGCTCCAGACGAAATCGGCGGTTGAATCGATAGGCCGCTTCGGCCAGGTAGCGCCGCGCATATTTGGCCTGGCGCACCGCGTGGTAGGTGCCGCTGATGGCACGTTTAACATTGCCCAGCACCACATTCAACCAGCGGGCCCCCTGGACTTCGGTTGCAGCACGAGCGCCGTCGGTATCGAGGGTGGTGTGGGCATGCCCGGCCTCCTCCAGACGGCGAAAGCACGCCAAGCCGTCGCTATAGACCTCACATCCCGGTTCCAGACGCCGCGCGATCCAGTCCTTCAGCGAGGCGTTGTCAAAGGCC	NA	NA	NA	NA
WP_007962146.1|801672_802653_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	1.8e-100
WP_007969828.1|802777_805975_+	YadA-like family protein	NA	NA	NA	NA	NA
WP_042805188.1|806077_808003_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	32.0	9.7e-18
WP_007969091.1|811106_812069_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_007972735.1|816863_818747_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	33.2	1.8e-24
WP_042805770.1|818876_820604_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_003490504.1|820779_821997_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_033481101.1|822237_822669_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_042805769.1|822678_823188_+	GspH/FimT family pseudopilin	NA	NA	NA	NA	NA
WP_007965181.1|823184_823601_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_007965183.1|823597_824233_+	type II secretion system protein J	NA	NA	NA	NA	NA
WP_042675433.1|824229_825081_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_007965187.1|825077_826199_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_007972728.1|826182_826836_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_007972727.1|826825_827623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007972726.1|827619_829911_+	type II secretion system secretin GspD	NA	A7BJX1	Enterobacteria_phage	22.6	3.6e-11
WP_131454214.1|829984_830257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042805772.1|830370_831198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007965195.1|831611_832340_-	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_007972724.1|832445_833021_-	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_007972723.1|833245_835408_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_007972722.1|835439_836597_-	phosphotransferase	NA	NA	NA	NA	NA
WP_007972718.1|837232_838072_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_007972716.1|838199_839234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042805768.1|841202_842498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007972714.1|842479_843448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007972712.1|843837_845016_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	32.8	4.5e-50
WP_007965213.1|845217_845673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088370746.1|845978_847065_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_042805110.1|847460_849605_+	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_082336374.1|849610_851977_+	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_042805112.1|851973_853146_+	cellulase	NA	NA	NA	NA	NA
WP_088370759.1|853127_857657_+	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
WP_022559930.1|859539_859965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007963670.1|860311_860734_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	61.5	1.5e-40
WP_007963672.1|861067_861583_+	peptide deformylase	NA	NA	NA	NA	NA
WP_007972228.1|861801_862746_-	DegV family protein	NA	NA	NA	NA	NA
WP_131438865.1|863227_863641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082336469.1|863558_864044_+	glycosyl hydrolase family 5	NA	NA	NA	NA	NA
WP_007972231.1|864433_866023_-	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_042805654.1|866377_866692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007972234.1|866992_868273_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_007972236.1|868269_869679_-	amidohydrolase	NA	NA	NA	NA	NA
WP_173362041.1|869812_870379_+	DUF924 family protein	NA	A0A1V0SIY0	Klosneuvirus	38.1	1.2e-16
WP_007963687.1|871602_872529_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_007963688.1|872574_873366_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_007972239.1|873498_874170_-	methyltransferase	NA	NA	NA	NA	NA
WP_007972240.1|874631_875282_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_007963696.1|875281_876553_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_007972241.1|876845_879011_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.6	3.1e-49
WP_007972243.1|879007_880429_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_007969091.1|880480_881443_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_007962146.1|881954_882935_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	1.8e-100
WP_007969091.1|883354_884317_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	1134409	1216547	5191653	tRNA,transposase,integrase,protease	Leptospira_phage(50.0%)	67	1130951:1130968	1211215:1212417
1130951:1130968	attL	TCGCGCGCATGGTCGGCG	NA	NA	NA	NA
WP_007964566.1|1134409_1135168_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
1130951:1130968	attL	TCGCGCGCATGGTCGGCG	NA	NA	NA	NA
WP_007974042.1|1135390_1136185_-	thiazole synthase	NA	NA	NA	NA	NA
WP_022558627.1|1136234_1136435_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_033481344.1|1136623_1138408_+	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_007974045.1|1138851_1140186_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_088370762.1|1140257_1140443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007969091.1|1140524_1141487_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_131438931.1|1141794_1142058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007975745.1|1142324_1142720_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_042806308.1|1143165_1143717_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_007962146.1|1144090_1145071_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	1.8e-100
1144593:1144610	attR	TCGCGCGCATGGTCGGCG	NA	NA	NA	NA
WP_050780476.1|1145348_1145813_+	BLUF domain-containing protein	NA	NA	NA	NA	NA
1144593:1144610	attR	TCGCGCGCATGGTCGGCG	NA	NA	NA	NA
WP_007962146.1|1146892_1147873_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	1.8e-100
WP_007969286.1|1148615_1148918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007969284.1|1148990_1149869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042805052.1|1150367_1150874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007969091.1|1150985_1151948_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_173655848.1|1152841_1153075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088370746.1|1153584_1154671_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_007969091.1|1159466_1160429_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_007969370.1|1161041_1161413_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_042805064.1|1161498_1162149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017165118.1|1162320_1162554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007969368.1|1162645_1163713_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_007969367.1|1163959_1164886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007969366.1|1165011_1165398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098477673.1|1167287_1168390_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	1.3e-43
WP_082336386.1|1168530_1169145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082336385.1|1169285_1170149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042805181.1|1170288_1170993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100084197.1|1170995_1171622_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_007969773.1|1171812_1173738_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_007969771.1|1173734_1175378_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_050780412.1|1175434_1176550_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_007969091.1|1176777_1177740_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_007970013.1|1178388_1179234_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_042805235.1|1179225_1179453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007970012.1|1179519_1179912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173362023.1|1179960_1180278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007970010.1|1180514_1180856_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042805233.1|1181021_1182719_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_042805232.1|1182985_1183303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007970004.1|1183295_1187102_+	zeta toxin family protein	NA	NA	NA	NA	NA
WP_007970002.1|1187404_1188703_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_088370763.1|1190008_1190566_+	plasmid mobilization protein	NA	NA	NA	NA	NA
WP_042805530.1|1190816_1191845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050780436.1|1191860_1193432_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_007971688.1|1193515_1194262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007971690.1|1194264_1195098_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_025989230.1|1195719_1196196_-	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_042805534.1|1196183_1197818_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_007971696.1|1197814_1198951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007971699.1|1198960_1199947_-	patatin-like phospholipase family protein	NA	A0A1B2LRS3	Wolbachia_phage	28.1	2.1e-24
WP_046934610.1|1199953_1200178_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_042805538.1|1200451_1200844_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042805535.1|1200846_1201716_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_007962004.1|1202477_1203137_+	thermonuclease family protein	NA	NA	NA	NA	NA
WP_007962003.1|1203247_1203640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003490669.1|1203730_1204123_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_007971705.1|1204753_1206886_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_007971708.1|1208455_1208932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003490678.1|1208957_1209635_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_007971710.1|1209627_1210986_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_088370764.1|1211087_1211204_-	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_098477673.1|1211246_1212349_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	1.3e-43
WP_088370746.1|1213815_1214902_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_007969091.1|1215584_1216547_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	1646167	1702986	5191653	tRNA,tail,transposase,protease	Pseudomonas_phage(37.5%)	45	NA	NA
WP_050780463.1|1646167_1646575_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_007974410.1|1646574_1650246_-	putative Ig domain-containing protein	NA	A0A0A1IX03	Pseudomonas_phage	27.9	2.4e-86
WP_042806161.1|1650235_1650469_-	hypothetical protein	NA	A0A0A1IV01	Pseudomonas_phage	62.1	2.4e-16
WP_007974412.1|1650465_1650894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007974415.1|1650884_1651976_-	DUF2163 domain-containing protein	NA	NA	NA	NA	NA
WP_131438905.1|1651968_1653168_-	hypothetical protein	NA	B7SE08	Pseudomonas_virus	42.2	2.3e-78
WP_050780464.1|1653171_1655946_-|tail	phage tail length tape measure family protein	tail	A0A2H4J7J3	uncultured_Caudovirales_phage	25.7	1.5e-43
WP_007974420.1|1656119_1656635_-	hypothetical protein	NA	A0A0S4L2X3	Pseudomonas_phage	46.6	1.4e-24
WP_042806162.1|1656634_1657402_-	hypothetical protein	NA	J9SVZ4	Pseudomonas_phage	39.9	5.9e-43
WP_042806163.1|1657391_1657577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007974424.1|1657573_1658050_-	hypothetical protein	NA	A0A0S4L2X9	Pseudomonas_phage	49.0	4.1e-34
WP_007974425.1|1658046_1658520_-	DUF1320 domain-containing protein	NA	J9SNI4	Pseudomonas_phage	50.0	1.8e-34
WP_088370746.1|1658586_1659674_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_007967299.1|1660238_1660667_-	Rnf electron transport complex subunit RnfB	NA	NA	NA	NA	NA
WP_007971195.1|1660668_1661259_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_007971192.1|1661698_1663783_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003485424.1|1664032_1664482_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_007971190.1|1664713_1668310_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005924907.1|1668322_1669216_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.1	5.1e-22
WP_022559734.1|1669354_1669744_-	VOC family protein	NA	NA	NA	NA	NA
WP_007971187.1|1670091_1671489_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_007971186.1|1671485_1672451_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_042805467.1|1672639_1674577_-	DUF885 family protein	NA	NA	NA	NA	NA
WP_007965588.1|1674851_1675628_-	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_042805466.1|1675632_1676307_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	28.3	4.9e-09
WP_007971180.1|1676731_1678093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088370746.1|1678561_1679649_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_007973091.1|1680284_1681628_-	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_007973092.1|1681930_1682533_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_007965599.1|1682606_1683053_+	CopD family protein	NA	NA	NA	NA	NA
WP_007973094.1|1683669_1684548_-	type III secretion system effector protein	NA	NA	NA	NA	NA
WP_007966722.1|1684901_1685966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046932707.1|1686034_1686322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007966720.1|1686590_1688126_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.6	4.4e-98
