The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011270	Planctomyces sp. SH-PL14, complete genome	8442773	1429284	1495684	8442773	integrase,tail,transposase	Burkholderia_phage(28.57%)	57	1429148:1429163	1499822:1499837
1429148:1429163	attL	TCTCTCCCTCTCCGCT	NA	NA	NA	NA
WP_082845966.1|1429284_1430637_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_082845967.1|1431080_1432997_+	recombinase family protein	NA	NA	NA	NA	NA
WP_156514311.1|1433468_1434899_+	AAA family ATPase	NA	U5XGM6	Phormidium_phage	25.4	1.6e-17
WP_075092096.1|1435421_1436213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156514312.1|1436193_1436964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075092098.1|1436947_1437544_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_075092099.1|1437664_1438054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075092100.1|1438162_1438378_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_075092101.1|1438370_1440098_-	exodeoxyribonuclease VII large subunit	NA	A0A2P1EJT5	Megavirus	34.7	1.1e-17
WP_082845968.1|1440132_1443285_-	error-prone DNA polymerase	NA	A0A0K1Y906	Streptomyces_phage	27.6	6.1e-102
WP_082845969.1|1443292_1444858_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_075092105.1|1445504_1446290_+	SOS response-associated peptidase	NA	C7BGE4	Burkholderia_phage	33.3	2.5e-12
WP_075092106.1|1446620_1447433_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_156514313.1|1447483_1447834_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_075092108.1|1448048_1449038_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_082845971.1|1449420_1450119_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_075092109.1|1450216_1450420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156514950.1|1450866_1451943_-	response regulator	NA	W8CYF6	Bacillus_phage	34.2	2.5e-23
WP_075092111.1|1456178_1460003_+	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	27.7	1.8e-23
WP_075092112.1|1461473_1462019_-	DUF1003 domain-containing protein	NA	NA	NA	NA	NA
WP_075092113.1|1462147_1462438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075092114.1|1462513_1462702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082845972.1|1462753_1463479_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_082845973.1|1463864_1464650_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_075092117.1|1464954_1465998_-	DUF3459 domain-containing protein	NA	NA	NA	NA	NA
WP_075092118.1|1466067_1466298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075092119.1|1466477_1467968_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_075092120.1|1467964_1468726_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.9	4.3e-38
WP_156514314.1|1469117_1469843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075092122.1|1469947_1474009_-	serine/threonine protein kinase	NA	M1PWP3	Moumouvirus	29.5	6.6e-16
WP_075092123.1|1474021_1474594_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_156514315.1|1474969_1475983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075092125.1|1476293_1476851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075092126.1|1476906_1477386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156514316.1|1477382_1477592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075092119.1|1478039_1479530_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_075092120.1|1479526_1480288_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.9	4.3e-38
WP_082846731.1|1480481_1481159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082845975.1|1481563_1482463_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_075092131.1|1482389_1482791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075092132.1|1482787_1483381_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_082845977.1|1483285_1484017_+|tail	lamin tail domain-containing protein	tail	NA	NA	NA	NA
WP_075092134.1|1484082_1484406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075092135.1|1484452_1485136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156514317.1|1485259_1486102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075092137.1|1486094_1487702_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_075092138.1|1487714_1488137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075092139.1|1488126_1490052_-	DEAD/DEAH box helicase	NA	A0A2L0WU59	Oxyplax_ochracea_nucleopolyhedrovirus	24.9	3.6e-28
WP_075092140.1|1490186_1490462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075096949.1|1490615_1491875_+	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	56.9	9.5e-123
WP_075092141.1|1491867_1492359_+	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	57.7	2.1e-46
WP_082845978.1|1492321_1493578_+	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	35.0	7.5e-19
WP_075092143.1|1493715_1493937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156514318.1|1493933_1494131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156514319.1|1494136_1494574_-	hypothetical protein	NA	A0A2I7RR53	Vibrio_phage	36.3	4.4e-11
WP_075092145.1|1494570_1494894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082845979.1|1495255_1495684_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
1499822:1499837	attR	TCTCTCCCTCTCCGCT	NA	NA	NA	NA
>prophage 2
NZ_CP011270	Planctomyces sp. SH-PL14, complete genome	8442773	2271985	2327957	8442773	tRNA,transposase	Escherichia_phage(25.0%)	42	NA	NA
WP_082846057.1|2271985_2273020_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075092650.1|2273267_2273966_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_082846058.1|2274088_2274370_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_075092651.1|2274546_2276262_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	56.2	2.1e-173
WP_075092652.1|2276704_2277988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156514365.1|2278111_2279593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082846059.1|2279970_2281944_+	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_075092657.1|2282315_2283227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082846060.1|2283867_2284821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075092659.1|2285069_2285753_+	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_075092660.1|2286103_2287594_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_075092661.1|2287729_2288200_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_075092662.1|2288515_2291041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075092663.1|2291224_2291821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075092664.1|2292530_2293481_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_075092665.1|2293595_2294042_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_156514366.1|2294236_2295157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075092667.1|2295455_2297342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156514367.1|2297381_2299433_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_156514368.1|2299571_2300444_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_075092670.1|2300456_2302682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082846062.1|2302816_2304694_+	TolC family protein	NA	NA	NA	NA	NA
WP_075097020.1|2305454_2306117_+	hypothetical protein	NA	M1I1N9	Paramecium_bursaria_Chlorella_virus	28.1	7.0e-08
WP_156514369.1|2306322_2306556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156514370.1|2307454_2308594_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075092672.1|2308687_2309278_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	22.4	1.4e-12
WP_075092673.1|2309304_2309559_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_075092674.1|2309638_2310019_-	carboxylesterase family protein	NA	NA	NA	NA	NA
WP_082846063.1|2310053_2311460_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075092676.1|2311570_2312932_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075092677.1|2313245_2313887_-	Holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