WP_007973097.1|1688141_1688963_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.2	7.7e-65
WP_005924942.1|1689470_1690430_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_007973101.1|1690606_1694197_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.3	3.4e-181
WP_007965609.1|1694463_1695210_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	36.9	3.5e-24
WP_007965611.1|1695206_1696511_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_003485381.1|1696507_1697299_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_003485378.1|1697324_1697783_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_007965614.1|1697779_1698793_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_005911715.1|1698921_1699113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007973104.1|1699189_1701556_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_007973106.1|1701639_1702986_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 8
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	1712579	1771547	5191653	protease,tRNA,transposase,coat	Leptospira_phage(18.18%)	44	NA	NA
WP_022559712.1|1712579_1713614_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_007973125.1|1713610_1715962_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_007973127.1|1715978_1716749_-	molecular chaperone	NA	NA	NA	NA	NA
WP_008576696.1|1716757_1717309_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_088370744.1|1717562_1718650_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_088370774.1|1718735_1719686_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	2.2e-100
WP_007971765.1|1719959_1720736_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_007971766.1|1720732_1723342_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_007971767.1|1723364_1724567_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_007966645.1|1724756_1725113_+	arsenate reductase	NA	NA	NA	NA	NA
WP_007971770.1|1725359_1726490_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_007971771.1|1726782_1728477_+	asparagine synthase B	NA	A0A0P0C1V4	Ostreococcus_lucimarinus_virus	39.1	2.7e-88
WP_033481302.1|1728544_1729597_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_007971775.1|1730041_1732180_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042805544.1|1732606_1735024_-	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_087945314.1|1735120_1735657_+	bacterioferritin	NA	NA	NA	NA	NA
WP_007971781.1|1735923_1736580_-	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
WP_007971783.1|1737009_1739253_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.0	1.0e-82
WP_007966661.1|1739314_1740166_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014089765.1|1740288_1740729_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_173362037.1|1740770_1742243_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_007966664.1|1742253_1743447_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_007966665.1|1743453_1745034_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_042805456.1|1745475_1747665_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_007971104.1|1747842_1749612_-	M14 family metallopeptidase	NA	NA	NA	NA	NA
WP_042805455.1|1749975_1751541_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	24.8	1.8e-22
WP_007966672.1|1751548_1752157_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_005911777.1|1752463_1752652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042675912.1|1752878_1753148_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_007966673.1|1753199_1754045_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_007971099.1|1754111_1754612_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042805453.1|1754844_1757043_-	dipeptidyl carboxypeptidase II	NA	A0A1V0SID3	Klosneuvirus	28.2	2.8e-45
WP_007966677.1|1757417_1757903_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	35.5	4.0e-13
WP_007966679.1|1758052_1758832_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_007971094.1|1759032_1760913_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.5	4.7e-25
WP_088370775.1|1761035_1762016_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	2.3e-100
WP_007969635.1|1762371_1763889_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_173362020.1|1764950_1765589_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_088370772.1|1766157_1767244_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.4	3.2e-42
WP_007972080.1|1768534_1769020_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_003483561.1|1769247_1769463_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	5.0e-16
WP_007966687.1|1769601_1770081_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_007966688.1|1770213_1770642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007972081.1|1770716_1771547_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	1800491	1855485	5191653	transposase	Bacillus_phage(36.36%)	43	NA	NA
WP_007969091.1|1800491_1801454_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_007969319.1|1802404_1804786_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_088370778.1|1804915_1806005_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.6	5.5e-42
WP_039569573.1|1806224_1806515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007969297.1|1806744_1807860_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_007969295.1|1807814_1808330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007964018.1|1808455_1810519_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_007969441.1|1810681_1811098_+	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_003487537.1|1811541_1811724_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_042805086.1|1811857_1812898_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_007975311.1|1813840_1814821_-|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_007964007.1|1815700_1816999_-	alkaline phosphatase family protein	NA	A0A0M3PB47	Turkeypox_virus	34.6	1.3e-55
WP_007964005.1|1817035_1817581_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	50.6	2.7e-13
WP_007969594.1|1817577_1819041_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_007969593.1|1819188_1820415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007969592.1|1821151_1821688_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_007963996.1|1821713_1822115_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_007963995.1|1822141_1822462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042805556.1|1822458_1822701_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_042805557.1|1823473_1825372_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.3	1.7e-62
WP_042805558.1|1825629_1828041_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.8	9.6e-15
WP_007971843.1|1828153_1828876_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_007971845.1|1829082_1830210_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.3	2.2e-14
WP_007971847.1|1830374_1831322_-	DMT family transporter	NA	NA	NA	NA	NA
WP_007971849.1|1831724_1832555_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_007963982.1|1833155_1833656_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_050780440.1|1833597_1835274_+	serine hydrolase	NA	NA	NA	NA	NA
WP_007971853.1|1835419_1836685_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_007971854.1|1836748_1837942_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.7	2.8e-23
WP_005912893.1|1837938_1838628_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.5	8.0e-07
WP_007971856.1|1838732_1840202_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_022558952.1|1840221_1841058_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_007971860.1|1841080_1842187_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_007971862.1|1842183_1845243_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_007971865.1|1845446_1846043_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_007971867.1|1846216_1848049_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	8.0e-30
WP_042674840.1|1848266_1850072_-	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_007971872.1|1850413_1850812_+	aldehyde-activating protein	NA	NA	NA	NA	NA
WP_007971874.1|1850808_1851612_+	DUF4349 domain-containing protein	NA	NA	NA	NA	NA
WP_005912915.1|1851811_1852105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042805563.1|1852192_1852444_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_007962146.1|1853499_1854480_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	1.8e-100
WP_007969091.1|1854522_1855485_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	1859104	1912490	5191653	tRNA,transposase	Leptospira_phage(50.0%)	44	NA	NA
WP_088370744.1|1859104_1860191_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_088370887.1|1860188_1862060_-	type III secretion system effector protein	NA	NA	NA	NA	NA
WP_007962146.1|1862678_1863659_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	1.8e-100
WP_007962146.1|1863839_1864820_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	1.8e-100
WP_007975720.1|1866051_1866582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082336596.1|1866578_1867238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098477673.1|1868141_1869243_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	1.3e-43
WP_088370780.1|1869240_1869567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088370744.1|1869665_1870753_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_007969713.1|1871580_1875045_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_003488532.1|1875690_1876233_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_172955843.1|1876623_1877574_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_007962146.1|1877806_1878787_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	1.8e-100
WP_007962840.1|1878880_1879585_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.7	9.6e-32
WP_042805519.1|1879633_1881082_+	two-component system sensor histidine kinase CreC	NA	NA	NA	NA	NA
WP_007962838.1|1881208_1882021_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_007971609.1|1882440_1883760_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_007962836.1|1883767_1884187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042805517.1|1884183_1884834_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_007962834.1|1884958_1885843_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_007971607.1|1885862_1886954_+	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
WP_007971606.1|1887022_1888426_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_007971605.1|1888439_1888946_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_042805516.1|1889281_1889926_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007962821.1|1890032_1891247_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_007971603.1|1891261_1894405_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_007971602.1|1894406_1895918_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_007971601.1|1895910_1896585_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007971600.1|1896681_1897152_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_007971599.1|1897257_1898166_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003488570.1|1898391_1898595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007971596.1|1898918_1899833_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007971594.1|1899940_1901158_+	MFS transporter	NA	NA	NA	NA	NA
WP_007971592.1|1901313_1902345_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_007971590.1|1902427_1903024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007971589.1|1903025_1904489_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_007969091.1|1904514_1905477_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_098477673.1|1905703_1906805_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	1.3e-43
WP_088370781.1|1906982_1907279_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007969091.1|1907538_1908501_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_007975758.1|1908526_1909570_+	Fic family protein	NA	NA	NA	NA	NA
WP_042806309.1|1910045_1910450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162829054.1|1910437_1911175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007969091.1|1911527_1912490_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	2028865	2099315	5191653	tRNA,transposase,integrase	Leptospira_phage(20.0%)	53	2056772:2056787	2103651:2103666
WP_088370744.1|2028865_2029953_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_007966292.1|2030202_2030892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007966294.1|2031032_2031668_-	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_007966296.1|2031669_2031996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003485878.1|2031992_2032298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050780448.1|2032294_2032645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007972426.1|2032673_2034068_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	38.1	1.4e-79
WP_007966300.1|2034272_2034611_+	iron-sulfur cluster assembly accessory protein	NA	NA	NA	NA	NA
WP_003485869.1|2035013_2035445_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_002804494.1|2035456_2035687_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_007966301.1|2035934_2036384_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_007972428.1|2036533_2037499_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_007972430.1|2037682_2041186_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_005914888.1|2041242_2041974_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_042805701.1|2041980_2042364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007972432.1|2042511_2043633_-	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X6WGT4	Pacmanvirus	24.4	4.5e-07
WP_007972434.1|2043976_2046478_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.1	7.4e-119
WP_007972436.1|2046474_2047437_+	EF-P lysine aminoacylase GenX	NA	A0A1V0SAC0	Catovirus	26.2	2.8e-18
WP_007966318.1|2047545_2048232_+	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_007972437.1|2048424_2049489_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_007966320.1|2049698_2052398_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.4	4.4e-109
WP_042805702.1|2052624_2055093_+	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
WP_005914878.1|2055488_2056217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007972442.1|2056477_2058145_-	urocanate hydratase	NA	NA	NA	NA	NA
2056772:2056787	attL	CATCGCTTCGGTTTCG	NA	NA	NA	NA
WP_007966323.1|2058161_2059019_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_007972444.1|2059200_2060742_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	41.1	1.8e-78
WP_007972446.1|2060755_2061961_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_042805703.1|2062021_2063392_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_007972450.1|2063707_2064445_+	histidine utilization repressor	NA	NA	NA	NA	NA
WP_033481359.1|2064628_2065627_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_007972454.1|2066191_2066749_-	phasin family protein	NA	NA	NA	NA	NA
WP_008576246.1|2066911_2067187_-	polyhydroxyalkanoic acid system family protein	NA	NA	NA	NA	NA
WP_022559593.1|2067423_2068233_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_007972456.1|2068174_2068831_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_007969337.1|2070100_2071186_+	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	2.2e-75
WP_007969335.1|2071270_2072479_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_007969333.1|2072601_2073924_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_088370784.1|2075129_2076092_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_082336398.1|2076913_2081062_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_007962306.1|2081269_2081635_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_007962305.1|2081612_2082266_-	phophatidylserine decarboxylase associated domain-containing protein	NA	NA	NA	NA	NA
WP_007970204.1|2082298_2083135_-	putative DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_007970203.1|2083187_2084117_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_088370744.1|2085632_2086719_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_017158593.1|2087652_2088597_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_007971045.1|2088604_2089264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017158592.1|2089290_2090469_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_007971047.1|2090530_2091574_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_007971048.1|2091566_2092445_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_007971049.1|2092720_2093776_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_007969091.1|2093888_2094851_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_007971051.1|2095038_2096313_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_007971053.1|2096321_2099315_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	27.9	1.4e-87
2103651:2103666	attR	CGAAACCGAAGCGATG	NA	NA	NA	NA
>prophage 12
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	2103846	2142671	5191653	transposase,integrase	Xanthomonas_phage(65.52%)	48	2128175:2128234	2142651:2143845
WP_042805193.1|2103846_2104050_+	hypothetical protein	NA	A0A1D6ZIU2	Xanthomonas_phage	97.0	4.8e-29
WP_042805195.1|2104062_2104293_+	methyltransferase	NA	A0A1W6DXZ2	Xanthomonas_phage	94.7	2.1e-28
WP_007969856.1|2104430_2105864_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	76.9	2.3e-173
WP_007970474.1|2105863_2106193_+	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	95.4	1.6e-53
WP_007969859.1|2106192_2107386_+	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	91.4	1.5e-210
WP_007970477.1|2107387_2108068_+	conjugal transfer protein TrbP	NA	A0A1W6DY89	Xanthomonas_phage	76.5	1.6e-92
WP_082336405.1|2108549_2108810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007970480.1|2108844_2109480_-	conjugal transfer protein TrbP	NA	A0A1W6DY89	Xanthomonas_phage	80.8	2.3e-93
WP_007970482.1|2109481_2110675_-	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	95.7	5.9e-215
WP_007970474.1|2110674_2111004_-	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	95.4	1.6e-53
WP_007970484.1|2111003_2112437_-	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	76.7	3.3e-172
WP_042805195.1|2112573_2112804_-	methyltransferase	NA	A0A1W6DXZ2	Xanthomonas_phage	94.7	2.1e-28
WP_042805193.1|2112816_2113020_-	hypothetical protein	NA	A0A1D6ZIU2	Xanthomonas_phage	97.0	4.8e-29
WP_011347636.1|2113023_2113320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007970486.1|2113651_2114377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162045077.1|2114366_2114507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042805342.1|2114503_2114689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042805343.1|2114688_2114871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007970489.1|2115082_2115541_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_007970491.1|2115522_2115849_+	hypothetical protein	NA	S0F2N2	Stenotrophomonas_phage	38.2	5.4e-14
WP_088370786.1|2115915_2116227_+	chloride channel protein	NA	A0A1W6DXV7	Xanthomonas_phage	88.3	1.4e-48
WP_042805344.1|2116245_2116458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007970497.1|2116740_2118063_-	hypothetical protein	NA	Q4LAU4	Stenotrophomonas_phage	56.5	6.9e-132
WP_088370746.1|2118319_2119407_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_007969861.1|2119724_2120393_-	conjugal transfer protein TrbP	NA	A0A1D6ZIU7	Xanthomonas_phage	72.6	5.6e-82
WP_007969859.1|2120394_2121588_-	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	91.4	1.5e-210
WP_007969858.1|2121587_2121917_-	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	94.5	3.5e-53
WP_007969856.1|2121916_2123350_-	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	76.9	2.3e-173
WP_042805195.1|2123486_2123717_-	methyltransferase	NA	A0A1W6DXZ2	Xanthomonas_phage	94.7	2.1e-28
WP_042805193.1|2123729_2123933_-	hypothetical protein	NA	A0A1D6ZIU2	Xanthomonas_phage	97.0	4.8e-29
WP_011347636.1|2123936_2124233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007969851.1|2124560_2125280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162045071.1|2125269_2125410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082336388.1|2125406_2125592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131438830.1|2125575_2125818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007969847.1|2125957_2126359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098477673.1|2127064_2128166_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	1.3e-43
2128175:2128234	attL	GGTAATCCCCCCACTTTTAGCGGTCGCCAGAAGTGGAGCTAAGCGGCCATCGCCAACTTC	NA	NA	NA	NA
WP_088370746.1|2128212_2129300_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_007969253.1|2129907_2130750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007969255.1|2130861_2131917_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_088370746.1|2132556_2133644_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_157883161.1|2134339_2135227_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	G9L697	Escherichia_phage	50.9	3.6e-76
WP_007969091.1|2135483_2136446_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_007969691.1|2136612_2138178_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_007969694.1|2138304_2139762_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	3.1e-85
WP_007969695.1|2139928_2140840_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.1	2.3e-30
WP_007963232.1|2140890_2141211_+	DUF1244 domain-containing protein	NA	NA	NA	NA	NA
WP_088370746.1|2141584_2142671_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
2142651:2143845	attR	GAAGTTGGCGATGGCCGCTTAGCTCCACTTCTGGCGACCGCTAAAAGTGGGGGGATTACCCGTTGGCCGCCAGCGGTGCGGAGCGGATTCTGGCTGGCGTCGGCTTGGCTGGCGCCAAGGCAAGCCGCGCGGCGCCCGCGCCGTACCGCTGACGGCCAACCCGCCGGGAAGCGCCCTGTGGCGCGCCGATACCGTGTTGCGCGCCTTGTCTCGACGCGCCACAGCACGCTTCGCACTGACCTCAACGTACATGACACGCTCTAGTCGCGCGTCTGCGTCTGTACTTGTCCAGCCTGCGGTACCGCATCGGGATTCAGGGTGCGACTGCCGCGGCGCGGCCGCGTGAACGGCGTGGGCCGGGGTGCGGTAGGCACGGTGTTGCCATACATCAGCCTGGCTCCGGCCCGTGCATCGCCGGCAGCGATCTCCAGTTCGAAACGCTCGGCATCACGGCGGCGGACCTCACGCGAAATCATGCCAGCTTCGTCCTCGTCCACACCCAGCTCTACCAGCGCCACTTTGCCGAAGATCACCGCCGACTCGAAGGTCTCGCGGATCTGGTAATCCACTCCCGCCGCGACCAACTGCAGCGAATGCTGGCGGTCGTACGAACGCACCAGCAGCTTGGCATGCGGAAACTCTCGCGTTGCCAGCTCGACGATGCGATTAGCTGCCTCTTGATTGTCGACGCACACCGCAATCGCACGTGCGCTGTGTGCGCCGGAGGCGTGCAGCACATCGAGCCGGGTGCCGTCGCCGTAGTAGATCTTGAAACCGAATTCTTCCGCGCTTTGGATCATCTCGATGTCGTTATCGATGATGGTTACATCCACATCGCGCGCCAGCAGCGACTGACTGGCCACCTGCCCAAAGCGCCCGAAGCCGATGATCAACACGCTGCCGGTCTGGCCGCTGGCTGCTTCCACCCCATCCAGCGAAATCGCCGCTGCCGGCGTCAGCCGCCGTTGCAGCAGCACGAACAACGGCGTCAGTGCCATCGACAACACCACGATGGCGGTCAGGCTGGCATTGACCTGGGCATCGATGACGCCCGCTGCCGACGCGGCGGCAAACAGCACGAATGCGAACTCGCCGCCTTGTGCCATCAGCACACCACGGTCCAACGCCTGGCGATGGTCACTGCGCATCATCCGCGCCACCGCATAGATGCACACGCCCTTGCCCACCATCAGGG	NA	NA	NA	NA
>prophage 13
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	2176503	2219076	5191653	transposase	Leptospira_phage(22.22%)	37	NA	NA
WP_007970742.1|2176503_2177208_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	31.2	1.1e-16
WP_088370789.1|2177174_2177492_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157883183.1|2177515_2178022_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_088370744.1|2178070_2179157_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_007969091.1|2179535_2180498_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_088370791.1|2180488_2181532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007970654.1|2181628_2182093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007970655.1|2182481_2184014_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_042805372.1|2184594_2184879_+	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
WP_007970656.1|2184881_2185649_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_007965740.1|2185654_2186710_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_007970657.1|2186706_2187759_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_042675614.1|2187752_2188664_+	DMT family transporter	NA	NA	NA	NA	NA
WP_007970658.1|2188807_2189512_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_007970659.1|2189705_2190989_+	MFS transporter	NA	NA	NA	NA	NA
WP_007970660.1|2191132_2191864_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_007965749.1|2191844_2193110_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_007970661.1|2193315_2194542_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003481988.1|2194538_2195105_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_007970662.1|2195286_2196273_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_088370772.1|2196594_2197681_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.4	3.2e-42
WP_007969736.1|2197919_2199776_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005923413.1|2199974_2201537_-	sodium/sugar symporter	NA	A0A240F465	Aeromonas_phage	41.0	4.2e-88
WP_042805169.1|2201794_2204407_-	exo 1,3/1,4-beta-D-glucan glucohydrolase	NA	NA	NA	NA	NA
WP_042675619.1|2204841_2206797_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_007965756.1|2207007_2207631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007970218.1|2207634_2207979_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_007970221.1|2208135_2209650_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003481969.1|2209646_2210027_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_007970223.1|2210194_2211037_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_007965766.1|2211033_2211849_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	34.6	4.2e-31
WP_007965767.1|2211884_2212370_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_007965770.1|2212373_2213741_-	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	38.4	1.2e-25
WP_007965771.1|2214350_2215268_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_042805290.1|2215304_2216468_-	N-acetylmuramoyl-L-alanine amidase	NA	M1IEI0	Bacillus_phage	41.6	2.9e-09
WP_007975311.1|2216882_2217863_+|transposase	IS5-like element ISXfu2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.5	1.1e-97
WP_088370792.1|2218095_2219076_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	2.3e-100
>prophage 14
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	2259692	2270383	5191653	tRNA,transposase	Leptospira_phage(16.67%)	7	NA	NA
WP_088370746.1|2259692_2260779_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_042805593.1|2262867_2263080_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	74.5	5.1e-13
WP_007966762.1|2263219_2265868_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	40.0	9.7e-85
WP_007966764.1|2265969_2266458_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_003481871.1|2266770_2267805_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.3	5.1e-114
WP_007972059.1|2267977_2268619_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_007966769.1|2268706_2270383_-	2-polyprenylphenol 6-hydroxylase	NA	G8DDN0	Micromonas_pusilla_virus	29.4	1.9e-41
>prophage 15
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	2290533	2430391	5191653	tRNA,transposase,integrase	Leptospira_phage(50.0%)	109	2350474:2350533	2429257:2430455