WP_075092678.1|2314249_2315266_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_075092679.1|2315429_2315762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075092680.1|2315901_2317785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075092681.1|2317877_2318249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075092682.1|2318245_2318476_-	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_075092683.1|2319073_2320075_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_082846754.1|2320249_2321479_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_082846064.1|2322388_2322712_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_075092686.1|2322794_2324822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075092687.1|2325387_2326206_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.1	8.0e-14
WP_075091179.1|2326571_2327957_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP011270	Planctomyces sp. SH-PL14, complete genome	8442773	2697288	2745328	8442773	protease,transposase	Paenibacillus_phage(50.0%)	30	NA	NA
WP_082846112.1|2697288_2699976_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_075092961.1|2699977_2701573_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_075092962.1|2701619_2701859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075092963.1|2701915_2702515_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075092964.1|2702875_2703289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075092965.1|2703554_2712656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156514252.1|2713860_2714391_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	38.0	1.1e-16
WP_156514253.1|2714134_2714707_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082846063.1|2714802_2716209_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_156514402.1|2716273_2717083_+	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_075097050.1|2717384_2718404_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_075092966.1|2718400_2718727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075092967.1|2718881_2720273_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_082846114.1|2720311_2721271_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_075092969.1|2721671_2722721_-	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_075092970.1|2722856_2723330_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_075092971.1|2723859_2725527_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_082846115.1|2725640_2726411_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_075092973.1|2726459_2727479_-	sugar isomerase	NA	NA	NA	NA	NA
WP_082846766.1|2727905_2729945_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	36.8	1.2e-106
WP_075092975.1|2729945_2730824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075092976.1|2730943_2732551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075092977.1|2732547_2735130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075092978.1|2735126_2738963_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_075092979.1|2739038_2739737_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075092980.1|2739882_2740353_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075092981.1|2740349_2740991_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075092982.1|2741076_2741979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075092983.1|2742310_2743528_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_082846116.1|2743921_2745328_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP011270	Planctomyces sp. SH-PL14, complete genome	8442773	5426396	5485364	8442773	head,integrase,tRNA,terminase,portal,capsid,tail,protease	uncultured_Caudovirales_phage(12.5%)	51	5416079:5416098	5481752:5481771
5416079:5416098	attL	CCGGAGCGCGGCCTTCACCG	NA	NA	NA	NA
WP_075094732.1|5426396_5427254_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_156514654.1|5427640_5430778_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_075094734.1|5431015_5431564_-	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	44.3	3.8e-28
WP_082846389.1|5431895_5432921_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_075094735.1|5433357_5435295_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_075094736.1|5435291_5435795_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_075094737.1|5436283_5437549_-	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_075094738.1|5437633_5437831_-	carbon storage regulator CsrA	NA	NA	NA	NA	NA
WP_075094739.1|5438232_5439066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082846390.1|5439847_5442274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075094741.1|5442435_5443461_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_075094742.1|5443747_5444167_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_156514655.1|5444284_5446135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075094745.1|5447603_5448944_-	DUF1552 domain-containing protein	NA	NA	NA	NA	NA
WP_075094746.1|5449045_5451661_-	DUF1592 domain-containing protein	NA	NA	NA	NA	NA
WP_075094747.1|5452190_5453099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075094748.1|5453239_5454016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075094749.1|5454616_5454910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075094750.1|5455018_5455588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156514656.1|5455832_5456921_+	galactose oxidase	NA	NA	NA	NA	NA
WP_075094752.1|5457449_5458712_+	MFS transporter	NA	NA	NA	NA	NA
WP_075094753.1|5459177_5459429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075094754.1|5459685_5461191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156514657.1|5461328_5461619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082846392.1|5461812_5462979_-|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	27.3	2.2e-25
WP_075094756.1|5462941_5463169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075094757.1|5463608_5464004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075094758.1|5464154_5464448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075094759.1|5465060_5465486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075094760.1|5465482_5466439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075094761.1|5466442_5467228_-	hypothetical protein	NA	M9MUU1	Rhodococcus_phage	31.4	4.2e-20
WP_075094762.1|5467237_5467597_-	hypothetical protein	NA	A0A1V0DY68	Dinoroseobacter_phage	47.5	4.2e-07
WP_075094763.1|5467593_5467986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082846393.1|5467982_5469737_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_075094765.1|5469721_5471803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075094766.1|5471799_5472888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156514658.1|5472887_5474639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075094768.1|5474871_5475189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075094769.1|5475260_5475656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075094770.1|5475698_5476109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075094771.1|5476139_5476691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075094772.1|5476690_5477152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082846394.1|5477148_5477484_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_075094774.1|5477480_5478071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075094775.1|5478115_5478727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075094776.1|5478802_5479261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075094777.1|5479342_5479558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075094778.1|5479627_5480995_-|capsid	phage major capsid protein	capsid	A0A0F7L2V9	uncultured_marine_virus	38.7	9.8e-49
WP_082846395.1|5481196_5481862_-|protease	Clp protease ClpP	protease	A0A142K8P6	Gordonia_phage	40.2	1.4e-32
5481752:5481771	attR	CCGGAGCGCGGCCTTCACCG	NA	NA	NA	NA
WP_082846396.1|5481858_5483649_-|portal	phage portal protein	portal	A0A0A7RUE7	Clostridium_phage	26.7	9.9e-41
WP_082846397.1|5483519_5485364_-|terminase	terminase large subunit	terminase	C7BGG7	Burkholderia_phage	31.7	5.7e-60