WP_007962146.1|2290533_2291514_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	1.8e-100
WP_005914995.1|2291589_2291832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007969183.1|2291996_2293886_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	33.8	2.1e-89
WP_007969091.1|2293972_2294935_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_007969091.1|2295226_2296189_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_131454090.1|2296284_2297016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098477673.1|2297012_2298115_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	1.3e-43
WP_042675941.1|2300143_2300905_-	YdcF family protein	NA	NA	NA	NA	NA
WP_007966804.1|2301011_2302139_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_007966806.1|2302148_2302775_-	DUF47 family protein	NA	NA	NA	NA	NA
WP_007966808.1|2303047_2304388_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_007972292.1|2304371_2305040_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_007972293.1|2305074_2305575_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_007972294.1|2305635_2306637_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007972295.1|2306983_2308408_+	MFS transporter	NA	NA	NA	NA	NA
WP_042805669.1|2308621_2310343_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	33.9	5.6e-09
WP_007972297.1|2310436_2311495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042805670.1|2311626_2313180_+	B12-binding domain-containing radical SAM protein	NA	NA	NA	NA	NA
WP_007972299.1|2313236_2314451_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_007972301.1|2314543_2315665_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_007972302.1|2315661_2316792_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_007966825.1|2316916_2317615_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_088370793.1|2317611_2318847_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_007972304.1|2318859_2319702_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_007966828.1|2319985_2320837_-	chain-length determining protein	NA	NA	NA	NA	NA
WP_007972305.1|2320881_2322015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007972306.1|2322011_2322950_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_007972307.1|2322946_2324200_-	O-antigen translocase	NA	NA	NA	NA	NA
WP_082336474.1|2324196_2325321_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	28.1	3.2e-29
WP_082336475.1|2325308_2326220_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007972312.1|2326227_2327181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007966838.1|2327184_2327856_-	acetyltransferase	NA	NA	NA	NA	NA
WP_007972313.1|2327852_2328290_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_007966841.1|2328705_2329215_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_007972314.1|2329298_2330642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042805674.1|2330668_2331061_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_042675163.1|2331577_2332300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007964109.1|2332351_2332945_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_007964107.1|2332941_2333598_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_007970697.1|2333594_2334920_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	39.2	1.5e-22
WP_007970695.1|2334930_2335689_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_039569300.1|2335685_2335892_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_007970694.1|2335888_2336359_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_007970692.1|2336425_2338414_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_042675158.1|2338410_2338953_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_007970691.1|2338952_2339450_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_042805378.1|2339443_2340139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007970689.1|2340506_2342579_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_007964093.1|2342565_2344083_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_033481396.1|2344381_2344726_+	response regulator	NA	NA	NA	NA	NA
WP_088370794.1|2344833_2347689_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_007964087.1|2348153_2348618_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007970687.1|2348654_2349845_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
2350474:2350533	attL	CGACGTCCCCCCGCCCTGAGTAGCGGTCGGGTTTAGAGTCCGGGGTTGATGATATCGGTG	NA	NA	NA	NA
WP_098477673.1|2350505_2351608_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	1.3e-43
WP_088370746.1|2351763_2352851_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_042805069.1|2352927_2353212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007969389.1|2353318_2353831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007969391.1|2353831_2354281_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_007969393.1|2354295_2355768_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_007969395.1|2356300_2357317_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088370744.1|2357942_2359029_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_007969978.1|2359526_2360807_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.4	7.4e-99
WP_042805225.1|2360918_2361581_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_007969972.1|2362628_2363051_+	DedA family protein	NA	NA	NA	NA	NA
WP_042805224.1|2363189_2363468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007969968.1|2363784_2364792_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_007969966.1|2365019_2366333_-	sorbosone dehydrogenase family protein	NA	NA	NA	NA	NA
WP_005916026.1|2366329_2366746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088370746.1|2367715_2368802_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_050780414.1|2369867_2370572_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_033481483.1|2370568_2371591_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.7	2.3e-10
WP_039731535.1|2371806_2372082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042805218.1|2373164_2375909_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_042805217.1|2376397_2377513_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_088370795.1|2380067_2381155_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.2e-43
WP_007970310.1|2381793_2383278_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_050780423.1|2383396_2384419_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_007970314.1|2384415_2385027_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_007970316.1|2385332_2395544_-	autotransporter-associated beta strand repeat-containing protein	NA	NA	NA	NA	NA
WP_007969091.1|2395763_2396726_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_005916070.1|2396937_2397195_-	stress-induced protein	NA	NA	NA	NA	NA
WP_007963473.1|2399083_2400061_+	siroheme synthase	NA	NA	NA	NA	NA
WP_042674992.1|2400227_2400386_-	XapX domain-containing protein	NA	NA	NA	NA	NA
WP_042805275.1|2400382_2400613_-	DUF1427 family protein	NA	NA	NA	NA	NA
WP_007970169.1|2400618_2402247_-	MFS transporter	NA	NA	NA	NA	NA
WP_007970171.1|2402341_2404189_-	amidohydrolase	NA	NA	NA	NA	NA
WP_042805277.1|2404302_2404686_-	DoxX family protein	NA	NA	NA	NA	NA
WP_007970176.1|2404722_2405379_-	hydrolase	NA	NA	NA	NA	NA
WP_007970178.1|2405375_2405849_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088370746.1|2407821_2408908_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_007970341.1|2409238_2409880_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_007970342.1|2410135_2411263_+	Cache 3/Cache 2 fusion domain-containing protein	NA	NA	NA	NA	NA
WP_007970344.1|2411307_2411922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042805313.1|2413275_2414844_+	oxidoreductase	NA	NA	NA	NA	NA
WP_042805314.1|2414865_2417310_+	DUF2309 domain-containing protein	NA	NA	NA	NA	NA
WP_162829047.1|2417556_2417721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162269069.1|2418629_2418968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042805317.1|2418973_2419624_+	recombinase family protein	NA	NA	NA	NA	NA
WP_007970355.1|2419718_2420177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007970357.1|2420185_2420494_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_088370744.1|2421590_2422677_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_131438827.1|2423188_2423620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082336369.1|2423688_2424213_-	phenolic acid decarboxylase	NA	NA	NA	NA	NA
WP_007969500.1|2424873_2425737_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_007969501.1|2425757_2426519_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.8	3.6e-24
WP_007969091.1|2426557_2427520_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_162269070.1|2427615_2427909_-	DUF3861 family protein	NA	NA	NA	NA	NA
WP_007962146.1|2427956_2428937_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	1.8e-100
WP_098477673.1|2429288_2430391_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	1.3e-43
2429257:2430455	attR	CGACGTCCCCCCGCCCTGAGTAGCGGTCGGGTTTAGAGTCCGGGGTTGATGATATCGGTGTTTGCCAGATGTTGGGCATACGCAGCCGGCGTCATGCCGCCAATTGCTTTCTTGGGTCGGTCCTCGTTGTATTCGCGTCGCCAGCGTTCGATCTCGGTGCGCGCGTGCAGCAACGTCGGGAACCAGTGCTCGTTGAGGCATTCATCGCGTAGCCGGCCGTTGAAGGATTCGACGTAGGCGTTCTGGTTCGGTTTGCCTGGTTGGATCAGCCGCAACTGCACGCCACGGGCATGCGCCCAGGCGACCATTGCCATACCGCAAAACTCCTTGCCGTTGTCGGTGCGGATCACCTGCGGCAGGCCGCGACTGTGTGCCAACCGATCCAGGACGCGCGCAACCCCGTGCCCAGAGATCGCGCGCTCCACCTCGATGGCGACCGCTTCGTGCGTTGCGTCGTCCACGATCACCAGACACTTGATCACTCGGCCTTCGGCGGAGCGGTCGAACACGAAGTCCATCGACCACACCTGGTTGGCCTGCGCTGGCCGCAGCAGCGGCTGACGCTCGCCAACCGGTACCTTCTTGCGCTGGCGGCGCCGGACTTGTAACTGCTGCTCGCGATACAACCGCTCCACGCGCTTGTAGTTCACCAGGCGTCCTTCCTGTCGCAGTTTGAGATAGATCATCCCCACGCCGTAGCGGCGATGGCGATGCGCCAACGCAAGAATGCGCTCGCGCAGTTCGCCGTTGCGGTCTTGGCGTGGGCAATAGCGCAGCGCGCTGGCGCTCATGCCGATCACTGCCAGCGCACGACGCTCGCTGGCACCACGCCCGATCCACTCGCGCACCAGCATACGACGCGCCGGTGCGCTCACCACTTTTTTCGCAACGCATCCTTGATCAGGTCGTTCTCGAACAACTGCTCGGCCAGCAACTTCTTCAGCCGCGCGTTCTCGGCCTCAAGGTCCTTGAGCCGCTTGGCATCGGGCACGCTCATGCCGCCGAACTTGCTACGCCACAGATAGTACGAGGCCTCGCTGAAGCCATGGCGCCGGCACAGATCCTTGATCGCCACGCCGCCTTCGGCTTCGCGCAGGAAGCCGATGATCTGCTCTTCGGTAAAACGCTTCTTCACGTCCAATCTCCTTGGGGTAGGGAATTGGACTCCAAACTGAGGTGATACTCAAAATTGGGGGGAT	NA	NA	NA	NA
>prophage 16
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	2618892	2691642	5191653	transposase	uncultured_Caudovirales_phage(36.84%)	49	NA	NA
WP_098477673.1|2618892_2619994_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	1.3e-43
WP_007969671.1|2620486_2620858_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_088370806.1|2620871_2622596_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_005918162.1|2622606_2623596_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_005918165.1|2623592_2624213_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_005918170.1|2624209_2625586_+	FliI/YscN family ATPase	NA	NA	NA	NA	NA
WP_005918178.1|2625589_2626045_+	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_042805142.1|2626041_2627334_+	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_173362021.1|2627499_2628051_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_005917976.1|2628061_2629075_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_007969679.1|2629071_2629410_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_005921346.1|2629406_2629814_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_007969680.1|2629815_2630661_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_088370746.1|2630869_2631956_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_005917968.1|2632728_2632998_+	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
WP_007975658.1|2633011_2633803_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_088370746.1|2634092_2635179_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_088370807.1|2635205_2638055_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	31.4	3.9e-15
WP_089112489.1|2638430_2641352_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.0	3.5e-11
WP_007970797.1|2641622_2643710_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	34.3	1.5e-19
WP_007970795.1|2643863_2644994_+	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_029819345.1|2645011_2647084_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_088370808.1|2648022_2649714_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_005918202.1|2649700_2650585_+	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_005918198.1|2650581_2651349_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_002813536.1|2651371_2651764_+	chemotaxis protein CheY	NA	NA	NA	NA	NA
WP_007970783.1|2651763_2652390_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_007970781.1|2652392_2654051_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_088370744.1|2654278_2655365_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_131454219.1|2655362_2656472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005914940.1|2660954_2661695_+	flagellar motor protein	NA	NA	NA	NA	NA
WP_005931860.1|2661701_2662676_+	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_003489696.1|2662677_2663460_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.1	5.9e-14
WP_007971282.1|2663456_2664731_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_003489692.1|2664833_2665142_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_002806565.1|2665138_2665504_+	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_007971284.1|2665537_2667538_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_042805473.1|2667778_2670070_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.7	1.5e-09
WP_033481115.1|2670388_2670922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007971288.1|2671650_2673828_+	cache domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	53.6	3.2e-09
WP_042805474.1|2673900_2676690_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.8	1.3e-10
WP_007962534.1|2676992_2677754_+	transporter	NA	NA	NA	NA	NA
WP_042805475.1|2677767_2680137_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.4	4.9e-11
WP_088370746.1|2682075_2683162_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_082336594.1|2683203_2683815_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	77.5	3.2e-07
WP_007962146.1|2683929_2684910_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	1.8e-100
WP_007969229.1|2685476_2687735_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	9.3e-12
WP_098477673.1|2687922_2689024_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	1.3e-43
WP_042674369.1|2689530_2691642_+	CHASE3 domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.8	3.0e-12
>prophage 17
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	2732976	2798445	5191653	tRNA,transposase	Leptospira_phage(25.0%)	60	NA	NA
WP_007973515.1|2732976_2734494_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.7	7.2e-85
WP_099050317.1|2734704_2735830_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.7	9.4e-05
WP_042805941.1|2737186_2738401_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_007973510.1|2738727_2740467_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.6	4.2e-44
WP_007973508.1|2740463_2741384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003486289.1|2741400_2741865_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_007973506.1|2741873_2745116_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_007962953.1|2745124_2745568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042674829.1|2745567_2746743_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	31.8	6.3e-44
WP_007962949.1|2746982_2747699_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_042674827.1|2748107_2748827_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_046121198.1|2748823_2750026_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_007962945.1|2750253_2750754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022559069.1|2750813_2751068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007962944.1|2751069_2752929_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_003486267.1|2752925_2753174_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_088370811.1|2753288_2754086_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_042674819.1|2754082_2754472_+	VOC family protein	NA	NA	NA	NA	NA
WP_007973499.1|2754578_2755475_+	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	33.3	1.0e-33
WP_007962940.1|2755611_2756382_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.2	3.4e-14
WP_007962938.1|2756502_2757069_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_007962937.1|2757068_2757455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007973497.1|2757682_2759539_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_005915396.1|2759535_2759835_-	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
WP_007973496.1|2759869_2761288_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_007973495.1|2761496_2762738_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.9	9.7e-104
WP_087945324.1|2762871_2763483_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_022559057.1|2763624_2765097_+	amino acid permease	NA	NA	NA	NA	NA
WP_007962121.1|2765173_2766604_+	amino acid permease	NA	NA	NA	NA	NA
WP_007962123.1|2766693_2767347_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_005915388.1|2767382_2767949_+	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_007962134.1|2767951_2768650_+	acireductone synthase	NA	NA	NA	NA	NA
WP_088370804.1|2768887_2769974_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.4	1.9e-42
WP_088370812.1|2770110_2771697_-	calcineurin-like phosphoesterase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_007963934.1|2771865_2772486_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_007970958.1|2772475_2773252_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_007970957.1|2773245_2773980_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_007963930.1|2773976_2774579_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_007963926.1|2774575_2775703_-	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_007970954.1|2775699_2776791_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_007970952.1|2776787_2778083_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_007970951.1|2778079_2778994_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_007970950.1|2779003_2779327_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_042675106.1|2779952_2781365_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.4	1.0e-40
WP_172955836.1|2781568_2782234_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042675105.1|2782319_2783063_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_173362027.1|2783163_2784474_-	threonine synthase	NA	NA	NA	NA	NA
WP_042675108.1|2784629_2784944_+	EthD family reductase	NA	NA	NA	NA	NA
WP_007970948.1|2785018_2785999_-	homoserine kinase	NA	NA	NA	NA	NA
WP_007970947.1|2786040_2788548_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_007970946.1|2789234_2789735_-	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_157883184.1|2790200_2790374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007962146.1|2790354_2791335_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	1.8e-100
WP_131438933.1|2792916_2793168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131454068.1|2793172_2793442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088370744.1|2793546_2794634_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_007975469.1|2794722_2795685_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_131477119.1|2795753_2796095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007969091.1|2796108_2797071_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_088370746.1|2797357_2798445_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
>prophage 18
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	2925466	3010729	5191653	tRNA,transposase,protease	Bacillus_phage(20.0%)	59	NA	NA
WP_007965679.1|2925466_2925907_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.0	7.1e-25
WP_005915265.1|2925985_2926621_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_007975178.1|2926906_2927851_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_007969900.1|2928072_2928831_-	cytochrome c1	NA	NA	NA	NA	NA
WP_007969898.1|2928823_2930083_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_007965672.1|2930082_2930727_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_007969896.1|2931235_2932219_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.9	7.4e-30
WP_007965669.1|2932412_2933378_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_007969894.1|2933483_2934128_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_007965666.1|2934166_2935621_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_088370817.1|2936041_2937025_+	PhoH family protein	NA	A0A1B2ICF6	Erwinia_phage	48.6	7.3e-46
WP_003488340.1|2937673_2938159_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_007963745.1|2938158_2938677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003488337.1|2938772_2939651_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_042805246.1|2939647_2940931_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_007970040.1|2940946_2941948_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_172955830.1|2942099_2943491_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_042805248.1|2943670_2944519_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_050780418.1|2944515_2945427_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_007970045.1|2945555_2946689_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	2.8e-25
WP_007970047.1|2946802_2948293_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_022559356.1|2948297_2949884_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_007963775.1|2949880_2951083_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_007972327.1|2951330_2952446_-	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_007972329.1|2952665_2954033_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_007963778.1|2954629_2956015_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_007972331.1|2956021_2956777_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_007972333.1|2956920_2958300_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_173362043.1|2958296_2959616_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007972337.1|2959700_2960999_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.6	1.1e-20
WP_005915313.1|2961128_2961590_+	bacteriohemerythrin	NA	NA	NA	NA	NA
WP_007972338.1|2961709_2962990_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_022559366.1|2963684_2963963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007972339.1|2963952_2966301_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_007972340.1|2966297_2967143_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_005915324.1|2967149_2968829_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_039731973.1|2970847_2971702_+	plasmid replication/partition related protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	39.8	6.4e-14
WP_007972342.1|2971932_2973237_+	DUF445 family protein	NA	NA	NA	NA	NA
WP_007972343.1|2973381_2977476_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.9	1.2e-57
WP_007972344.1|2977509_2978496_+	response regulator	NA	W8CYM9	Bacillus_phage	27.6	9.7e-06
WP_007962773.1|2979058_2980486_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_082336480.1|2980650_2981382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082336481.1|2981314_2983468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007975321.1|2984672_2985635_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_088370784.1|2986275_2987238_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_088370820.1|2987444_2988032_-	DUF1629 domain-containing protein	NA	NA	NA	NA	NA
WP_088370746.1|2988083_2989170_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_007962168.1|2989220_2989619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017154836.1|2989855_2990155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007969987.1|2990657_2995667_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_007969989.1|2995945_2996605_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007962519.1|2996619_2997924_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_007969992.1|2997936_3001107_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005917351.1|3001444_3002440_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_007969645.1|3002601_3005118_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	29.3	2.3e-11
WP_007969646.1|3005114_3006071_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_088370821.1|3006223_3007966_+	PTS fructose transporter subunit EIIBC	NA	NA	NA	NA	NA
WP_042805138.1|3008138_3009416_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_007969091.1|3009766_3010729_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	3213565	3273769	5191653	tRNA,transposase,protease	Leptospira_phage(13.33%)	46	NA	NA
WP_007973634.1|3213565_3214339_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_007973636.1|3214514_3214922_-	VOC family protein	NA	NA	NA	NA	NA
WP_042805963.1|3214918_3216847_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_007962932.1|3217539_3218565_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_007973640.1|3218647_3219721_-	D-glycerate dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	26.9	3.2e-18
WP_007973642.1|3219713_3220817_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
WP_007963936.1|3220827_3221754_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_042805965.1|3221834_3222485_+	SCO family protein	NA	NA	NA	NA	NA
WP_007973647.1|3222481_3223324_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_007963939.1|3223553_3225137_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	5.5e-11
WP_007973649.1|3225429_3226935_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	4.2e-85
WP_007973651.1|3226988_3227609_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_088370746.1|3229531_3230618_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_088370828.1|3230584_3232042_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_007963950.1|3232152_3232659_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_007963954.1|3234532_3235195_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_007963955.1|3235191_3235626_+	HIT family protein	NA	NA	NA	NA	NA
WP_003486900.1|3235653_3235821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022559000.1|3236066_3236252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005912996.1|3236408_3236978_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.6	4.1e-73
WP_007963958.1|3237074_3237926_-	iron-sulfur cluster carrier protein ApbC	NA	Q8JL10	Natrialba_phage	27.0	7.1e-05
WP_007970550.1|3238263_3241248_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.6	2.7e-14
WP_007963962.1|3241609_3244672_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_007962146.1|3244734_3245715_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	1.8e-100
WP_007963964.1|3245878_3247639_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_042805062.1|3247990_3250093_+	peptidase	NA	A0A1V0SHG2	Klosneuvirus	27.7	1.2e-72
WP_042805121.1|3250477_3252577_+	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.7	3.3e-72
WP_007969573.1|3252760_3254776_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_003486879.1|3254960_3255656_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_007964761.1|3255696_3256104_-	MGMT family protein	NA	NA	NA	NA	NA
WP_088370829.1|3256434_3257379_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_039730924.1|3257624_3258995_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.0	1.4e-39
WP_042805402.1|3258991_3260242_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007970778.1|3260249_3261494_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_007964764.1|3261725_3262205_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_042805401.1|3262314_3262857_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.2	1.2e-18
WP_017168813.1|3262966_3263716_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_007964766.1|3263923_3264415_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_007964767.1|3264649_3265486_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_042805398.1|3265495_3266836_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_042805397.1|3266978_3268685_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_042805396.1|3269054_3270356_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_003486852.1|3270387_3270648_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_007970765.1|3270649_3271525_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_162269063.1|3272080_3272686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088370746.1|3272682_3273769_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
>prophage 20
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	3534313	3646678	5191653	transposase,integrase,protease	Leptospira_phage(25.0%)	84	3626872:3626888	3649760:3649776
WP_088370746.1|3534313_3535400_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_007971812.1|3536385_3538506_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_007971813.1|3538800_3539646_-	transporter	NA	NA	NA	NA	NA
WP_007971815.1|3540348_3542319_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_003490255.1|3542742_3543561_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_162829048.1|3543825_3544002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172955903.1|3544068_3544503_-	VOC family protein	NA	NA	NA	NA	NA
WP_042805552.1|3544741_3547993_-	error-prone DNA polymerase	NA	A0A1C9LWI9	Streptomyces_phage	25.3	4.8e-86
WP_007971821.1|3548173_3549592_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_007965488.1|3549601_3550255_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_007971824.1|3550256_3550862_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	36.9	4.7e-11
WP_014502325.1|3551011_3551233_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_007971826.1|3551242_3551668_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	45.1	1.8e-09
WP_007971828.1|3551873_3552389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007971831.1|3552551_3552902_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_007965495.1|3552964_3553558_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_007971833.1|3553554_3554871_-	DUF763 domain-containing protein	NA	NA	NA	NA	NA
WP_007965498.1|3555147_3555726_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_042805554.1|3555698_3556787_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_007971837.1|3556783_3559081_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_088370836.1|3559513_3560600_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_007970896.1|3560706_3563235_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.4	6.7e-152
WP_007965505.1|3563491_3564130_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_007970894.1|3564422_3565169_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_007965509.1|3565330_3565636_-	UBP-type zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_007970892.1|3565632_3567342_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007970890.1|3567695_3568325_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	NA	NA	NA	NA
WP_042675543.1|3568356_3568539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007965515.1|3568486_3569467_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_007970887.1|3569742_3572097_+	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_007970882.1|3573427_3575233_+	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_007962146.1|3575479_3576460_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	1.8e-100
WP_088370837.1|3576522_3578001_-	glycoside hydrolase family 30 protein	NA	NA	NA	NA	NA
WP_042805133.1|3578322_3579192_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_007969632.1|3579191_3579971_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_042805134.1|3580186_3580816_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042805135.1|3580878_3581655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088370746.1|3582075_3583162_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_042805044.1|3583261_3584836_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_042805045.1|3585080_3585347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088370746.1|3586690_3587778_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_007969091.1|3588023_3588986_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_088370838.1|3589071_3589269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088370839.1|3589265_3590519_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_007969091.1|3590616_3591579_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_042805640.1|3591669_3593511_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	27.2	5.4e-34
WP_007972186.1|3593640_3594204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007972187.1|3594308_3595697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007972190.1|3596001_3597048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007972192.1|3597373_3598003_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007972194.1|3598074_3598788_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_082336465.1|3599041_3599254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007972196.1|3599510_3602183_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.6	4.7e-79
WP_005913957.1|3602550_3603843_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	38.4	5.8e-75
WP_007972197.1|3604355_3605219_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_007972198.1|3605218_3606346_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_005996155.1|3607041_3607428_-	twitching motility response regulator PilH	NA	W8CYM9	Bacillus_phage	31.8	5.6e-10
WP_003483926.1|3607916_3608816_-	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	28.0	7.0e-19
WP_007972201.1|3609227_3609704_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_003483924.1|3609866_3610349_+	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	38.3	7.0e-26
WP_003483923.1|3610391_3610952_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_087945318.1|3611299_3613702_-	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_007962234.1|3614136_3615084_-	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	36.0	3.8e-07
WP_007972205.1|3615231_3618219_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_173361968.1|3618441_3623343_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_042676284.1|3624067_3625066_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_007970368.1|3625143_3627360_-	TonB-dependent receptor	NA	NA	NA	NA	NA
3626872:3626888	attL	GACCACGCCTGCCGGCG	NA	NA	NA	NA
WP_007970366.1|3627574_3628774_-	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_007969091.1|3628908_3629871_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_007969292.1|3629966_3630524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007969022.1|3630533_3633128_-	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_007969021.1|3633334_3634489_-	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_007970235.1|3634564_3635461_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_172955784.1|3635587_3637207_+	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_039732060.1|3637438_3637765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050780421.1|3638346_3639537_+|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	28.1	3.3e-24
WP_007970239.1|3639539_3640007_-	Arc family DNA-binding protein	NA	A0A0U4B0M9	Pseudomonas_phage	74.3	1.0e-05
WP_042805296.1|3640109_3640319_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042805298.1|3640402_3640837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007970241.1|3640833_3641589_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_042805299.1|3642316_3642601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042805300.1|3642604_3642982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042805301.1|3643030_3644962_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	33.5	1.6e-65
WP_088370744.1|3645590_3646678_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
3649760:3649776	attR	CGCCGGCAGGCGTGGTC	NA	NA	NA	NA
>prophage 21
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	3824166	3892012	5191653	tRNA,transposase,integrase	Ralstonia_phage(18.18%)	57	3878907:3878936	3893582:3893611
WP_007965876.1|3824166_3824640_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_007972512.1|3824856_3826554_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	33.5	5.3e-28
WP_007972507.1|3828564_3830298_-	S8 family serine peptidase	NA	A0A2K9L1P3	Tupanvirus	37.4	1.5e-17
WP_007965884.1|3830606_3831692_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_003488784.1|3831756_3832311_-	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_007965888.1|3832497_3832917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007972506.1|3833271_3834729_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_026006968.1|3834725_3835031_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_003488792.1|3835154_3835718_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_042675658.1|3835714_3836065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005925947.1|3836070_3836562_+	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
WP_007972504.1|3836972_3838070_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_007962146.1|3838756_3839737_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	1.8e-100
WP_088370844.1|3839851_3840451_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007971450.1|3841900_3844258_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_007971452.1|3844480_3846712_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_007965906.1|3846842_3847418_+	nitroreductase	NA	NA	NA	NA	NA
WP_007965908.1|3847414_3848401_+	exodeoxyribonuclease IX	NA	A0A2H4IAS6	Erwinia_phage	27.0	3.7e-13
WP_007965909.1|3848397_3848949_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_042675662.1|3848941_3849727_+	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_007965913.1|3849933_3850875_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_007965914.1|3851116_3851977_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003488826.1|3852178_3852742_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_007971456.1|3852927_3854520_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	28.6	5.9e-21
WP_007965922.1|3854611_3855553_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007971458.1|3856064_3856505_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_007965924.1|3856558_3857527_+	transaldolase	NA	Q58MB1	Prochlorococcus_phage	25.1	1.0e-07
WP_007971460.1|3857883_3858453_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_007971463.1|3858871_3859522_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_007965927.1|3859617_3860133_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_007965928.1|3860257_3860965_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_007971465.1|3860961_3862872_+	CHASE3 domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	31.3	9.9e-23
WP_007965930.1|3862868_3863333_+	response regulator	NA	NA	NA	NA	NA
WP_022558382.1|3863427_3863658_-	DUF2007 domain-containing protein	NA	NA	NA	NA	NA
WP_007970430.1|3863659_3864301_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_007970431.1|3864790_3866530_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	55.4	2.8e-181
WP_050780425.1|3866635_3866899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007970432.1|3866910_3867840_+	DMT family transporter	NA	NA	NA	NA	NA
WP_162045075.1|3867943_3868153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033481634.1|3868506_3868887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007965277.1|3868886_3869447_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_007970434.1|3869483_3870527_+	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_007970435.1|3870839_3871949_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_007970436.1|3872071_3872977_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_007970438.1|3873058_3873781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042805335.1|3873979_3874381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007965267.1|3874510_3874984_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007970442.1|3875029_3875857_+	p-hydroxycinnamoyl CoA hydratase/lyase	NA	NA	NA	NA	NA
WP_007970444.1|3875938_3877408_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_007962146.1|3877797_3878778_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	1.8e-100
3878907:3878936	attL	TTGAGGGTCGGCAGGGATTCGTGTAAAAAA	NA	NA	NA	NA
WP_007964456.1|3879776_3880847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007971055.1|3880931_3882209_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_007971053.1|3882330_3885324_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	27.9	1.4e-87
WP_007971051.1|3885332_3886607_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_088370845.1|3886790_3887804_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_098477673.1|3889004_3890106_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	1.3e-43
WP_007969091.1|3891049_3892012_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
3893582:3893611	attR	TTTTTTACACGAATCCCTGCCGACCCTCAA	NA	NA	NA	NA
>prophage 22
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	4200131	4246198	5191653	transposase,protease	Bacillus_phage(20.0%)	31	NA	NA
WP_007973673.1|4200131_4201499_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.7	8.1e-43
WP_003482763.1|4201599_4202151_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_007965029.1|4202347_4203265_-	tyrosine recombinase XerC	NA	S5M872	Bacillus_phage	26.8	1.0e-12
WP_007973676.1|4203445_4204117_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_007973677.1|4204113_4204968_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_022558202.1|4204957_4205212_-	lipoprotein	NA	NA	NA	NA	NA
WP_003482768.1|4205268_4205667_-	YbaN family protein	NA	NA	NA	NA	NA
WP_042805972.1|4205906_4208042_-	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	25.1	1.8e-28
WP_007973682.1|4208151_4209336_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_007973684.1|4209726_4211820_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_007965016.1|4211887_4212199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003482775.1|4212577_4213147_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_005916857.1|4213256_4214222_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_005916853.1|4214770_4215571_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_007973688.1|4216125_4217040_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_007965008.1|4217070_4217808_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_007965004.1|4217838_4218891_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.5	1.1e-18
WP_007973690.1|4218895_4219564_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_007973691.1|4219724_4221662_-	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_007973693.1|4222729_4224379_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_042675723.1|4224554_4225535_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.2	2.4e-17
WP_007973696.1|4225939_4227427_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.1	1.7e-126
WP_042675720.1|4229076_4231263_+	cache domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	65.7	3.4e-11
WP_007975511.1|4232033_4233014_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.0	1.3e-98
WP_088370744.1|4233212_4234299_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_042805164.1|4234382_4237124_-	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	29.2	3.6e-10
WP_007969725.1|4237227_4240107_+	insulinase family protein	NA	NA	NA	NA	NA
WP_003489747.1|4240667_4241597_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_007975178.1|4241734_4242679_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_173362017.1|4243141_4244047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007969091.1|4245235_4246198_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	4276482	4346335	5191653	transposase	Leptospira_phage(27.27%)	59	NA	NA
WP_007969091.1|4276482_4277445_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_007972968.1|4277540_4278977_-	UdgX family uracil-DNA binding protein	NA	NA	NA	NA	NA
WP_003489593.1|4279267_4280512_-	putative DNA modification/repair radical SAM protein	NA	NA	NA	NA	NA
WP_007972967.1|4280719_4281538_-	dioxygenase	NA	NA	NA	NA	NA
WP_007965152.1|4281567_4281978_-	DoxX family protein	NA	NA	NA	NA	NA
WP_007965151.1|4282084_4282981_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007972966.1|4283277_4283847_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_007972965.1|4283987_4284983_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_007972964.1|4285354_4286050_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_042805825.1|4286198_4288268_+	M13 family metallopeptidase	NA	A0A1V0SHG2	Klosneuvirus	25.7	1.3e-65
WP_007972962.1|4288468_4289395_-	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_080720651.1|4289859_4290549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007972960.1|4290718_4292314_-	APC family permease	NA	NA	NA	NA	NA
WP_007972959.1|4292622_4292994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007965134.1|4293171_4293948_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_042805824.1|4293944_4295258_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	32.5	4.4e-22
WP_007972955.1|4295565_4296780_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_022560070.1|4297095_4297290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007972952.1|4297772_4298279_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_042805823.1|4298417_4299317_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_007972948.1|4299399_4299738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007965129.1|4299876_4300449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007972946.1|4300900_4304443_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_007972943.1|4304652_4305033_+	response regulator	NA	NA	NA	NA	NA
WP_042805821.1|4305026_4305269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033481013.1|4305265_4306549_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_042805820.1|4307083_4307365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007962146.1|4307547_4308528_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	1.8e-100
WP_007969744.1|4308815_4310225_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_007969742.1|4310215_4311238_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_172955872.1|4311342_4311552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042805174.1|4311699_4312341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007969739.1|4312569_4313436_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	47.1	1.7e-59
WP_007969738.1|4313870_4315040_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	43.4	2.2e-73
WP_088370744.1|4315590_4316677_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_007971579.1|4318616_4319768_+	beta-glucosidase	NA	NA	NA	NA	NA
WP_042805510.1|4319764_4321540_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	3.7e-40
WP_003490054.1|4321728_4321911_-	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_007971575.1|4322012_4322627_-	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
WP_007971572.1|4322893_4324057_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.3	4.1e-11
WP_042805509.1|4324139_4324322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082336445.1|4324722_4325037_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_172955932.1|4325070_4325268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042805508.1|4325706_4325919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173362034.1|4326246_4326996_+	DUF3348 domain-containing protein	NA	NA	NA	NA	NA
WP_007971565.1|4327006_4329664_+	DUF802 domain-containing protein	NA	NA	NA	NA	NA
WP_007962999.1|4329660_4330332_+	OmpA family protein	NA	NA	NA	NA	NA
WP_007971562.1|4330328_4330994_+	DUF2894 domain-containing protein	NA	NA	NA	NA	NA
WP_007971560.1|4331326_4333468_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_007971559.1|4333553_4334822_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_007971557.1|4334821_4336258_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_007971555.1|4336268_4336991_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	8.4e-15
WP_007971554.1|4337233_4339087_+	M14 family metallopeptidase	NA	NA	NA	NA	NA
WP_042674847.1|4339108_4340053_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_098477673.1|4340600_4341702_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	1.3e-43
WP_088370744.1|4341868_4342956_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_131438818.1|4343695_4344844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050780408.1|4344840_4345302_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_007975391.1|4345351_4346335_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	4366602	4471469	5191653	portal,tail,terminase,head,tRNA,capsid,transposase,protease	Xanthomonas_virus(19.51%)	115	NA	NA
WP_088370862.1|4366602_4369437_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	34.4	5.1e-132
WP_007962146.1|4370910_4371891_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	1.8e-100
WP_042805331.1|4374270_4376244_+	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	3.5e-15
WP_007970423.1|4376551_4376935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007970422.1|4377757_4378240_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_007964195.1|4378236_4378692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005913472.1|4378714_4379488_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_007964196.1|4379619_4380021_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_042805328.1|4380365_4382060_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_007970417.1|4382203_4382665_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_007962040.1|4383814_4385074_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_007962042.1|4385242_4386355_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_007969506.1|4386440_4387277_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.4	4.5e-12
WP_003484185.1|4387279_4388206_+	MCE family protein	NA	NA	NA	NA	NA
WP_022559971.1|4388202_4388847_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_007971522.1|4389309_4389906_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	34.3	9.6e-25
WP_007971521.1|4390021_4391671_+	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_007962677.1|4391701_4392334_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_007962676.1|4392333_4393065_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_007971520.1|4393199_4394546_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.1	7.5e-33
WP_007971519.1|4394592_4395996_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.8	7.2e-47
WP_007971518.1|4396270_4397437_-	nucleotide sugar dehydrogenase	NA	M1HZB2	Paramecium_bursaria_Chlorella_virus	58.4	1.9e-117
WP_007962671.1|4397777_4398677_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.2	4.1e-27
WP_007971517.1|4398673_4399231_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.3	3.9e-44
WP_007971516.1|4399227_4400115_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.4	1.5e-93
WP_007971515.1|4400166_4401222_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	45.0	3.2e-79
WP_007962558.1|4401427_4402174_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_007971513.1|4402173_4403118_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_007962553.1|4403133_4404120_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_042674680.1|4404222_4405611_+	UbiA family prenyltransferase	NA	NA	NA	NA	NA
WP_007962550.1|4405610_4406912_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_007971506.1|4406914_4407643_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_007971505.1|4407644_4408589_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_007971504.1|4408611_4409907_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007961930.1|4409903_4410302_+	GtrA family protein	NA	NA	NA	NA	NA
WP_088370744.1|4411210_4412298_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_131438929.1|4412563_4413103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007975738.1|4413089_4413638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007969091.1|4413704_4414667_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_131454201.1|4414729_4415185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088370864.1|4415308_4415665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088370865.1|4415740_4416391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007972139.1|4416392_4417070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007972140.1|4417069_4417381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042805609.1|4417377_4421775_-	hypothetical protein	NA	C4ML20	Xanthomonas_virus	50.6	0.0e+00
WP_007972142.1|4421765_4422158_-	hypothetical protein	NA	Q2NPH1	Xanthomonas_virus	52.8	2.4e-32
WP_007972143.1|4422157_4422625_-	DUF1833 family protein	NA	Q52PL0	Xanthomonas_phage	45.8	6.8e-34
WP_157883153.1|4422621_4422981_-	hypothetical protein	NA	A5H1M2	Xanthomonas_virus	41.5	3.1e-18
WP_007972144.1|4422977_4425845_-|tail	phage tail tape measure protein	tail	A5H1M1	Xanthomonas_virus	29.1	4.7e-77
WP_050780443.1|4425841_4426102_-	DUF1799 domain-containing protein	NA	I6PD79	Cronobacter_phage	39.7	2.1e-08
WP_007972145.1|4426149_4426452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042805631.1|4426448_4427093_-|tail	phage tail protein	tail	A0A0H5BBY3	Pseudomonas_phage	58.4	4.8e-62
WP_007972147.1|4427207_4427708_-	HNH endonuclease	NA	A5H1K2	Xanthomonas_virus	42.1	9.5e-26
WP_007972148.1|4427717_4428071_-	DUF3168 domain-containing protein	NA	C4ML11	Xanthomonas_virus	35.3	1.2e-11
WP_100084204.1|4428067_4428529_-	HK97 gp10 family phage protein	NA	I7GSL4	Xanthomonas_virus	43.4	5.9e-22
WP_042805612.1|4428521_4428872_-|head	phage head closure protein	head	Q7Y5K6	Xanthomonas_virus	37.0	2.3e-10
WP_007972155.1|4428868_4429288_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_042805614.1|4429291_4429801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007972156.1|4429860_4431105_-|capsid	phage major capsid protein	capsid	C7BGH0	Burkholderia_phage	42.9	3.6e-82
WP_042805615.1|4431172_4431910_-|protease	Clp protease ClpP	protease	C7BGG9	Burkholderia_phage	52.8	2.4e-49
WP_173362039.1|4431875_4433198_-|portal	phage portal protein	portal	C7BGG8	Burkholderia_phage	37.6	1.3e-61
WP_042805617.1|4433197_4434874_-|terminase	terminase large subunit	terminase	A0A0U4B0C7	Pseudomonas_phage	71.5	8.5e-236
WP_042805618.1|4434876_4435257_-	hypothetical protein	NA	A0A0U4JIP6	Pseudomonas_phage	57.1	9.4e-34
WP_007972163.1|4435354_4435783_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_162829049.1|4435782_4435929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042805619.1|4435925_4436132_-	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	45.9	2.4e-07
WP_162045088.1|4436128_4436293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131438860.1|4436295_4436589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100084205.1|4436606_4438016_-	SGNH/GDSL hydrolase family protein	NA	Q52PM7	Xanthomonas_phage	38.5	4.7e-62
WP_162269065.1|4437943_4438474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042805621.1|4438698_4438917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007972169.1|4438913_4439417_-	hypothetical protein	NA	Q2NPA5	Xanthomonas_phage	40.0	2.1e-20
WP_007972171.1|4439413_4440070_-	glycoside hydrolase family 19 protein	NA	A0A1B0Z086	Pseudomonas_phage	45.4	4.9e-38
WP_042805622.1|4440817_4441108_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	50.5	1.3e-19
WP_007972174.1|4441140_4441446_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_042805623.1|4441528_4442047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088370866.1|4442043_4442451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100084206.1|4442440_4443790_-	AAA family ATPase	NA	O80281	Escherichia_phage	32.5	1.5e-49
WP_042805625.1|4443786_4444086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042805626.1|4444637_4444832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042805627.1|4444828_4445167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007972180.1|4445391_4445700_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042805628.1|4445781_4446459_+	helix-turn-helix transcriptional regulator	NA	E5AGE6	Erwinia_phage	29.5	1.3e-17
WP_157883186.1|4446461_4446605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007969091.1|4446690_4447653_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_131454203.1|4447873_4448257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088370868.1|4448441_4448708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088370744.1|4448704_4449792_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_007972876.1|4449934_4450252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042805804.1|4450356_4450578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007972878.1|4450583_4451033_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042805805.1|4451322_4452009_+	phage antirepressor KilAC domain-containing protein	NA	A0A1B0YZY9	Pseudomonas_phage	38.7	2.6e-26
WP_007972882.1|4452005_4452455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042805807.1|4452451_4452634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131438881.1|4452626_4452884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007972887.1|4452894_4453269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007972889.1|4453265_4453952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042805810.1|4453941_4454298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007972892.1|4454284_4454677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157883152.1|4454666_4454843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042805811.1|4454823_4455066_+	AlpA family phage regulatory protein	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	36.8	1.2e-05
WP_007964253.1|4455670_4455991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007972894.1|4456183_4458061_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_007972896.1|4458169_4458610_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_007972901.1|4458608_4459622_+	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_007964247.1|4459818_4460340_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_007972904.1|4460585_4461719_+	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	40.9	6.1e-28
WP_007972905.1|4461857_4462334_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_007964242.1|4462330_4463836_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_080720841.1|4463939_4464998_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_007972908.1|4464998_4465823_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_007972910.1|4466020_4467298_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_007972912.1|4467463_4469185_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_007964231.1|4469235_4470546_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_007972915.1|4470545_4471469_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
>prophage 25
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	4697683	4715997	5191653	transposase	Pseudomonas_phage(56.25%)	29	NA	NA
WP_007974155.1|4697683_4698604_-	hypothetical protein	NA	Q6QID9	Burkholderia_phage	32.8	8.1e-23
WP_042806087.1|4698618_4698924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042806086.1|4699075_4699309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042806085.1|4699305_4699515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042806084.1|4699642_4700077_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042806082.1|4700099_4700486_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_042806080.1|4700486_4700711_-	hypothetical protein	NA	A0A1L2CVJ2	Pectobacterium_phage	52.7	2.9e-14
WP_042806114.1|4700900_4701626_+	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	49.2	2.7e-37
WP_157883171.1|4701622_4702042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131469762.1|4702079_4702325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007974147.1|4702321_4702633_+	hypothetical protein	NA	Q5ZQY8	Pseudomonas_phage	38.9	8.3e-12
WP_042806113.1|4702640_4702937_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	63.3	1.8e-32
WP_042806074.1|4702941_4703493_+	DUF3486 family protein	NA	Q6QIC2	Burkholderia_phage	47.8	4.0e-33
WP_007974143.1|4703496_4705218_+	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	41.9	7.7e-99
WP_007974141.1|4705214_4706744_+	DUF935 family protein	NA	A0A0S4L5M4	Pseudomonas_phage	58.3	6.0e-164
WP_007974140.1|4706747_4708022_+	hypothetical protein	NA	J9STS2	Pseudomonas_phage	60.9	3.7e-82
WP_042806071.1|4708021_4708597_+	phage virion morphogenesis protein	NA	Q5ZQY1	Pseudomonas_phage	47.9	1.7e-31
WP_042806069.1|4708812_4709961_+	hypothetical protein	NA	A0A0S4L0J5	Pseudomonas_phage	47.7	2.7e-76
WP_042806067.1|4709989_4710337_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_007974137.1|4710406_4711354_+	hypothetical protein	NA	R9U4B8	Rhizobium_phage	41.3	6.6e-60
WP_088409559.1|4711508_4711790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007974136.1|4711861_4712392_+	DUF1320 domain-containing protein	NA	Q5ZQX5	Pseudomonas_phage	41.9	4.2e-32
WP_007974135.1|4712388_4712859_+	hypothetical protein	NA	A0A0S4L2X9	Pseudomonas_phage	46.6	3.5e-30
WP_042806063.1|4712855_4713107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007974134.1|4713108_4713864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007974133.1|4713863_4714376_+	hypothetical protein	NA	A0A0S4L2X3	Pseudomonas_phage	39.4	4.0e-19
WP_162829052.1|4714417_4714558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088370872.1|4714561_4714846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088370873.1|4714910_4715997_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.4	3.2e-42
>prophage 26
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	4820287	4878385	5191653	transposase,plate	uncultured_virus(25.0%)	34	NA	NA
WP_007969091.1|4820287_4821250_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_007969091.1|4821812_4822775_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_007970822.1|4822979_4825784_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.1	7.4e-67
WP_003487371.1|4825860_4826151_+	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_007970826.1|4826461_4827505_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_042805413.1|4827554_4834694_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_042676013.1|4834705_4836382_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_007970830.1|4836378_4836840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007970832.1|4836836_4840532_-	protein kinase	NA	Q0N495	Clanis_bilineata_nucleopolyhedrovirus	29.9	9.3e-09
WP_042805414.1|4840536_4841253_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_033485573.1|4841249_4841825_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_007972979.1|4841821_4845352_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_042805829.1|4845348_4846629_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_007967095.1|4846610_4847945_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_007967097.1|4848447_4849338_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_082332431.1|4849588_4850470_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007967101.1|4850528_4851854_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_007967103.1|4852137_4852686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007972985.1|4852682_4854650_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.5	2.3e-38
WP_007972987.1|4854799_4856131_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_007972988.1|4856360_4856675_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_007967112.1|4859052_4859592_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_022560311.1|4859941_4860469_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_007972993.1|4860465_4861536_+	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_042805830.1|4862001_4864887_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_007972997.1|4864990_4866292_+	histidine-type phosphatase	NA	NA	NA	NA	NA
WP_007967121.1|4866362_4867667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007973001.1|4868284_4869028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007973002.1|4869432_4871460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042805832.1|4871772_4872036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007969091.1|4872247_4873210_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_007969091.1|4873522_4874485_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_088370877.1|4874544_4877289_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.2	8.8e-81
WP_042805202.1|4877344_4878385_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 27
NZ_CP011160	Xanthomonas citri pv. aurantifolii strain FDC 1559 chromosome, complete genome	5191653	5066472	5116961	5191653	tail,transposase	Ralstonia_phage(12.5%)	34	NA	NA
WP_007962146.1|5066472_5067453_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	1.8e-100
WP_005917020.1|5067692_5068322_+	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	3.3e-52
WP_007965298.1|5068706_5069951_+	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_007965295.1|5070109_5071711_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_088370746.1|5071849_5072937_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
WP_007965291.1|5074620_5075436_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.0	5.4e-18
WP_007972253.1|5081704_5082886_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_042805659.1|5082967_5084872_-	GAF domain-containing protein	NA	B5LWN8	Feldmannia_species_virus	28.2	3.3e-18
WP_007964950.1|5084868_5085462_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_088370880.1|5087279_5089442_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_033481624.1|5089626_5089833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082336471.1|5090025_5090412_-	YchJ family protein	NA	NA	NA	NA	NA
WP_082336472.1|5090448_5091327_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_007972260.1|5091362_5095385_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_022560433.1|5096158_5096860_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_007964964.1|5096846_5098316_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_003489347.1|5098335_5098938_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	49.0	3.1e-47
WP_007964968.1|5099068_5099521_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082332286.1|5099609_5099828_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_022560435.1|5099824_5100757_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_007964972.1|5100753_5102214_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_042805665.1|5102210_5104532_+	FUSC family protein	NA	NA	NA	NA	NA
WP_007964975.1|5104770_5106132_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.1	1.9e-31
WP_007964977.1|5106884_5107787_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007964979.1|5107887_5108721_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_007964982.1|5109550_5110816_+	cardiolipin synthase B	NA	NA	NA	NA	NA
WP_007972266.1|5110839_5111367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022560440.1|5111637_5111844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057663950.1|5111830_5112937_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_040964294.1|5113142_5113631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007969091.1|5113949_5114912_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_007968268.1|5115216_5115753_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_007968270.1|5115813_5116341_-|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	28.0	1.0e-09
WP_007969699.1|5116409_5116961_-|tail	phage tail protein	tail	NA	NA	NA	NA
